ID: 1159909073

View in Genome Browser
Species Human (GRCh38)
Location 18:74126719-74126741
Sequence CTGGCTTGTGCCTGAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159909073_1159909078 -2 Left 1159909073 18:74126719-74126741 CCAGCACCTCAGGCACAAGCCAG 0: 1
1: 0
2: 1
3: 31
4: 290
Right 1159909078 18:74126740-74126762 AGCAGGCAATAGGAATTCAAAGG 0: 1
1: 0
2: 0
3: 18
4: 265
1159909073_1159909079 24 Left 1159909073 18:74126719-74126741 CCAGCACCTCAGGCACAAGCCAG 0: 1
1: 0
2: 1
3: 31
4: 290
Right 1159909079 18:74126766-74126788 ATTAAATAAATAAGTTAAAAAGG 0: 1
1: 0
2: 28
3: 550
4: 3349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159909073 Original CRISPR CTGGCTTGTGCCTGAGGTGC TGG (reversed) Intronic
900382717 1:2392762-2392784 CTGCCGTATGCCTGAGGTGACGG + Intronic
901517858 1:9761357-9761379 GTGGCGTGTGCCTGAGGTCCCGG + Intronic
902744592 1:18465013-18465035 CTGGGTGGAGCCTGAGGTTCAGG + Intergenic
903022666 1:20404947-20404969 CTGCCTTGGCCCTGAGTTGCTGG - Intergenic
903168487 1:21537685-21537707 CTGGCATGTGACTGAGATGGGGG + Intronic
903576155 1:24340988-24341010 CTGGCATGTGCCTGGGGGCCTGG + Intronic
904005648 1:27361809-27361831 CTGGCGTGGGCCTGAAGTGCTGG + Exonic
904319606 1:29688550-29688572 CAGGGTTCTGCCAGAGGTGCAGG - Intergenic
904433118 1:30477863-30477885 CTGGCCTGTGTCTGAAGTGGTGG - Intergenic
904785265 1:32977806-32977828 CTGGCTTGTGGCTGAGGCCGGGG + Intergenic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
905157190 1:35995065-35995087 GTGGCGTGTGCCTGTGGTCCCGG + Intronic
905371652 1:37485682-37485704 GTGGCAGGTGCCTGAGGGGCTGG + Intergenic
905548333 1:38817463-38817485 CTGGGATCTGCCTGACGTGCAGG - Intergenic
905766740 1:40607682-40607704 CTGGCTTGTCCCAGAGCTCCTGG + Intergenic
906745784 1:48221361-48221383 CTGGCCAGTGCCTGATGTTCTGG + Intergenic
907184938 1:52602389-52602411 ATGGCTTGTTCCGGAGGTGGCGG - Exonic
907655751 1:56340480-56340502 CTGCCTTGTCCCTGGGGTGGTGG - Intergenic
910646032 1:89516226-89516248 CTGAATGGTGCCTGAGCTGCAGG + Intergenic
914727372 1:150339239-150339261 GTGGCTTGTGCCTGTAGTCCTGG + Intronic
914947186 1:152078322-152078344 GTGGCTTGTGCCTGTAGTCCCGG - Intergenic
915246244 1:154558309-154558331 CTGGCTGGGGCCGGAGGGGCCGG - Exonic
916586124 1:166152086-166152108 CTGGCCAGTGCCTGGGCTGCTGG - Intronic
917487561 1:175468759-175468781 GTGGCTGGAGCCTGAGGTGGAGG + Intronic
918053009 1:180990966-180990988 CTGGCTCTTGCCTGCGGGGCTGG - Intronic
921065356 1:211618832-211618854 CAGCCCTGTGCCTGAGGAGCAGG + Intergenic
921075003 1:211693512-211693534 CTGTCTTGTGCCTAAGTAGCAGG - Intergenic
921650669 1:217674440-217674462 CTGGCTTGTGCTCCAGCTGCTGG + Intronic
922241808 1:223760294-223760316 GTGGAGTGTGTCTGAGGTGCTGG + Intronic
922504134 1:226116688-226116710 CTGGGCTGTGCCTGAGGTCCTGG - Intergenic
923145243 1:231193090-231193112 CTTGCTTCTGCCTGAGAGGCAGG - Intronic
923813051 1:237342274-237342296 GTGGCTTGTGCCTGTGGTCCTGG - Intronic
924557898 1:245132988-245133010 CTGTCTGGTGCCTGTGGGGCCGG + Intergenic
924699988 1:246441743-246441765 CTGGCATGTGCCTGTGGTCTCGG - Intronic
1064297326 10:14090186-14090208 CTTGCTCTTGCCTGAGGTCCTGG + Intronic
1067132032 10:43574053-43574075 CTGGCTCGTTCCTGCGGTGCGGG + Intronic
1067208372 10:44238708-44238730 CTGGCTTATGCCTGAGGCCCTGG - Intergenic
1069297245 10:66861491-66861513 CTGCCTTGTGCCTGAGCTGCTGG + Intronic
1069442557 10:68442009-68442031 ATGGCTTGAGCCAGAGGTGAAGG - Intronic
1069490661 10:68857790-68857812 CAGGCTGGAGCCTGAGGTGGTGG + Intronic
1073206502 10:101772207-101772229 CTGGCAGGTGTCTGAGGTTCTGG - Intronic
1073304381 10:102491651-102491673 CTGGGTGGTACCTGAGATGCTGG - Intronic
1075399316 10:122150023-122150045 CTGGCTTCAGCCTGAGGAGCAGG + Intronic
1076021422 10:127076854-127076876 CCTGCTTGTCCCTGGGGTGCAGG + Intronic
1076675637 10:132146242-132146264 TTAGCTTCTGCCTGAGGTGCAGG + Intronic
1076761680 10:132608894-132608916 CCGACCTGGGCCTGAGGTGCTGG + Intronic
1076887375 10:133268898-133268920 CTGGCTCCTGCCTGAGGTCGCGG - Intronic
1077146956 11:1050669-1050691 CGGGGATGGGCCTGAGGTGCAGG + Intergenic
1077342259 11:2031362-2031384 CTGCTTTGTGGCTGAGGTGGGGG + Intergenic
1077392187 11:2305236-2305258 CTGGCTAGTGCTGGAGCTGCTGG - Intronic
1078059231 11:8032685-8032707 CTGGCGTGAGCCAGATGTGCGGG - Intronic
1078464803 11:11542108-11542130 CTAGCTTGTGGGTGAGGAGCGGG - Intronic
1079083296 11:17428581-17428603 CTGGCTGGGCCCTGAGGTGTGGG + Exonic
1083768142 11:64852090-64852112 CTGCCTTCTGCCAGAGGGGCTGG + Exonic
1084038105 11:66525643-66525665 CTGGCTTGGGCCATAGGTGCTGG + Intronic
1084062335 11:66684499-66684521 ATGGCATGTGCCTGTGGTTCAGG + Intergenic
1084335904 11:68457736-68457758 CTGGCTGGTGCCTGAGAGGGAGG - Intergenic
1084951291 11:72667278-72667300 CTTGCTTGATACTGAGGTGCTGG - Intronic
1085385976 11:76158614-76158636 CCCACTTGTGCCTGAGGAGCTGG + Intergenic
1085580901 11:77649546-77649568 GTGGCATGTGCCTGTGGTCCCGG - Intergenic
1086468883 11:87085621-87085643 GTGGTGTGTGCCTGTGGTGCTGG + Intronic
1086782471 11:90924371-90924393 GTGGCATGTGCCTGTGGTCCAGG - Intergenic
1087309245 11:96521199-96521221 CTGGCTTGTGGGTGGGGTGCTGG + Intergenic
1090955677 11:131511270-131511292 CTGGCTGGGGCCTGAGGGGATGG - Intronic
1091129680 11:133134812-133134834 CTGCCTTGTAGCTGGGGTGCAGG - Intronic
1202825245 11_KI270721v1_random:86551-86573 CTGCTTTGTGGCTGAGGTGGGGG + Intergenic
1091494170 12:957970-957992 CTGGCTCTTGCCACAGGTGCAGG - Intronic
1091555746 12:1572324-1572346 CTGTATTGTGACTGTGGTGCTGG - Intronic
1091688153 12:2578364-2578386 CTGGCTGGTCCCTGAGGCTCTGG + Intronic
1094565822 12:31597716-31597738 ATAGCTTGTGCCTGTGGTCCCGG - Intergenic
1095740311 12:45599444-45599466 GTGGCATGTGCCTGTGGTCCCGG + Intergenic
1096639824 12:52985226-52985248 GTGGCATGTGCCTGTGGTCCCGG - Intergenic
1097628340 12:62029291-62029313 CTAGCATGTGTCTGATGTGCTGG + Intronic
1098411508 12:70189133-70189155 CTGGCTTGTCTCTGCGGTGTTGG - Intergenic
1100435794 12:94570486-94570508 GTGGCTTGTGCCTGCAGTCCCGG + Exonic
1102701685 12:114844821-114844843 GTGGCATGTGTCTGTGGTGCTGG + Intergenic
1103014435 12:117482763-117482785 GTGGCTTGTCCCTGAGGTGGAGG - Intronic
1103700106 12:122844837-122844859 CTGGCCTGTGTCAGAGCTGCTGG + Intronic
1104536751 12:129624796-129624818 CTGCCCTGTGCCTGAGAGGCTGG - Intronic
1105521800 13:21137815-21137837 GTGGCTTGTGCCTGTGTTCCCGG + Intergenic
1105886294 13:24644986-24645008 CTGTATTGTGACTGAGGTGCTGG - Intergenic
1111657828 13:91175053-91175075 CCGGGTTGTGCCGGAGGAGCTGG - Intergenic
1112880631 13:104102598-104102620 TTGGCTTTTGCCCGAAGTGCTGG + Intergenic
1113260114 13:108552451-108552473 CTCGGCTCTGCCTGAGGTGCAGG + Intergenic
1113752332 13:112784963-112784985 GTGGCTCGGGCCTGGGGTGCTGG + Intronic
1115681412 14:35742935-35742957 CTGTCTTGCCCCTGAGCTGCTGG - Intronic
1115909671 14:38241530-38241552 CTGCCTTTTGAATGAGGTGCCGG - Intergenic
1118812290 14:69284195-69284217 CTTCCTTGTGCCTGAAGAGCAGG - Intronic
1121158630 14:91712721-91712743 CCGCCTTGTTCCTGAGCTGCTGG - Intronic
1121625478 14:95382862-95382884 CTGGGCTGTGGCAGAGGTGCTGG - Intergenic
1121712845 14:96052301-96052323 CAGGCTGGTGCCAGAGGTGGGGG + Intronic
1122781699 14:104146494-104146516 AGGGCTTGGGCCTGAGGAGCCGG + Intronic
1123007962 14:105333495-105333517 CTGGCTGCTCCCTGGGGTGCTGG + Intronic
1123206014 14:106714152-106714174 CTGATTTGTGACTGCGGTGCAGG + Intergenic
1123211098 14:106761559-106761581 CTGATTTGTGACTGCGGTGCAGG + Intergenic
1124722434 15:32121685-32121707 CGGGTTTGTGCCTGAGGTCCTGG + Intronic
1128226977 15:66008688-66008710 GTGGCATGTGCCTGTGGTCCTGG + Intronic
1129172691 15:73817677-73817699 CAGGCCTGGGCCTGGGGTGCTGG - Intergenic
1129297288 15:74606519-74606541 CTGGCTTATGCATCACGTGCAGG + Intronic
1130120341 15:81042294-81042316 TTGGCTTAGGCCAGAGGTGCTGG - Intronic
1130337673 15:82971209-82971231 CTGGATCGTGCCATAGGTGCAGG + Intronic
1132818545 16:1848466-1848488 CTGGCTTATGCCAGACATGCGGG - Intronic
1133423066 16:5663931-5663953 CTGGCTTGTCCCTGAAGGGAAGG - Intergenic
1134604089 16:15556347-15556369 CAGGCTTGTGTGTGTGGTGCAGG - Intronic
1137649955 16:50111223-50111245 GTGGCATGTGCCTGTGGTCCCGG - Intergenic
1139438990 16:66954677-66954699 GTGGCATGTGCCTGTGGTCCTGG - Intergenic
1139692890 16:68652294-68652316 GTAGCTTGTGCCTGGGGAGCAGG + Intronic
1139726020 16:68899138-68899160 CTGGTGTGTGCCTGTGGTCCTGG + Intronic
1141440376 16:84026024-84026046 CTGCCATGGGGCTGAGGTGCTGG - Intronic
1142014632 16:87738545-87738567 CTGGTGTGTGGATGAGGTGCTGG - Intronic
1142014665 16:87738745-87738767 CTGGTGTGTGGATGAGGTGCTGG - Intronic
1142014685 16:87738856-87738878 CTGGTGTGTGGATGAGGTGCTGG - Intronic
1142014772 16:87739396-87739418 CTGGTGTGTGGATGAGGTGCTGG - Intronic
1142014786 16:87739503-87739525 CTGGTGTGTGGATGAGGTGCTGG - Intronic
