ID: 1159926521

View in Genome Browser
Species Human (GRCh38)
Location 18:74274713-74274735
Sequence AGTTATTTGAAGAATATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 536}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159926521 Original CRISPR AGTTATTTGAAGAATATAGC TGG (reversed) Intronic
900434958 1:2625576-2625598 AGTTAACTGCAGAAGATAGCAGG - Intronic
900813051 1:4822540-4822562 TATTATTTGAAGTACATAGCAGG + Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
906194934 1:43924101-43924123 AGTTATTTCAAGGATATATAAGG + Intronic
906825780 1:48978319-48978341 AGTTATTGGCAGAACCTAGCAGG - Intronic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
907614493 1:55910401-55910423 AGTAATGTGGATAATATAGCTGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
909627969 1:77740322-77740344 AGATATTTGAAGGTGATAGCTGG - Intronic
909795465 1:79729739-79729761 AGTTGTTTAAAGTATATTGCTGG - Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910392666 1:86760905-86760927 AGTGCTATGAAGAATAAAGCAGG - Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911000144 1:93156095-93156117 AGTTATTTGAAAACTATAAAAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911860539 1:102942097-102942119 ATTTATTTGAAGAAGATAAAAGG - Intronic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912483820 1:110007956-110007978 AATTCTTTGAAGAATAAAACTGG - Intronic
913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916285315 1:163099526-163099548 AGTTATTTGCAGAAGATCGGAGG - Intergenic
916639313 1:166709972-166709994 TGTTATTTTAGGAATATTGCTGG + Intergenic
916698907 1:167270193-167270215 ATTTATTTGAAGAACATATGGGG - Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917252931 1:173081962-173081984 AGTTATGTGAAGAATGTAATTGG - Intergenic
917295864 1:173518540-173518562 AGTTACTTCAAGAAAATAACTGG + Intronic
917340166 1:173967992-173968014 ACCTATTTGAAAAATAGAGCTGG - Intronic
917746551 1:178014234-178014256 AGTTATGTGAAGAATGATGCTGG + Intergenic
918147456 1:181770083-181770105 AGTTACTTGAGCAAAATAGCTGG + Intronic
918731268 1:188000561-188000583 AGTTATTAGAAGACTAGAGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919354833 1:196508538-196508560 AGATATTTGAATAAAATATCTGG + Intronic
919533827 1:198761212-198761234 AGTTATGTGAAGAATATCAATGG - Intergenic
920802329 1:209201029-209201051 AGTGATTTAAAGAATATGGGAGG - Intergenic
921013396 1:211164227-211164249 AGTTATTTGAAGAATGTCAATGG + Intergenic
922310832 1:224388713-224388735 AATTATTAGAAGAATTCAGCAGG - Exonic
922389991 1:225131054-225131076 AGTTAATTGTAGAATGTAGGTGG + Intronic
923180209 1:231510443-231510465 AGTTATTTAAAAAATATTACTGG + Intergenic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063051841 10:2457970-2457992 AGTTATGTGGAGAATATACTAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1064894925 10:20224268-20224290 AGACATTTGAAAAATACAGCCGG - Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1066554538 10:36596808-36596830 AGTTATAAGGAGTATATAGCAGG + Intergenic
1066637937 10:37525258-37525280 AGTTTTTTAAAAAAAATAGCTGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1067665871 10:48278508-48278530 AGTTCTGTGAAGAATATTGTTGG + Intergenic
1068138923 10:52979552-52979574 AGTTATTTCTAGAATGTTGCTGG + Intergenic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068455083 10:57244147-57244169 GGTTATATAAAAAATATAGCAGG + Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070016608 10:72539959-72539981 AGTTATTTTCAGCATATACCTGG - Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072036172 10:91564843-91564865 AATTTTTTGACGAATATATCAGG - Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073934402 10:108613700-108613722 ACTTATGTCAAGAATATAGTAGG - Intergenic
1074277348 10:112016174-112016196 ATTTGTTTGAAGAATATAACAGG - Intergenic
1074761848 10:116672752-116672774 TCTTATTTGTAGAATATGGCTGG + Exonic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1078535980 11:12174680-12174702 AGTTATTTTAGGTATATACCAGG + Intronic
1079581511 11:22070168-22070190 AGTTATGTGAAGAATATTATTGG - Intergenic
1079704733 11:23600058-23600080 AGTTCTGTGAAGAATATAGGTGG + Intergenic
1080065411 11:28006367-28006389 TGTTATTGGAGGAATATAGAAGG - Intergenic
