ID: 1159908212

View in Genome Browser
Species Human (GRCh38)
Location 18:74117873-74117895
Sequence GTCTAGAACTTCAGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159908212_1159908215 9 Left 1159908212 18:74117873-74117895 CCCTCTTCTCTGAAGTTCTAGAC 0: 1
1: 0
2: 1
3: 14
4: 215
Right 1159908215 18:74117905-74117927 AGACAGACCTAGCACCTAACAGG 0: 1
1: 0
2: 1
3: 7
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159908212 Original CRISPR GTCTAGAACTTCAGAGAAGA GGG (reversed) Intronic
902290882 1:15433868-15433890 GTCTAGAACCTCACGGAAGGAGG + Intergenic
906847212 1:49206150-49206172 GTCTAGAACTGTTGGGAAGAGGG + Intronic
907061572 1:51431558-51431580 GTCTCGGCCTTCAGAGAAGCTGG + Intronic
907731551 1:57071336-57071358 GTCTAGAGTTTAAGAGAATAAGG + Intronic
910368146 1:86488128-86488150 GCCTAGAATCTCAGAAAAGAAGG - Intronic
910368150 1:86488163-86488185 GCCTAGAATCTCAGATAAGAAGG - Intronic
912574496 1:110653720-110653742 GACAAGAACATCAGAGAACATGG + Intergenic
914706374 1:150173258-150173280 GTCTGGAACTCCACAGGAGAAGG - Intergenic
915785731 1:158609376-158609398 ATTGAGAACTTCAGAGTAGATGG - Intergenic
921556475 1:216604279-216604301 ATCTAGAAGCTCAGTGAAGAGGG + Intronic
923346983 1:233063740-233063762 GTCTAGAAGTTCCTGGAAGAAGG - Intronic
924276025 1:242388141-242388163 GTCTAATACTTCATTGAAGAAGG - Intronic
924827512 1:247556327-247556349 GTCTAGAAAGTTAGAGAAGAAGG + Intronic
1062942212 10:1432420-1432442 GTGTAAAACTTCAGAGAATTAGG - Intronic
1064011624 10:11741049-11741071 GCCTAGGACTTCAGATGAGAGGG + Intergenic
1065225584 10:23540497-23540519 GCCAAAATCTTCAGAGAAGAAGG - Intergenic
1065276990 10:24095483-24095505 TTCTGGAAATTAAGAGAAGAAGG - Intronic
1067828548 10:49596887-49596909 GTCTAAGATTTCAGAGAAAAAGG + Intergenic
1068117472 10:52750765-52750787 GGCTAGAGATTCAGTGAAGAGGG + Intergenic
1068931138 10:62591948-62591970 GGCTACAACTTCTGAGATGAAGG - Intronic
1070081186 10:73189665-73189687 GTCTAGAACTTCATATAATTGGG - Intronic
1074233056 10:111556781-111556803 ATCTATAACTTCAGAACAGATGG + Intergenic
1075090213 10:119440070-119440092 GTCCAGAATTTCAGAGATGCTGG + Intronic
1075747587 10:124738435-124738457 TTCTAGAAGTTCAGAGCACAGGG + Intronic
1075866956 10:125731305-125731327 ATCTAGATCATCAGAGAAGGGGG + Intronic
1077376685 11:2208579-2208601 GTTTGGAATATCAGAGAAGAGGG + Intergenic
1077713470 11:4558404-4558426 GCCTAAAACTTCAGAGACAAGGG + Intergenic
1078965930 11:16342276-16342298 GTGTATAACTTAACAGAAGAGGG + Intronic
1079676201 11:23230047-23230069 GTCTTGAACTTCTGAGAAATGGG + Intergenic
1080021176 11:27561697-27561719 GTGTAGAAGTGCAGAGATGATGG - Intergenic
1080132318 11:28811287-28811309 TATTTGAACTTCAGAGAAGACGG + Intergenic
1085729517 11:78984325-78984347 ATCTAGCCCTTCAGAGAAGGGGG - Intronic