1142207213 16:88789552-88789574 CTTCCTTGAGCCTGAGGTCCAGG - Intergenic
1142232480 16:88906285-88906307 ATGGCCTGTGGCCGAGGTGCAGG - Intronic
1142580625 17:940065-940087 GTGGCCTGTGCCTGTGGTCCCGG - Intronic
1143374225 17:6457896-6457918 CTGGGTTGGGCCTGGGGTGCAGG - Intronic
1143675751 17:8431135-8431157 CTGCCTCCTGGCTGAGGTGCTGG - Intronic
1143904289 17:10197550-10197572 GTGGCTTGTTCCTGGGGTTCTGG - Intronic
1144624738 17:16838925-16838947 CTGCCTGGAGCCTGAGGTGGGGG + Intergenic
1144735715 17:17554234-17554256 CTGCCTTGTGGCTGAGGGGAGGG - Intronic
1144881692 17:18433796-18433818 CTGCCTGGAGCCTGAGGTGGGGG - Intergenic
1145150541 17:20510590-20510612 CTGCCTGGAGCCTGAGGTGGGGG + Intergenic
1145766757 17:27463554-27463576 GTTGCTTGTGTCTGAGGTTCTGG + Intronic
1146399885 17:32494188-32494210 CTGGCTCCTGGCTGAGGGGCTGG + Exonic
1148357378 17:46984494-46984516 CAGACTTGTCCCTGAGGTGGAGG - Intronic
1148696395 17:49562331-49562353 ATGGCTTGTGCCTGTAGTCCTGG + Intergenic
1149543222 17:57484212-57484234 CGGGCATCTGCCTGAGGAGCAGG - Intronic
1149547792 17:57517385-57517407 CTGCCTTGTGCCAGAATTGCTGG + Intronic
1150614948 17:66763234-66763256 CTGCCCCGTGCCTGAGGTCCTGG + Intronic
1151213874 17:72564240-72564262 CTGGCGTTTGCCAGAGCTGCAGG - Intergenic
1151931234 17:77233010-77233032 GTGGCATGTGCCTGTGGTCCCGG + Intergenic
1152120680 17:78416497-78416519 CAGGCCTGTGCCTGGGGTCCTGG + Intronic
1153027285 18:683338-683360 CTGGGATGTGCCTGAGGCGGTGG - Exonic
1153769684 18:8405377-8405399 CTGGCTTCTGCCTGTTGTCCTGG - Intronic
1154134139 18:11761196-11761218 CTGGCTTGAGGTGGAGGTGCAGG - Intronic
1155946935 18:31863773-31863795 CAGGCTTATACCTGAGGAGCAGG - Intronic
1157483981 18:48073939-48073961 CTGGCTGGGGCCTGAGGGGCAGG - Intronic
1158635163 18:59149669-59149691 CTGCCTTGGGCCTGAGGAGCGGG + Intronic
1159909073 18:74126719-74126741 CTGGCTTGTGCCTGAGGTGCTGG - Intronic
1160765829 19:807265-807287 CTGACTTGTGCCACAGCTGCGGG + Intronic
1163723622 19:18910224-18910246 CTGGCCTGTGGCTCAGGGGCAGG + Intronic
1163992262 19:21009511-21009533 CTGTCTTGTGCCTAAGTGGCAGG - Intergenic
1164872440 19:31657165-31657187 CAGGCTTGTGTCTCAGCTGCAGG - Intergenic
1164983515 19:32631549-32631571 CGGGGTTGTTGCTGAGGTGCTGG - Intronic
1165346655 19:35252885-35252907 GTGGCATGTGCCTGTGGTCCCGG + Intronic
1165790550 19:38489079-38489101 TTGGCATGTGCATGAGGGGCAGG + Intronic
1167294704 19:48643092-48643114 CTGGCATGTGCCTGCAGTCCTGG + Intronic
1167302216 19:48684706-48684728 CTGGATACTGTCTGAGGTGCTGG - Intergenic
1167490138 19:49788078-49788100 GTGGCTTGTGCCTGTAGTCCCGG - Intronic
925740565 2:7002273-7002295 CTGGCTTGTGCCAGATGCCCTGG + Intronic
925943699 2:8841848-8841870 CTGGCTTTCACCTGAGTTGCCGG + Intergenic
927928164 2:27027129-27027151 CAGGCTGGTGCCCGAGGGGCAGG - Exonic
928569818 2:32594560-32594582 ATGGCGTGTGCCTGTGGTCCCGG + Intronic
928780315 2:34809891-34809913 CTTGCTTATCCCTGAGGAGCAGG - Intergenic