1080486091 11:32708429-32708451 AGTTCTGTGAAGAATAATGCTGG + Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081195989 11:40161451-40161473 AGTTATTTGAAAATTAGAGGAGG + Intronic
1081462636 11:43286110-43286132 AATAATTAGAAGAATATGGCAGG + Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1087002580 11:93435613-93435635 AGTTATTTGACCAAAGTAGCAGG + Intronic
1087030019 11:93693403-93693425 AGTTTTTTCAAAAATACAGCTGG + Intronic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088589177 11:111388131-111388153 AGTTATAAGAAAAATATATCAGG - Intronic
1088800430 11:113301605-113301627 AGTTATGTGAAGAATGTTGATGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089725224 11:120471766-120471788 TGTTAATTGTAGAATATAGATGG + Intronic
1089907559 11:122058061-122058083 AGTTCTTTGAAGAATAGGTCTGG - Intergenic
1089913093 11:122123436-122123458 AGTTATTAGGAAAACATAGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1091051736 11:132378728-132378750 AATTATTTGTAGAAGATGGCAGG - Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092938986 12:13390167-13390189 AGTTTTTAGAAGAAGATAGAGGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093119468 12:15251105-15251127 ATTTATTTGAAGAATGTTACTGG - Intronic
1093611183 12:21160084-21160106 AGTTCTGTGAAGAATATTGCTGG - Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093903625 12:24663693-24663715 AGTTACTTGAAAATTATAGGTGG + Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095113646 12:38328411-38328433 AGTAATTTCACGAATATAGAGGG - Exonic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097789349 12:63797756-63797778 AGTGATTTGAAGGAGACAGCTGG + Intronic
1097790893 12:63814435-63814457 AGTTATTTTAACAGTAAAGCAGG - Intergenic
1098714364 12:73810983-73811005 AGGTATTTGAGGAATATATTAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098831907 12:75374052-75374074 AGTTATCTGCGGAAGATAGCAGG + Intronic
1098980273 12:76948348-76948370 AGTCATGTAAAGCATATAGCTGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099273842 12:80550180-80550202 TGTTATTTGAATAAAATATCCGG + Intronic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099413477 12:82359524-82359546 AATTATTTGAAGAATAGACTAGG + Intronic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099534191 12:83825460-83825482 ATTTCTTTGAAGAATAATGCTGG + Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099735783 12:86565012-86565034 AGTTATCTGCAGAAGATAGTAGG - Intronic
1099784315 12:87240886-87240908 TGTTTTTTGAAGACTATAGTAGG - Intergenic
1099890304 12:88581598-88581620 AGTTATTTTAATAATAGAGTAGG + Intergenic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100244825 12:92746684-92746706 AGTTATTTGAAAACAATAGTTGG - Intronic
1100470439 12:94888133-94888155 AGTTATTTTAAGAATAAAAGAGG - Intergenic
1101311372 12:103583206-103583228 AGCTATTTGTAGAATAAAGCTGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1101572147 12:105963414-105963436 AGCTATCTGCAGAATATAACGGG + Intergenic
1102827418 12:115961182-115961204 GGTTATTTGCAGAGTGTAGCAGG + Exonic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1105589468 13:21778006-21778028 GGTTATGTGAAGAATCTAGCAGG - Intergenic
1106426871 13:29639462-29639484 AGTTATTTAAATAATTGAGCTGG - Intergenic
1106444187 13:29809848-29809870 AGTGATTTAAAGTATATAGGAGG - Intronic
1107373930 13:39781814-39781836 AATTATTTGAAAAATATATTTGG - Intronic
1107800041 13:44097667-44097689 AACTATATGAAGAATATAGTTGG - Intergenic
1108234378 13:48387830-48387852 AGTAATTTTAAGAATATAAAAGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109617366 13:64852915-64852937 AATTATTTGAAGAATAGACTAGG + Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110171096 13:72501483-72501505 AATGATTTGAAGAATACAGGAGG + Intergenic
1110514708 13:76396323-76396345 AGGTATTGGAAGAATAGAGTTGG + Intergenic
1111077456 13:83255899-83255921 AGTTATTTTAAATATATATCCGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111672947 13:91350968-91350990 ATTCATTTGAAGGAAATAGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112848421 13:103672820-103672842 AGTAATTTGTAGAATATCCCAGG - Intergenic
1112979502 13:105364912-105364934 AATTATTTGAAGATTATTGTAGG - Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114544521 14:23488789-23488811 AGTTAATTGATTATTATAGCAGG - Intronic
1115965460 14:38882529-38882551 AGTTAATTGAATTATATAGTTGG - Intergenic
