ID: 1159925928

View in Genome Browser
Species Human (GRCh38)
Location 18:74269011-74269033
Sequence GCATCTATAAAGGTTAGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159925923_1159925928 21 Left 1159925923 18:74268967-74268989 CCAGGGAATACCAATACAATAAC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1159925928 18:74269011-74269033 GCATCTATAAAGGTTAGCTATGG 0: 1
1: 0
2: 0
3: 5
4: 72
1159925922_1159925928 22 Left 1159925922 18:74268966-74268988 CCCAGGGAATACCAATACAATAA 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1159925928 18:74269011-74269033 GCATCTATAAAGGTTAGCTATGG 0: 1
1: 0
2: 0
3: 5
4: 72
1159925926_1159925928 11 Left 1159925926 18:74268977-74268999 CCAATACAATAACTGGAAATGGC 0: 1
1: 1
2: 0
3: 2
4: 141
Right 1159925928 18:74269011-74269033 GCATCTATAAAGGTTAGCTATGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159925928 Original CRISPR GCATCTATAAAGGTTAGCTA TGG Intronic
901859595 1:12065552-12065574 GCATTTATAAAGGTCTGCAAAGG - Intronic
907899542 1:58725229-58725251 GCCTCTAGAAAAATTAGCTATGG - Intergenic
913358988 1:117957911-117957933 GCATATATAGAGGTAAACTAAGG + Intronic
917640189 1:176975915-176975937 TCATCTATAAAGATCAGCTAAGG - Intronic
1063323544 10:5074805-5074827 GCAACTGTAAAGATAAGCTATGG - Intronic
1064245402 10:13664018-13664040 GCATCTATAAAAATAAGCTTTGG - Intronic
1066680052 10:37929545-37929567 GAATCTAGAAAGGTTAGCCTGGG + Intergenic
1068068082 10:52158018-52158040 GCATGCATAAAGGTTTGCTGTGG + Intronic
1078783905 11:14468405-14468427 GGATCCTTAAAGGTTAGCTGAGG - Intronic
1081015596 11:37875760-37875782 CCATCTATAAAGCTTACATAGGG - Intergenic
1085690350 11:78659214-78659236 ACATCAAGAAATGTTAGCTATGG - Intronic
1085723472 11:78933440-78933462 GCATAATTAAAGATTAGCTAAGG + Intronic
1089024510 11:115255179-115255201 GCCTCTATAAACGTCAGTTAAGG + Intronic
1093337779 12:17929954-17929976 GCATCTATATGAGTTAGATAAGG - Intergenic
1099062350 12:77927908-77927930 GCATCACTAAAGGTTAGAGAAGG + Intronic
1102556924 12:113732922-113732944 AGATCTATAAAGGTTAGGTTGGG + Intergenic
1109857314 13:68148226-68148248 TCATGTATAATGGTTAGCAAAGG + Intergenic
1110106855 13:71687989-71688011 GCACTAATAAAGTTTAGCTAGGG - Intronic
1110371357 13:74744133-74744155 ACATCTCTAAAGGTGAACTATGG - Intergenic
1112872936 13:103996953-103996975 GCATTTATATAGGTTATCTAAGG - Intergenic
1113633260 13:111902133-111902155 GCAACAATAATGGTAAGCTATGG + Intergenic
1116424362 14:44771523-44771545 GCATCTATAACGATGAGCAATGG - Intergenic
1118496282 14:66310973-66310995 GCATGGATAGAGGCTAGCTAAGG + Intergenic
1119229962 14:72971919-72971941 GGATTAAGAAAGGTTAGCTAAGG + Intronic
1125990005 15:44096928-44096950 GCATCAATAAGGGTGAGATATGG - Intronic
1126668152 15:51093637-51093659 GCAGCTCTGAAGGTTAGCTGTGG - Intronic
1126915439 15:53461030-53461052 GCATTTATGAAGGGGAGCTAAGG + Intergenic
1129968826 15:79759553-79759575 GGATTAAGAAAGGTTAGCTAAGG + Intergenic
1140802278 16:78499443-78499465 CCACTTAGAAAGGTTAGCTATGG - Intronic
1144315310 17:14055184-14055206 GCATCTATGTAGGTGAGCCATGG - Intergenic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1153318284 18:3745987-3746009 GCAGCTATAAAGTATAGCTGAGG - Intronic