932658146 2:73627873-73627895 CTGGCATGTGCCTCTGGTGAGGG - Intergenic
933625937 2:84598894-84598916 GTGGCTTGTGCCTGTAGTCCTGG + Intronic
934947300 2:98551087-98551109 GTGGCTTGTGCTTGTGGTTCTGG - Intronic
935601250 2:104924200-104924222 CTGGCTTGTGCCTCTTGTTCTGG - Intergenic
935663231 2:105487748-105487770 CTGGCTCCCGCCTGACGTGCAGG - Intergenic
937322511 2:120969435-120969457 CTGGCCTCTTCCGGAGGTGCTGG - Intronic
937356537 2:121201445-121201467 CTTGCTTGTGCCTGGGCTCCAGG + Intergenic
937920047 2:127122428-127122450 CTGGCTTGAAGCTGATGTGCAGG - Intergenic
938049089 2:128150806-128150828 GTGCCTTGTGCCTGAGGAGATGG - Intronic
938462942 2:131509743-131509765 CTGGCTGGTGCCTGGGGGCCTGG + Intergenic
938792975 2:134692962-134692984 CTGGAACGTGACTGAGGTGCTGG - Intronic
941479271 2:165985524-165985546 CTTGCTTGTTGCTGAGGTGAGGG + Intergenic
942797346 2:179836931-179836953 CTGGCTGGTGACTGGGGTGCTGG - Intronic
944108076 2:196101049-196101071 CTTCCTTGTGCCAGAGGTGAGGG + Intergenic
944710455 2:202330558-202330580 GTGGCTTGTGCCTGTAGTCCTGG + Intergenic
946358680 2:219206033-219206055 GTGGCTTGTGCCTGTAGTCCTGG + Intronic
946500179 2:220238788-220238810 CTGGCTTTGGACTCAGGTGCTGG + Intergenic
948006078 2:234608662-234608684 CCGTCTTCTGCCTGACGTGCTGG + Intergenic
948611907 2:239175327-239175349 CTGGCGTGTCCCCGGGGTGCAGG - Intronic
948723138 2:239913800-239913822 CTGGCCTTTGCTTCAGGTGCTGG - Intronic
1169136796 20:3202703-3202725 CTGGCTTGAGCCTGAGGAGGGGG - Intronic
1171361416 20:24588941-24588963 CTGGCTTGTCCCTGAGCTGTGGG + Intronic
1172628641 20:36363562-36363584 TTGGCTTGGGCCTGAGTGGCTGG + Intronic
1173554852 20:43958725-43958747 CTGGCTTCTTCTGGAGGTGCAGG + Intronic
1173665329 20:44758818-44758840 CAGACTTGAGCCTGAGATGCAGG + Intronic
1176150196 20:63586876-63586898 CTGGCCTGTGGCTGGTGTGCAGG + Intergenic
1177429368 21:20970893-20970915 CTTTCTTTTGCCTGATGTGCTGG + Intergenic
1178360733 21:31947046-31947068 CTGGCTTGAGCCTGGGATGTGGG - Intronic
1178360755 21:31947160-31947182 CTGGCTTGAGCCTGGGATGTGGG - Intronic
1179107842 21:38419235-38419257 CTGGTTTGTGCCTGTTGTTCTGG - Intronic
1179289606 21:40006962-40006984 CTGGCTTGTTACCGAGGAGCTGG + Intergenic
1179886329 21:44315764-44315786 CTGGCTGGTGCCAGCGATGCGGG + Intronic
1180205366 21:46256230-46256252 CTGGCATGGCCCTGAGGAGCCGG + Intronic
1181112972 22:20612648-20612670 CTGGCTGGTGCCTGGGGGGCTGG - Intergenic
1181311599 22:21947731-21947753 GTGGCAGGGGCCTGAGGTGCAGG + Intronic
1181636910 22:24178756-24178778 CTGGCTGGTCCCTGAGATGCTGG - Intergenic
1184661579 22:45967876-45967898 CTGGCTGGAGCCTGAGGCCCTGG + Intronic
1184666499 22:45992135-45992157 CTGGCCTGTGCCACAGGTCCTGG - Intergenic
1185198537 22:49488273-49488295 ATGTCTTGTCCCTGAGGTGTTGG + Intronic
949944725 3:9180821-9180843 CTGGCATTTGCAGGAGGTGCTGG - Intronic
953470825 3:43164376-43164398 CTGGCTTGTCCGAGGGGTGCAGG - Intergenic
955426367 3:58795489-58795511 TTGGCTTGTGCCTGTGGTCTCGG + Intronic
955538529 3:59950397-59950419 CTGGCATGTGCCTGATATGATGG - Intronic
955661567 3:61304875-61304897 CTTTCTTGAGCTTGAGGTGCTGG - Intergenic
960206266 3:114903480-114903502 CTGGCTTTTGGATGAGCTGCTGG - Intronic
960378895 3:116935831-116935853 CTGTATTGTGCCTGAGGTCAGGG + Intronic
961192616 3:124974812-124974834 CTAGCATGTGGCTTAGGTGCTGG + Intronic
961302422 3:125930707-125930729 CTGGCTTGAGCATGCGGTGGTGG - Intronic
961324468 3:126102127-126102149 CTGGCTTGGGCCTGGGCTTCAGG + Intergenic
961366990 3:126406440-126406462 CTGGTCGGTGCCTGAGGGGCAGG - Intronic
961470430 3:127107856-127107878 CTGGCTTGTGCCTTAGAGGCAGG + Intergenic
965488448 3:169307438-169307460 GTGGCATGTGCCTGTGGTCCCGG + Intronic
967147024 3:186615072-186615094 TTGGCTTGTGCAGCAGGTGCCGG - Intronic
967867600 3:194203451-194203473 CTGGTTAGTGTCTGAGGTGGTGG + Intergenic
968058080 3:195708341-195708363 CCGGCTTTGGCCTGAAGTGCAGG - Intergenic
968377455 4:54830-54852 CTGGTTTGTGCCACAGGTACAGG - Intronic
968481395 4:834651-834673 TGGGCTTGTGGCTGTGGTGCTGG + Intergenic
968977056 4:3827563-3827585 CTGGCTTGCTCCTGAGATCCAGG + Intergenic
969297078 4:6276526-6276548 GTGGCTTGGGCCTGGGGTGGGGG + Intronic
969409148 4:7016440-7016462 CTGGCTGGGGCCCGCGGTGCTGG + Intronic
969489044 4:7488449-7488471 CTGGCTACTGCATGTGGTGCAGG + Intronic
969888593 4:10238864-10238886 CTGGTTTGTGCCTGTCCTGCTGG + Intergenic
973777226 4:54254797-54254819 CCGGCATGTGCCTGGGATGCAGG - Intronic
974933183 4:68383462-68383484 GTGGCTGGTGCCTGAGGTGATGG + Intergenic
976802996 4:89014034-89014056 CCTCCTTGTGCCTGAGCTGCTGG + Intronic
977713083 4:100149768-100149790 CTCTCTTGTTCTTGAGGTGCAGG + Intergenic
978944033 4:114472659-114472681 ATGGCTTCTGCCTTAGGTGCTGG - Intergenic
983467893 4:168117829-168117851 CCACCTTGTGCCTGAGCTGCTGG - Intronic
984728650 4:183045179-183045201 CTGCCTGGTGCCGGCGGTGCCGG - Intergenic
985541631 5:490142-490164 CTGGGTGCTGCCTGAGGTTCTGG - Intronic
985952891 5:3236875-3236897 GTGGATGGGGCCTGAGGTGCTGG + Intergenic
986115827 5:4773407-4773429 CTGGATTGTGCCTGTTGTCCTGG - Intergenic
989207846 5:38829289-38829311 CTCACTTGTGCCTTAGGTGATGG + Intergenic
989632195 5:43496715-43496737 GTGGCATGTGCCTGTGGTCCTGG - Intronic
989993800 5:50802450-50802472 GTGGCTTGTGCCTGCAGTCCTGG - Intronic
990594093 5:57295736-57295758 GTGGCTTGTGCCTGTAGTCCCGG + Intergenic
990922181 5:60979611-60979633 TTGTCTTGTGGCTCAGGTGCCGG + Intronic
992245035 5:74812255-74812277 GTGGCTTGTGCCTGTAGTCCCGG - Intronic
995958288 5:117807258-117807280 CTGGCTAGTGCCAGACTTGCTGG - Intergenic
998095894 5:139395281-139395303 CCGGCTTGTGCCTGAGAAGGGGG - Exonic
998319801 5:141218570-141218592 GTGGCATGTGCCTGTGGTCCCGG - Exonic
998467270 5:142356393-142356415 CTGTGTTGTTCCTGCGGTGCGGG + Intergenic
1001341043 5:170845685-170845707 GTGGCTTGTGCCTGTAGTCCTGG + Intergenic
1002211556 5:177602398-177602420 CTGGCCTGTGCTTGCTGTGCTGG + Intronic