1086245556 11:84747918-84747940 GTCTAGAAGTGCAGATAAGTGGG - Intronic
1086331138 11:85755558-85755580 ATCTACAACTTCAGCGAAAATGG - Intronic
1086439634 11:86815214-86815236 GCATTGAATTTCAGAGAAGATGG - Intronic
1089633113 11:119795842-119795864 TTCTAGAAATGCAGAGAAGGAGG + Intergenic
1093857281 12:24121167-24121189 ATCAAGAACTTAAGAGAAAATGG + Intergenic
1094836295 12:34323667-34323689 AAATGGAACTTCAGAGAAGAGGG - Intergenic
1098421840 12:70305833-70305855 ACCAAGAACTTCAGAGAAGACGG - Intronic
1100234544 12:92647031-92647053 TTCTAGAAAATCAAAGAAGAGGG + Intergenic
1101172366 12:102111203-102111225 TTCTAGAACTTCATATAAGTGGG - Intronic
1101695267 12:107119621-107119643 ACCTAGAATCTCAGAGAAGAGGG - Intergenic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1104829165 12:131736715-131736737 GTCTAAGACTTAGGAGAAGACGG + Intronic
1106095421 13:26639204-26639226 GTCTACAACTTCAGAAAAGACGG - Intronic
1109248105 13:59983024-59983046 GCCTATAACTTCAAAGAAAATGG - Intronic
1109906722 13:68852798-68852820 GTATAGAAATTGAGAGTAGAGGG - Intergenic
1110543733 13:76733997-76734019 GTGTGGAACTTCAGAGAAAATGG - Intergenic
1112482002 13:99784832-99784854 GGATAGCACTTCAGAGAACATGG + Intronic
1112962743 13:105147621-105147643 GTCTAGCACTTCACAGAATCTGG - Intergenic
1113431470 13:110255243-110255265 GTCTAAAAGTTTAGAGATGAGGG + Intronic
1113481350 13:110624191-110624213 GTCAAAAACTTCTGAGAATAAGG - Intronic
1114447106 14:22797241-22797263 GCCTAGAACTTCAGAGCACTGGG + Intronic
1114640884 14:24219811-24219833 GTCTTGAAGTTTGGAGAAGAAGG - Intronic
1115700302 14:35946849-35946871 GTATAGAATAGCAGAGAAGAGGG + Intergenic
1115828963 14:37313080-37313102 GGCTAGATATTAAGAGAAGATGG - Intronic
1117982739 14:61358036-61358058 GTCTCTAAATTCAGAAAAGAAGG - Intronic
1119910570 14:78345956-78345978 GTCAGGGACTTCTGAGAAGATGG + Intronic
1120088282 14:80300809-80300831 GTATAGACATTCAGGGAAGATGG + Intronic
1120303423 14:82737097-82737119 GATTAGAACTCCAGAGGAGAAGG - Intergenic
1120994803 14:90408986-90409008 GTCTAAAGCCTCAGAGCAGAGGG - Intergenic
1123387276 15:19826138-19826160 GTCTAGTTCTTAAGTGAAGATGG + Intergenic
1124933095 15:34143008-34143030 GTATAGAAATTGAAAGAAGAGGG - Intronic
1126413609 15:48396112-48396134 TTCTAGAACTTCAGAGCACACGG + Intergenic
1128051435 15:64668226-64668248 GACTTCCACTTCAGAGAAGATGG + Intronic
1128551433 15:68600467-68600489 GTCTAGGACCCCAGAGAGGAGGG - Intronic
1129942281 15:79508879-79508901 ATTAAGATCTTCAGAGAAGAAGG - Intergenic
1132382829 15:101378685-101378707 GTAGAGAACATCAGGGAAGAGGG - Intronic
1135687004 16:24505885-24505907 GACTAGAAATTCAGCAAAGATGG + Intergenic
1139204364 16:65012870-65012892 TCTTAGAAATTCAGAGAAGAAGG - Intronic
1140399369 16:74658170-74658192 GTCTAGGACTACAGAGAGTAGGG - Intronic
1142402074 16:89864303-89864325 GTGTAGAACTCCAGAGGAGAGGG + Intronic
1143485057 17:7249585-7249607 AGCGAGAACGTCAGAGAAGATGG + Intronic
1145916295 17:28576004-28576026 CTCTAGAAGCTGAGAGAAGAGGG - Intronic
1149155103 17:53619384-53619406 GTCTAGGACATCAAAAAAGATGG + Intergenic
1149356208 17:55842320-55842342 CTCTTGAACTTCAGAGCAAATGG + Intronic
1150295163 17:64003485-64003507 GGAAAGAACTTCAGGGAAGAGGG + Intronic
1151086150 17:71383377-71383399 GTCTTGAAATTCAGAGAATTAGG - Intergenic
1153368480 18:4286510-4286532 CTCCAGAATTTCAGAGCAGAAGG + Intronic
1153807677 18:8723569-8723591 GTCTAGGGCTTCAGAGAGAAGGG - Intronic
1154148354 18:11885321-11885343 GTTTAGAAAATAAGAGAAGATGG + Exonic
1154333660 18:13449721-13449743 TTCTAAAAATTCAGAGAAAAAGG + Intronic
1155214057 18:23627110-23627132 GTTTACACTTTCAGAGAAGACGG + Intronic
1155345864 18:24855963-24855985 GTCTCGAACTTCTGAGACCAAGG - Intergenic
1155776339 18:29766636-29766658 GTCTAAAGCATCAGACAAGAGGG + Intergenic
1156903526 18:42328351-42328373 ATATAGAAATTCAGAGAAGAAGG + Intergenic
1157702080 18:49767812-49767834 GTCTGGAGCAGCAGAGAAGATGG - Intergenic
1158246214 18:55435091-55435113 GAGTAGAACTTAAGAGTAGAAGG - Intronic
1159908212 18:74117873-74117895 GTCTAGAACTTCAGAGAAGAGGG - Intronic
1164877617 19:31702671-31702693 GTCTAGCACTTCATAGAAATGGG - Intergenic
1166558641 19:43717848-43717870 GTCTTGAACTTCCGAGATCAAGG - Intronic
1166810292 19:45510057-45510079 GTCTAGAATCTCAGGGCAGAAGG + Intronic
1167323416 19:48810323-48810345 GTCTATGATTTCAGAGAACAAGG - Intronic
926148930 2:10413871-10413893 GCCTAGAACTTCACAGAAGGTGG + Intronic
926570859 2:14528487-14528509 GTCTACCAGCTCAGAGAAGAGGG - Intergenic
926583618 2:14660821-14660843 GTATAAAACTTAAGAGCAGAGGG - Intergenic
927287910 2:21376193-21376215 CTCTAGAAGTTCAGAGAAGGAGG + Intergenic
927657216 2:24959399-24959421 GTCTGGAACCTCAGAGGAGAGGG - Intronic
928124439 2:28605968-28605990 GACTAGAACCCCAGAGAACAAGG - Intronic
929678254 2:43960725-43960747 TTCTAGAAAATCAGAGAATATGG - Intronic
929932555 2:46270257-46270279 TTCTAGAACTACAGACAATATGG + Intergenic
932697036 2:73965596-73965618 GACTAGATTTTCAGAAAAGAAGG + Intergenic
932884528 2:75536914-75536936 TTCCAGAAAATCAGAGAAGAGGG + Intronic
933911465 2:86944253-86944275 GTCTATTCCTCCAGAGAAGAAGG + Intronic
934945067 2:98534880-98534902 GTTGAGAACAACAGAGAAGAAGG + Intronic
937312597 2:120911178-120911200 GTCTGGAATTTCAGAGAAATGGG + Intronic
938084990 2:128393746-128393768 GTCTAGAAGTACAGAGAGGTAGG - Intergenic
938561388 2:132475307-132475329 GTCTACTACTTCATAGAATAGGG + Intronic
940743101 2:157534793-157534815 GTCTAGAACTTCGGAACTGATGG + Intronic
941650112 2:168083428-168083450 GTCTAGAACTTGGTAGACGAAGG - Intronic
941938865 2:171011506-171011528 GAGTAGAACTTCAGTGTAGAAGG - Intronic
942929747 2:181475365-181475387 GTTTAGATGTTCAGAGGAGAGGG + Intronic
