ID: 1159923160

View in Genome Browser
Species Human (GRCh38)
Location 18:74244675-74244697
Sequence ACACTACCAAGTTCTGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159923160_1159923164 18 Left 1159923160 18:74244675-74244697 CCTTTGTCAGAACTTGGTAGTGT No data
Right 1159923164 18:74244716-74244738 CCTTCCCCATGGGTGTGAAATGG No data
1159923160_1159923168 28 Left 1159923160 18:74244675-74244697 CCTTTGTCAGAACTTGGTAGTGT No data
Right 1159923168 18:74244726-74244748 GGGTGTGAAATGGCATCTTGTGG No data
1159923160_1159923161 7 Left 1159923160 18:74244675-74244697 CCTTTGTCAGAACTTGGTAGTGT No data
Right 1159923161 18:74244705-74244727 TTTGATTATAACCTTCCCCATGG No data
1159923160_1159923162 8 Left 1159923160 18:74244675-74244697 CCTTTGTCAGAACTTGGTAGTGT No data
Right 1159923162 18:74244706-74244728 TTGATTATAACCTTCCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159923160 Original CRISPR ACACTACCAAGTTCTGACAA AGG (reversed) Intergenic
No off target data available for this crispr