1003395709 6:5750359-5750381 CCGGTTTGTGCATCAGGTGCAGG - Intronic
1003595140 6:7468025-7468047 CTGGGTGGGGCCTGAGGTTCCGG - Intergenic
1003869033 6:10387354-10387376 CTGGCCTGTGACTGCGATGCTGG - Intergenic
1004641866 6:17523367-17523389 CTGCATTGTGTTTGAGGTGCGGG + Intronic
1005716008 6:28549331-28549353 GTGGCTTGTGTCTGAAGTGGGGG - Intergenic
1006406290 6:33847660-33847682 TTGGCCTTGGCCTGAGGTGCTGG + Intergenic
1006569061 6:34985320-34985342 CTGGCTGGCCCCTGAGGTGATGG + Intronic
1006909389 6:37554386-37554408 CTGGTCTGTGACTGAGGTGGTGG + Intergenic
1007584446 6:42980222-42980244 GTGGCGTGTGCCTGTGGTCCCGG - Intergenic
1010095380 6:72037172-72037194 TTGGCATGTGGCTGAGGTGACGG + Intronic
1016746728 6:147588932-147588954 CTGGTTTATGCCTGTGGTCCTGG + Intronic
1017756481 6:157533554-157533576 CTGGCTTGTTCCAGAGCTGCAGG + Intronic
1019883151 7:3881122-3881144 AGTGCTTGTGCATGAGGTGCAGG + Intronic
1020330802 7:7015137-7015159 CTGGCCTGTGGCAGATGTGCAGG - Intergenic
1022679469 7:32530820-32530842 GTGGCATGTGCCTGTGGTCCTGG + Intronic
1023995378 7:45156334-45156356 CTGCCTTCTGCCTGAGGGGTGGG - Intergenic
1025190600 7:56892913-56892935 CAGGGCTGTGCCTGAGCTGCAGG + Intergenic
1025681343 7:63684007-63684029 CAGGGCTGTGCCTGAGCTGCAGG - Intergenic
1026476257 7:70738467-70738489 GTGTGTTGTGCCTGAGGAGCTGG + Intronic
1029510725 7:100993256-100993278 CTGACTGGGGCCTGAGGTGGTGG - Exonic
1029511216 7:100996505-100996527 CTGACTGGGGCCTGAGGTGGTGG - Exonic
1029511442 7:100997927-100997949 CTGACTGGGGCCTGAGGTGGTGG - Exonic
1029511944 7:101001176-101001198 CTGACTGGAGCCTGAGGTGGTGG - Exonic
1029641522 7:101823326-101823348 CTGGCTAGTTCTTGAGTTGCTGG - Intronic
1032094911 7:128933134-128933156 TTGGCTGGTGCCTGTGGGGCTGG + Intergenic
1032453685 7:132055991-132056013 CTGGCTGGTGCCTGGGTTGGTGG - Intergenic
1033987475 7:147244019-147244041 CTCGTTTCTGCCTGAGGTGGAGG + Intronic
1034292707 7:149945571-149945593 CTGGCTGGTCTCTGAGCTGCGGG - Intergenic
1034319699 7:150168804-150168826 CTGGCATGTGCCTGAGGACCGGG + Intergenic
1034773053 7:153798415-153798437 CTGGCATGTGCCTGAGGACTGGG - Intergenic
1034813357 7:154151301-154151323 CTGGCTTGTCTCTGAGCTGCGGG + Intronic
1035026461 7:155829950-155829972 CTGGCATGTGCTCCAGGTGCGGG - Intergenic
1035034335 7:155885328-155885350 CTGGCCAGAGCCTGAGGAGCTGG + Intergenic
1035229712 7:157457646-157457668 CTTGCTCATGCCTGAGCTGCCGG + Intergenic
1036398136 8:8386140-8386162 CCGGGTGGTGCCCGAGGTGCAGG - Intronic
1037007367 8:13798636-13798658 GTGGCTTGTGCCTGTAGTCCCGG + Intergenic
1037898816 8:22675730-22675752 CTGGCTTGCCCCAAAGGTGCTGG - Intergenic
1038663359 8:29516477-29516499 GTGGCTTGTGCCTGTCGTCCCGG + Intergenic
1039984572 8:42436709-42436731 CTGGCCGGTGACGGAGGTGCAGG - Intronic
1042178700 8:66062874-66062896 GTGGCATGTGCCTGTGGTCCTGG + Intronic
1042220361 8:66467278-66467300 CTGGGTTTTGCCTGAGCTACTGG + Intronic
1042946999 8:74165107-74165129 CTGCCTTGTGCATGAGGTAGAGG + Intergenic