943902450 2:193457491-193457513 ATCTAGAACCTCAAGGAAGACGG + Intergenic
943983769 2:194592392-194592414 GACTAACACTTCAGAAAAGATGG - Intergenic
944212649 2:197222390-197222412 ATCAAAAACTTCAAAGAAGATGG + Intronic
944821766 2:203439835-203439857 GTCTAAAATGTCAGTGAAGAAGG - Exonic
945853503 2:215038886-215038908 GTAAAGGATTTCAGAGAAGATGG - Intronic
947204673 2:227649496-227649518 GTCTAGAAATTCAGAGGACAGGG - Intergenic
948764560 2:240212728-240212750 GACTAGAACTTCGGAGAGCAGGG - Intergenic
1170085916 20:12531385-12531407 GTTTTGAACTTGAGGGAAGAAGG + Intergenic
1170142170 20:13135618-13135640 GTTTAGATCTTCAGATAAGTGGG - Intronic
1172500520 20:35423061-35423083 CTCTTGAACCTGAGAGAAGAAGG + Intergenic
1172992282 20:39045494-39045516 GTCTAAAACCTTAGACAAGAAGG - Intergenic
1173131223 20:40395530-40395552 GTTTAGATCTTCTGAGAAGTGGG + Intergenic
1173795469 20:45856706-45856728 GTCAAGAACTTCAGCGATGCTGG + Intronic
1174945607 20:54981983-54982005 GTCTAGAAGTACAGAAAAGTAGG - Intergenic
1175926875 20:62475535-62475557 GTCTTGACCTGCAGGGAAGAGGG + Exonic
1177351103 21:19943066-19943088 GTCTAGTACTTTAGAGAATACGG + Intergenic
1179071946 21:38079820-38079842 GTCTAGGTCTTCAGAGACAAGGG + Intronic
1179297115 21:40072884-40072906 GTCTATCACCTCAGAGAACATGG - Intronic
1183171077 22:36188710-36188732 CTCTAGAACACAAGAGAAGAGGG + Intergenic
949441236 3:4083043-4083065 GTCTAGAACATTAGAGACAATGG + Intronic
954351594 3:50048724-50048746 GTATAGAACTTCAGACACCATGG + Intronic
954389867 3:50263015-50263037 GTCTGGAATTACACAGAAGACGG + Intergenic
954728838 3:52639975-52639997 GTTTAGCTCTTGAGAGAAGAGGG + Intronic
955144255 3:56300403-56300425 GGCTAGAAATGCAGAGAGGAGGG + Intronic
957401766 3:79724949-79724971 GTCTAGGATATCAAAGAAGAAGG - Intronic
959689577 3:109183955-109183977 GTCTACACCTTCATAGATGAGGG + Intergenic
961266013 3:125643464-125643486 GTCTGGAACTTGAGACAAGTGGG + Intergenic
961755346 3:129123639-129123661 GTCCAGAACTCCAGAAAACAAGG + Intronic
962146806 3:132848175-132848197 GTCTATATCTTCAAAAAAGATGG + Intergenic
963169137 3:142233349-142233371 GGCTAGGACTTCATCGAAGAAGG - Intergenic
963398572 3:144766415-144766437 GTTTAGAACATTTGAGAAGAAGG + Intergenic
964463147 3:156959424-156959446 TTCTACAACTGCAGAGAAGTTGG - Intronic
965023969 3:163274159-163274181 CTCTAGAACTTCTAAGAAAAAGG - Intergenic
966434466 3:179868096-179868118 GTCTTGAACTTCAGAGCTCAAGG + Intronic
967612151 3:191520180-191520202 GTCTTGAACTTGAGAGGTGAAGG + Intergenic
968802159 4:2750300-2750322 GTCTAGTACTTGAGGTAAGAAGG + Intronic
969682627 4:8651844-8651866 GTCAAGAAGCTCAGAGAAGCAGG - Intergenic
971213058 4:24638488-24638510 TTCTAGAACCACAGAGATGAGGG - Intergenic
971908770 4:32765792-32765814 ATCTAGAAATACAGAAAAGAAGG - Intergenic
