ID: 1159903016

View in Genome Browser
Species Human (GRCh38)
Location 18:74065885-74065907
Sequence AGGAATCCACAGTGGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159903016_1159903026 24 Left 1159903016 18:74065885-74065907 CCCTTCACCCACTGTGGATTCCT No data
Right 1159903026 18:74065932-74065954 AGGCAGTACCTGCAGCTGGTGGG No data
1159903016_1159903023 4 Left 1159903016 18:74065885-74065907 CCCTTCACCCACTGTGGATTCCT No data
Right 1159903023 18:74065912-74065934 CCATTAAGTGGAGCAGAGCAAGG No data
1159903016_1159903024 20 Left 1159903016 18:74065885-74065907 CCCTTCACCCACTGTGGATTCCT No data
Right 1159903024 18:74065928-74065950 AGCAAGGCAGTACCTGCAGCTGG No data
1159903016_1159903025 23 Left 1159903016 18:74065885-74065907 CCCTTCACCCACTGTGGATTCCT No data
Right 1159903025 18:74065931-74065953 AAGGCAGTACCTGCAGCTGGTGG No data
1159903016_1159903020 -8 Left 1159903016 18:74065885-74065907 CCCTTCACCCACTGTGGATTCCT No data
Right 1159903020 18:74065900-74065922 GGATTCCTAAAGCCATTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159903016 Original CRISPR AGGAATCCACAGTGGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr