ID: 1159923168

View in Genome Browser
Species Human (GRCh38)
Location 18:74244726-74244748
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159923160_1159923168 28 Left 1159923160 18:74244675-74244697 CCTTTGTCAGAACTTGGTAGTGT No data
Right 1159923168 18:74244726-74244748 GGGTGTGAAATGGCATCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159923168 Original CRISPR GGGTGTGAAATGGCATCTTG TGG Intergenic
No off target data available for this crispr