972399620 4:38688762-38688784 GACGGGAACTTCAGAGAGGAGGG - Exonic
972555423 4:40176269-40176291 TTTTAGAACCTCAGAAAAGATGG - Intergenic
973142685 4:46788012-46788034 GTTTAGGACTTCAGGGACGAAGG + Intronic
973555785 4:52081341-52081363 TTCTAGAACTTCACAGAACAAGG + Intronic
975767475 4:77683975-77683997 GATTAGAAAGTCAGAGAAGAGGG - Intergenic
978937362 4:114394432-114394454 ATCTAGAAATCCAGAGAAGGAGG + Intergenic
980658759 4:135827843-135827865 GTCTACTACTTCACAGAAAAAGG - Intergenic
982532790 4:156567951-156567973 ATTTTGAACATCAGAGAAGAGGG - Intergenic
982657999 4:158172919-158172941 GCCTAGAAGTTCAGAAAAAAAGG + Exonic
983196024 4:164807444-164807466 TTCTATTACTCCAGAGAAGAAGG - Intergenic
985672748 5:1214692-1214714 GACCAGAATTTCAGAGCAGAAGG + Intronic
987384763 5:17318692-17318714 CTCTTGATCTTCAGAGCAGAAGG + Intergenic
987691053 5:21267662-21267684 ATATAGAACTACAGACAAGAAGG + Intergenic
987758130 5:22123535-22123557 GTCTAGAAAGCCAGAGAAAAAGG + Intronic
988501050 5:31784045-31784067 GTCTGGAAATTCAGAGCATAAGG + Intronic
989854264 5:46260470-46260492 GGAAATAACTTCAGAGAAGAAGG - Intergenic
993096087 5:83479782-83479804 GTCTTGGACTCCAAAGAAGAGGG + Intronic
997033950 5:130164595-130164617 TTCTAGATTTTCAGAAAAGATGG - Intronic
998944904 5:147328068-147328090 GACAAGTACTTCAGAGAAGTTGG + Intronic
998992364 5:147831939-147831961 ATCCAGAACTACAGAGTAGAAGG - Intergenic
999195785 5:149780680-149780702 GCCTAGAACTAGAGAGGAGATGG + Intronic
999415021 5:151387504-151387526 GCCAAGACCTACAGAGAAGATGG + Intergenic
1002776323 6:330663-330685 ATTTAGAACTTTTGAGAAGATGG + Intronic
1006269430 6:32952414-32952436 GCCAAGAGCTTCAAAGAAGAGGG - Intronic
1007232115 6:40355676-40355698 GTCTCCAACTTCAGTGGAGAGGG + Intergenic
1008460089 6:51758539-51758561 TCCTAGATCTTCAGGGAAGAGGG + Intronic
1008811184 6:55501441-55501463 GTCTGGAACTTTACAGAAAAAGG + Intronic
1012104970 6:95145691-95145713 GTCCAGAGTTTCAGAGAACAAGG + Intergenic
1012114912 6:95284935-95284957 CTCTACAATATCAGAGAAGATGG - Intergenic
1012527423 6:100194957-100194979 GTATGGGACTTCAGAGTAGATGG + Intergenic
1015960369 6:138642719-138642741 GACTAGAACAGCAGTGAAGAGGG + Intronic
1016030556 6:139333099-139333121 ATATAGAACTTTAGAAAAGAAGG + Intergenic
1016858170 6:148692913-148692935 GTATAGAACCTCAGAGGAGCAGG - Intergenic
1018107458 6:160502770-160502792 GTCAAGAACTTGAAAGATGAGGG - Intergenic
1020130711 7:5557043-5557065 TTCTAGAACTTCACATAAGTGGG - Intronic
1022755241 7:33280532-33280554 TGATAGAAATTCAGAGAAGAGGG - Intronic
1023366830 7:39473180-39473202 GTCTTGAACTTCAGAGACAGAGG + Intronic
1024413369 7:49074159-49074181 CTCTAGAACATCAGATAGGAAGG - Intergenic
1024429996 7:49277026-49277048 ATATAGAATTTCAGAGAAAAGGG + Intergenic
1027526153 7:79271177-79271199 GTCCCGGAGTTCAGAGAAGATGG - Intronic