1116058905 14:39896911-39896933 AGTTATCTGTAGAATATGGCAGG - Intergenic
1116068091 14:40009144-40009166 AGTTATCTGAAGAAGATGGGAGG - Intergenic
1116339982 14:43710014-43710036 AGGTATTTGTAAAATATAACTGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1116818185 14:49602650-49602672 AGTTATTTTAAAAATTTATCCGG - Intronic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119605515 14:76012876-76012898 AGTAATTTAAAGAATAAACCAGG + Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1125444649 15:39740767-39740789 ATTTTTTTGATGAAAATAGCTGG + Intronic
1126003821 15:44237456-44237478 AGTTATGTAAAGAAAATAGCAGG + Intergenic
1126338662 15:47615275-47615297 AGTGATTTAAAGTATATGGCAGG + Intronic
1126919172 15:53501547-53501569 AGTTATTTGAAGAATGATGATGG + Intergenic
1127037960 15:54940292-54940314 ACTTATTTGAACAAAACAGCAGG - Intergenic
1127351275 15:58155075-58155097 AGTGATTTGGAGAATTAAGCAGG - Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127572384 15:60256905-60256927 AATAACTGGAAGAATATAGCTGG + Intergenic
1128396928 15:67236126-67236148 AGATTTGTGAAGAATATTGCAGG - Intronic
1131363552 15:91817632-91817654 AGTTATTTTAAGACTGTAGTTGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1137289178 16:47040064-47040086 AGTGAGTTGAAAAACATAGCAGG + Intergenic
1138319102 16:56096026-56096048 AATTTCTTGAGGAATATAGCTGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139064677 16:63298148-63298170 AGATATTTGCATAATATTGCAGG + Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142839484 17:2616057-2616079 GGCTATTTGAAGAATAAAGTAGG - Intronic
1143585978 17:7850586-7850608 AGTTATTTGAAGCACATTTCAGG + Intronic
1144370630 17:14587419-14587441 AATTATTTCAAAAATATAACTGG - Intergenic
1146205233 17:30898649-30898671 ACTTATTATAAGAATAAAGCTGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146439159 17:32878231-32878253 ATTTATTTAAAAAAAATAGCTGG - Intergenic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1148920774 17:51031231-51031253 AGATGTTTGATGAATAAAGCTGG + Intronic
1149142758 17:53454045-53454067 AGTTCTTTGAAGAATGATGCTGG - Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154035285 18:10795570-10795592 TTTTATTTGAAGAATAGAGCTGG + Intronic
1154225561 18:12500607-12500629 AGTTATTTGGGGTATATACCTGG - Intronic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156562533 18:38143862-38143884 TTTTATTTGAAGAATTTAGATGG + Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156651426 18:39231055-39231077 AGAAATTTGAAGACAATAGCTGG - Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157624203 18:49035955-49035977 AGTTATTCAAAGAATACAGAAGG - Intergenic
1159281278 18:66289191-66289213 AATTATCTGTGGAATATAGCAGG - Intergenic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159899308 18:74028789-74028811 ATTTATTTGAAGAATATTTTGGG - Intergenic
1159926521 18:74274713-74274735 AGTTATTTGAAGAATATAGCTGG - Intronic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1166261277 19:41643170-41643192 TGTTATTTGAAAAAAAAAGCTGG + Intronic
1168537843 19:57186207-57186229 ATTTATTTGAAGATTAAAGATGG + Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
926351948 2:12003759-12003781 TGTTATTTGAGAAATTTAGCAGG + Intergenic
926512722 2:13802555-13802577 AGTTCTTTGAAGAAAATAAAAGG - Intergenic
928100253 2:28432635-28432657 ATTTATTTGATGACTCTAGCCGG + Intergenic
928798452 2:35055784-35055806 AGTTATGTGAAGAATAATGACGG + Intergenic
932869832 2:75387777-75387799 AATTATTTGAAGAATATCAATGG + Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
936847758 2:116857133-116857155 AGTTATTTGAAGAATGTCATTGG - Intergenic
937800324 2:126074699-126074721 ACTTATCTGAAGAAGATGGCAGG - Intergenic
937933474 2:127223202-127223224 ACCTATTTGAAGAATAAAACAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939259628 2:139790406-139790428 AGCTATTTGAAGAACATAGAGGG - Intergenic
939407932 2:141783512-141783534 AGTTATGTTAGGAATAGAGCTGG - Intronic
939593815 2:144100319-144100341 AGTCATTTGAATAATCTGGCTGG - Intronic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940291439 2:152081137-152081159 AGTCATTTCCAGAATAAAGCAGG + Intronic
