ID: 1159914025

View in Genome Browser
Species Human (GRCh38)
Location 18:74173120-74173142
Sequence ATGGCTTAGAGCCCCTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159914025_1159914037 30 Left 1159914025 18:74173120-74173142 CCCAGAAAGGGGCTCTAAGCCAT No data
Right 1159914037 18:74173173-74173195 GGGACGAGGAGGGTCCCGCCTGG No data
1159914025_1159914033 10 Left 1159914025 18:74173120-74173142 CCCAGAAAGGGGCTCTAAGCCAT No data
Right 1159914033 18:74173153-74173175 TGTAGGGAAGCAGTGAGGATGGG No data
1159914025_1159914028 -6 Left 1159914025 18:74173120-74173142 CCCAGAAAGGGGCTCTAAGCCAT No data
Right 1159914028 18:74173137-74173159 AGCCATCGCTGCACCTTGTAGGG No data
1159914025_1159914034 16 Left 1159914025 18:74173120-74173142 CCCAGAAAGGGGCTCTAAGCCAT No data
Right 1159914034 18:74173159-74173181 GAAGCAGTGAGGATGGGACGAGG No data
1159914025_1159914036 20 Left 1159914025 18:74173120-74173142 CCCAGAAAGGGGCTCTAAGCCAT No data
Right 1159914036 18:74173163-74173185 CAGTGAGGATGGGACGAGGAGGG No data
1159914025_1159914035 19 Left 1159914025 18:74173120-74173142 CCCAGAAAGGGGCTCTAAGCCAT No data
Right 1159914035 18:74173162-74173184 GCAGTGAGGATGGGACGAGGAGG No data
1159914025_1159914027 -7 Left 1159914025 18:74173120-74173142 CCCAGAAAGGGGCTCTAAGCCAT No data
Right 1159914027 18:74173136-74173158 AAGCCATCGCTGCACCTTGTAGG No data
1159914025_1159914032 9 Left 1159914025 18:74173120-74173142 CCCAGAAAGGGGCTCTAAGCCAT No data
Right 1159914032 18:74173152-74173174 TTGTAGGGAAGCAGTGAGGATGG No data
1159914025_1159914030 5 Left 1159914025 18:74173120-74173142 CCCAGAAAGGGGCTCTAAGCCAT No data
Right 1159914030 18:74173148-74173170 CACCTTGTAGGGAAGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159914025 Original CRISPR ATGGCTTAGAGCCCCTTTCT GGG (reversed) Intergenic
No off target data available for this crispr