ID: 1159923635

View in Genome Browser
Species Human (GRCh38)
Location 18:74247825-74247847
Sequence TGAGTGGACTGGCGCTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159923635_1159923640 2 Left 1159923635 18:74247825-74247847 CCTTCTCAGCGCCAGTCCACTCA No data
Right 1159923640 18:74247850-74247872 TGCAGGGTCCAAGTGCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159923635 Original CRISPR TGAGTGGACTGGCGCTGAGA AGG (reversed) Intergenic
No off target data available for this crispr