940405644 2:153298831-153298853 AATTATTTGAAGAATATCAGGGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942397037 2:175561126-175561148 AGTTATTGGAAGGATCTGGCTGG - Intergenic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943851373 2:192727279-192727301 AGTTGTTTGAAGAATAAAATAGG + Intergenic
943991330 2:194696492-194696514 AGTTATTAGAAGTATATTGAAGG - Intergenic
944664385 2:201947575-201947597 AGGTATTTGAAAAAAAAAGCAGG + Intergenic
944887228 2:204075742-204075764 AGTTATTTTAAGAATTAAACAGG - Intergenic
945025539 2:205616409-205616431 ATTTATTTGTAGAATTTATCAGG + Intronic
945368188 2:208982728-208982750 AGTTATTTTAAGAATGTTCCTGG - Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946551727 2:220808740-220808762 AGTTATCTCAAAAAAATAGCAGG - Intergenic
947209564 2:227695897-227695919 GGTTATAAGAAGCATATAGCTGG + Exonic
947346247 2:229192070-229192092 AATTATTAGAAGAAAATAGGGGG + Intronic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948739679 2:240035614-240035636 ATTTCTTTGAAGAATATCACTGG + Intergenic
1169645449 20:7804235-7804257 AGATATTTGGGGAATATAGGGGG + Intergenic
1169859572 20:10137086-10137108 AGTGATTTGCTGAATAGAGCAGG + Intergenic
1172476084 20:35238809-35238831 AGTGCTGTGAAGAATAGAGCCGG - Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176947651 21:15003190-15003212 AGTTATTTGAAAATTAAGGCAGG - Intronic
1177303425 21:19281232-19281254 GATTATTTGAAGTATATAGGAGG - Intergenic
1177401241 21:20607614-20607636 ATTTATTAGAAGAGTATATCTGG + Intergenic
1177545912 21:22559189-22559211 AGTTATGTGAAGAATGTCACTGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178028414 21:28495125-28495147 ACTTATTTTAAGGTTATAGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178145205 21:29731462-29731484 ATTTATTTGAAGAATTTAATAGG - Intronic
1179414155 21:41184943-41184965 AGTTAGATGACGAATATATCTGG - Intronic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180084661 21:45502467-45502489 AGTTATTTGATGAAAATAGATGG + Intronic
1180277779 22:10661405-10661427 ATTTAGGTGAAGAATATATCAGG - Intergenic
1180520074 22:16189894-16189916 ATTTATGTGAAGAATTTAACTGG - Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1183769427 22:39911231-39911253 AGTTATTTTAAAAATATAACTGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
950389635 3:12686464-12686486 AGTTATTTTAAAAAAATAGAGGG - Intergenic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951161143 3:19424076-19424098 AGTTCTTTGAAGAATAATGATGG - Intronic
951207868 3:19943395-19943417 AGTCATTTGAAGAATTTATGGGG - Intronic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952510594 3:34050114-34050136 AGTTAATTGAAGAAGAGAGATGG - Intergenic
953066843 3:39481031-39481053 AGTAATGTGAAGAAAATAGAAGG - Intronic
953762082 3:45696462-45696484 AGTTATTTTGAGTATATACCCGG + Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
956104742 3:65806128-65806150 ATTTTTTTCAAAAATATAGCTGG + Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957138642 3:76323515-76323537 AGGTATTTGGAGAATATTGATGG + Intronic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957486828 3:80872030-80872052 AGTTATTTGAAGAATGTTATTGG - Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957874587 3:86129294-86129316 AGTAATCTGAAGAAGACAGCAGG - Intergenic
958009094 3:87852481-87852503 ATTTATTTGATAAATATATCTGG - Intergenic
958041342 3:88230400-88230422 TGTTATTTCAAGGATATAGGTGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
958498620 3:94876596-94876618 AGTTAGCTGAAGAATATTGGAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959547565 3:107614628-107614650 AATGATTTCAAGAATATAGGAGG - Intronic
959558789 3:107755211-107755233 ATTTTTTTGAAGAATATATCTGG - Intronic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
961080325 3:124021395-124021417 AGTCATCTGAAGAAAATAGTGGG + Intergenic
963925801 3:150949776-150949798 AGTTATGTGAAGAATGTCGTTGG - Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
964994511 3:162859353-162859375 TTTTATATGAAGAATATAGTTGG - Intergenic
965102244 3:164312700-164312722 AGTTATGTGAAGAATATTGGTGG - Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965318160 3:167216588-167216610 AGTTCTGTGAAGAATATTGTTGG - Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966470731 3:180285994-180286016 AGTTCTTTGGAGAATATAATAGG - Intergenic
968207115 3:196813056-196813078 AGTTAATTGAAGGCCATAGCTGG + Intronic