1027951202 7:84818857-84818879 TTTTAGAACCTCAGATAAGAAGG - Intergenic
1028084766 7:86623073-86623095 GTCTAGATCTTGACAAAAGATGG + Intergenic
1031944355 7:127823401-127823423 GTCAAGAAACTCAGAAAAGAAGG - Intronic
1038806323 8:30795626-30795648 TTCTAGAACTTGGGAAAAGATGG - Intronic
1038881640 8:31620007-31620029 GTCTAGAAATACAAAGTAGAGGG - Intergenic
1039231172 8:35449911-35449933 GCCTAGAACAGCTGAGAAGAGGG - Intronic
1039374895 8:37023511-37023533 GTTAAGAACTGCAGAGATGAAGG + Intergenic
1040819342 8:51537770-51537792 ATCTAGAATTGCACAGAAGAGGG + Intronic
1041475106 8:58256224-58256246 GTGTTGAATTGCAGAGAAGAGGG + Intergenic
1042887678 8:73569965-73569987 TTCTACAAGTTGAGAGAAGAAGG + Intronic
1042977866 8:74490837-74490859 ATTTAATACTTCAGAGAAGAAGG + Intergenic
1044464294 8:92485514-92485536 GTCTACTACTTCATGGAAGAAGG + Intergenic
1046706193 8:117455015-117455037 CTGTAGAAGTTCACAGAAGAGGG + Intergenic
1047933005 8:129749413-129749435 GGCCAGAAGTTCAGGGAAGAGGG - Intronic
1047989065 8:130266336-130266358 GTCTAGACATTCAGGGATGAGGG + Intronic
1053555413 9:39132301-39132323 GTCTTTAACTTAGGAGAAGATGG + Intronic
1053819531 9:41952552-41952574 GTCTTTAACTTAGGAGAAGACGG + Intronic
1054109798 9:61096205-61096227 GTCTTTAACTTAGGAGAAGACGG + Intergenic
1054611059 9:67234920-67234942 GTCTTTAACTTAGGAGAAGACGG - Intergenic
1055437876 9:76310635-76310657 ACCTAGAAATTCAGGGAAGAGGG - Exonic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058241470 9:102567279-102567301 GTATAGAACATCAGAGATGTGGG - Intergenic
1058272509 9:102990295-102990317 GTCTAGAACTTCAAATAAAAGGG - Intergenic
1058816334 9:108685938-108685960 GTGATGAACTTCAGAGAAGCTGG + Intergenic
1060450633 9:123735490-123735512 GACTAGGACTTCAGAGATCATGG - Intronic
1061752855 9:132792768-132792790 GTCAGGAACTGCAGAGAAGGGGG + Exonic
1186950376 X:14617886-14617908 GTCTGGAACTTCCTGGAAGAAGG + Intronic
1188129359 X:26412124-26412146 GCCAAGAATTTCAGAGAATAAGG - Intergenic
1188367152 X:29330678-29330700 GCCTAGATCTTCAGAAGAGAAGG - Intronic
1188708576 X:33365495-33365517 CTCTCGAACTTCAGAAAGGAAGG + Intergenic
1189560135 X:42183829-42183851 GTGTGGAAGTGCAGAGAAGATGG + Intergenic
1189829720 X:44958710-44958732 GTACACAACTGCAGAGAAGAAGG - Intronic
1191136215 X:57067946-57067968 GTCATGAACTCCAGGGAAGAAGG + Intergenic
1191155459 X:57267720-57267742 GCCCAGAAGTTCAGAGATGAAGG + Intergenic
1192800474 X:74460528-74460550 GTCTGGGACCTCAGAGAAGTAGG - Intronic
1195452246 X:105028843-105028865 GTCCAGAACGTTAGAGAAGTAGG + Intronic
1195618914 X:106934033-106934055 GAATAGGACTTCAGAGAGGACGG - Intronic
1197627581 X:128819917-128819939 TTCTAGAAGTTCAGGGAAGGTGG + Intergenic
1199345606 X:146734979-146735001 ATCTGGAGCTTCAGAGAAAAAGG - Intergenic
1201745048 Y:17362886-17362908 GTTTGGAACTTGAGAGAAGCTGG + Intergenic