ID: 1159903464

View in Genome Browser
Species Human (GRCh38)
Location 18:74069339-74069361
Sequence GTGTGGAGAGGGGCTTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159903464_1159903468 -10 Left 1159903464 18:74069339-74069361 CCACAGCAAGCCCCTCTCCACAC No data
Right 1159903468 18:74069352-74069374 CTCTCCACACCCTTTACACGAGG No data
1159903464_1159903474 10 Left 1159903464 18:74069339-74069361 CCACAGCAAGCCCCTCTCCACAC No data
Right 1159903474 18:74069372-74069394 AGGGACTCTTGTGCAACCCTGGG No data
1159903464_1159903475 24 Left 1159903464 18:74069339-74069361 CCACAGCAAGCCCCTCTCCACAC No data
Right 1159903475 18:74069386-74069408 AACCCTGGGCTCTTGTGAAATGG No data
1159903464_1159903469 -9 Left 1159903464 18:74069339-74069361 CCACAGCAAGCCCCTCTCCACAC No data
Right 1159903469 18:74069353-74069375 TCTCCACACCCTTTACACGAGGG No data
1159903464_1159903473 9 Left 1159903464 18:74069339-74069361 CCACAGCAAGCCCCTCTCCACAC No data
Right 1159903473 18:74069371-74069393 GAGGGACTCTTGTGCAACCCTGG No data
1159903464_1159903476 25 Left 1159903464 18:74069339-74069361 CCACAGCAAGCCCCTCTCCACAC No data
Right 1159903476 18:74069387-74069409 ACCCTGGGCTCTTGTGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159903464 Original CRISPR GTGTGGAGAGGGGCTTGCTG TGG (reversed) Intergenic
No off target data available for this crispr