1043182001 8:77096877-77096899 CTGGCTGATGCCAGAGATGCTGG - Intergenic
1044625878 8:94234784-94234806 CAGGCCTGTGCCTGAGCTGCCGG + Intergenic
1046671307 8:117059588-117059610 TGGGCTTTTGCCTGAAGTGCAGG - Intronic
1047490083 8:125367148-125367170 ATGGATTGTTCCAGAGGTGCAGG + Intergenic
1047611978 8:126529879-126529901 GTGGCATGTGCCTGTGGTCCTGG + Intergenic
1047898078 8:129388919-129388941 CTGGATGGGGACTGAGGTGCGGG + Intergenic
1048300445 8:133247516-133247538 CTGACTGGTGCCTGATGAGCTGG - Intronic
1048596250 8:135869283-135869305 GTTGCTTGTGGCTGAGCTGCTGG - Intergenic
1049277385 8:141726557-141726579 CTGGCAGGAGCCTGAGCTGCGGG - Intergenic
1049371212 8:142268341-142268363 CTGCATTGTGGCTGAGGAGCAGG - Intronic
1049421039 8:142516819-142516841 CTGGCTTATGACTCAGGTGATGG + Intronic
1049646467 8:143738044-143738066 CTGGGGTGTCCCTGAGGTGCTGG + Intergenic
1050334084 9:4574100-4574122 CTGGCTTCTGCCCTATGTGCTGG + Intronic
1050689472 9:8209111-8209133 CTGGCTTGGGCCTGATCTGTTGG - Intergenic
1052700011 9:31926263-31926285 CTGCCTTGTACCTGAGCTGCAGG + Intergenic
1055857402 9:80706782-80706804 GTGGCTTGTGTCTGAAGTGAGGG - Intergenic
1058682100 9:107448959-107448981 GTGGCATGTGCCTGTGGTCCCGG - Intergenic
1058976120 9:110127044-110127066 CTGTCTTATGCCTCAGGTACAGG - Intronic
1060125036 9:121035701-121035723 GTGGCATGTGCCTGTGGTCCTGG - Intronic
1061897079 9:133653839-133653861 CTGGCTTGTGCCTGGGACCCAGG - Intronic
1062325065 9:136009025-136009047 CTGGCTGCTGCCGGAGGTGGTGG - Exonic
1062380996 9:136286454-136286476 CCTGCTTATGCCGGAGGTGCAGG + Exonic
1203571780 Un_KI270744v1:139416-139438 CTGGTTTGTGCCACAGGTACAGG + Intergenic
1185736970 X:2501829-2501851 CTGGCTGGGGCCTGTGGTCCGGG - Intronic
1187174469 X:16883575-16883597 GTGGCTAGTGGCTGACGTGCTGG - Intergenic
1188010232 X:25047275-25047297 CTGGGTTTTGCCTGTGGTTCTGG - Intergenic
1188112760 X:26211557-26211579 CTGCCTTGAGCCTGCAGTGCAGG - Intergenic
1189036236 X:37496070-37496092 CTGTCTTGGGACTGAGGTGTGGG - Intronic
1189037740 X:37509612-37509634 CTGTCTTGGGACTGAGGTGTGGG - Intronic
1189186771 X:39061694-39061716 CTGGCCTGGGCTTGAGGTGGTGG - Intergenic
1190330393 X:49231775-49231797 CTGTCTTGTGCTTGCTGTGCTGG + Exonic
1192233351 X:69280830-69280852 CCGGCTGTAGCCTGAGGTGCTGG + Intergenic
1193731380 X:85107745-85107767 TTGGCTTGTGCCTGATTGGCTGG + Exonic
1193857173 X:86618005-86618027 CTGGCTTGTGCCTGTAATCCTGG + Intronic
1196422642 X:115538789-115538811 CTGTCTTGTGCCTAAGTAGCAGG + Intergenic
1197399635 X:125974476-125974498 CTTCCTTTTGCCTGAGGTGCGGG + Intergenic
1197758832 X:130014039-130014061 ATAGCTGGTGCCTGAGCTGCAGG - Exonic
1200393702 X:155970002-155970024 CTGTCTTGTGCCTAAGTAGCAGG + Intergenic
1201416784 Y:13754988-13755010 CTGTCTTGTTGCTGAAGTGCTGG - Intergenic
1201764073 Y:17563496-17563518 CTGGCTTGTACCGAGGGTGCTGG + Intergenic
1201837480 Y:18342494-18342516 CTGGCTTGTACCGAGGGTGCTGG - Intergenic