1157257764 18:46153636-46153658 GCATCTTTAAAGGTCATCTTGGG - Intergenic
1159925928 18:74269011-74269033 GCATCTATAAAGGTTAGCTATGG + Intronic
1164279580 19:23757951-23757973 ACATTTATAAAGGTTTTCTAGGG + Intronic
925507214 2:4581374-4581396 TCATCTAAAAAGCTTATCTAAGG - Intergenic
925698983 2:6613841-6613863 GTGTCTATAAATGTTAGCCAGGG + Intergenic
931132101 2:59347997-59348019 GCAACTATAAATTTTAGCAAAGG - Intergenic
935262892 2:101370354-101370376 GCACCAATAAATGGTAGCTATGG - Intronic
937104696 2:119299314-119299336 GCATATATAAAAATTAGCAAGGG - Intergenic
937484484 2:122300344-122300366 ACATCTATAAAAGTTACATATGG - Intergenic
938056451 2:128218988-128219010 GCAACTATAAAGGGTAGCCCAGG - Intergenic
941992007 2:171566759-171566781 GCATCTATAAAATGGAGCTAAGG + Intergenic
944731151 2:202518613-202518635 GCATTTATAAATGTTCTCTATGG + Intronic
1178813591 21:35906752-35906774 ACAGCTATAAAGGAAAGCTAGGG + Intronic
1184263716 22:43334966-43334988 GCCTCTATTAAGGTCAGCTTAGG - Intronic
952028861 3:29116983-29117005 GCATCTTTAATGGTTACCTTTGG - Intergenic
953593402 3:44282978-44283000 GGAACTATATAGGTTAGATATGG + Intronic
955728046 3:61953491-61953513 GCACTTCTAAAGGTTACCTACGG + Intronic
957422715 3:79992157-79992179 GCATCTATAAAGTTAACTTATGG - Intergenic
957489798 3:80908906-80908928 GCATCTATTAAGGTAATCTGTGG - Intergenic
961935554 3:130579003-130579025 TCATCTATAAAGTATAGCTAGGG - Intronic
964702997 3:159589621-159589643 ACATGTGTAAAGTTTAGCTAAGG - Intronic
964831894 3:160893058-160893080 GCATATATAAAGGTAATATAAGG + Intronic
965900155 3:173629897-173629919 GTTTCTATAAAGGTTAGAAAAGG - Intronic
967123083 3:186401094-186401116 ACATTTTTAAAAGTTAGCTATGG + Intergenic
971643994 4:29172386-29172408 TCTTCTTTAAAGGTTAGCTATGG + Intergenic
982979255 4:162110832-162110854 GCAGATATATAGGTTAGCAAAGG - Intronic
986242264 5:5971602-5971624 GCATGTATAAATGTTATGTATGG + Intergenic
989184878 5:38614057-38614079 GCATCTATAAAGCATAATTAAGG + Intergenic
996489598 5:124078202-124078224 GCATCTTTATAGGTAAGGTAAGG + Intergenic
999774880 5:154804182-154804204 GCATCTGCAAAGGTTAGCCCAGG - Exonic
1005514392 6:26540037-26540059 CCATCTGTAAAGGTTGGTTAGGG - Intronic
1015775887 6:136813761-136813783 ACATTTATAAAGGTTTGCAAAGG + Intergenic
1033069724 7:138191144-138191166 GCACCTATAAAGATAAGCTCTGG + Intergenic
1037220495 8:16513482-16513504 GAATGAATAAAGGCTAGCTATGG + Intronic
1037664432 8:20956029-20956051 GCATCTATAAAAGAAAGATAAGG + Intergenic
1038426355 8:27466552-27466574 TCATCTAAAAAGGTTTTCTAAGG - Intronic
1043198938 8:77338981-77339003 AAATCTATAAAAGTTAGCCATGG - Intergenic
1047969917 8:130075621-130075643 GCAGCTTTAAAGGTAAGGTATGG + Intronic
1186675277 X:11809875-11809897 GCATTAACAAATGTTAGCTAGGG - Intergenic
1187215575 X:17272756-17272778 GCATCTGTATTGGTTAGCTAGGG + Intergenic
1187333159 X:18359286-18359308 ACATCTAAAAAGGTTCGATATGG - Intergenic
1192772813 X:74210530-74210552 GTTTGTATAAAGTTTAGCTATGG - Intergenic
1195409627 X:104555807-104555829 GCTTCTATCAAGGTGAGCTGGGG - Intergenic
1198882256 X:141294313-141294335 GCCTCTATATTGGTTTGCTAGGG - Intergenic
1198884084 X:141314422-141314444 TACTCTATAAAAGTTAGCTAAGG + Intergenic
1198924287 X:141770387-141770409 GCATCCATAAATGCTATCTAGGG + Intergenic