970944550 4:21675430-21675452 AATAATTTAAAGAATGTAGCTGG + Intronic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971136618 4:23875661-23875683 ATTTAGCTGAAGAATATCGCTGG - Intronic
971707666 4:30068071-30068093 AGTTATTGGAAGAATCGAACTGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973006186 4:45009607-45009629 AGTAATTTGAAGAAGAAATCAGG + Intergenic
973024171 4:45246272-45246294 AGTTATTTGAAGATGATTACTGG - Intergenic
973101478 4:46277140-46277162 AGTTGTTTCAGGAATATAGGTGG - Intronic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
974569164 4:63622588-63622610 AGTTTTTTAAAGAATATCTCTGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
976013869 4:80525768-80525790 AGTTATCTGAAGAAGTGAGCTGG - Intronic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976098828 4:81538664-81538686 TGTTTTTTGAAGATTAGAGCAGG - Intronic
976275161 4:83268828-83268850 ATTTACTTGAAGAATATGTCTGG - Intronic
976283978 4:83353314-83353336 AGTTAATTGTAGAATCTAGGTGG - Intergenic
976768708 4:88627426-88627448 GATTATTTGAAGTATATAGGAGG + Intronic
977035919 4:91953040-91953062 AGTTATTTGAAGATTAAAACAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978315535 4:107432352-107432374 ATTTATTAGAAGAATATTGTGGG + Intergenic
978341593 4:107725579-107725601 AGTTATCTGGAGAATATGTCAGG + Intergenic
978456011 4:108892776-108892798 AGTGCTGTGGAGAATATAGCAGG + Intronic
978705955 4:111711543-111711565 AGTTCTTTGAAGGATCTAGGAGG + Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
979595735 4:122532215-122532237 AGTTCTCTGAAGATGATAGCAGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980261476 4:130455115-130455137 GATTATTTGAAGTATATAGGAGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
981448606 4:144869700-144869722 AGTTATTTTAAGAAAACAACAGG + Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981703781 4:147637677-147637699 ATTTATTTTAAAAATAAAGCTGG + Intronic
982271834 4:153598285-153598307 AGTTATTAGAAAAATATATGAGG + Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983323117 4:166219622-166219644 ATTTATTTAAAGAATTTACCTGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983621973 4:169771583-169771605 ACTTATTTAAAAAATATGGCCGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984525577 4:180855600-180855622 TGCTATTTGATTAATATAGCTGG + Intergenic
984557509 4:181232853-181232875 AATTATTTGCAGAATTTAGTAGG + Intergenic
984986194 4:185332097-185332119 ATTGATTTGTAGAATATATCAGG + Intronic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986103315 5:4634083-4634105 GGTTATTTGTAGCAAATAGCAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG + Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987270058 5:16298298-16298320 AGTTCTGTGAAGAATATCACTGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988119301 5:26940438-26940460 AGATATTTGAAGAATATGCAGGG + Intronic
988786155 5:34567225-34567247 AGTTATGTGAGGAATTCAGCTGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989297388 5:39845807-39845829 ATTTATGTGAAGAATGTAACTGG + Intergenic
989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
990547581 5:56838333-56838355 TGTCTTTTGAAGCATATAGCAGG + Intronic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991302352 5:65141314-65141336 AGTTCTGTGAAGAATATCGTGGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992345689 5:75875022-75875044 TGTTATTTGAAGAATGTCGTTGG - Intergenic
992816280 5:80442888-80442910 AGTTATTTCAATATTATATCTGG - Intronic
993203391 5:84847511-84847533 AGTTATCTGCAGAAGACAGCAGG - Intergenic
993319825 5:86458549-86458571 AGTTATCTGCAGAAGATAGTAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993461248 5:88185077-88185099 ACTTATTAGAAGAAAAAAGCAGG - Intergenic
993593680 5:89826601-89826623 AGCTAATTAAAGAACATAGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994429140 5:99633391-99633413 AGTTCTGTGAAGAATATAAATGG + Intergenic
994442996 5:99835027-99835049 TTTTATTTGAAGAATAAAGGAGG + Intergenic
994626111 5:102221145-102221167 AGTTATGTGAAGAATAATGTTGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995079658 5:108034488-108034510 AGTGATTTGAAGAAAACTGCTGG - Intronic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996138562 5:119875689-119875711 ATTTTTATGAAGAAGATAGCTGG - Intergenic
996401045 5:123062925-123062947 AGTTACTGGTAGAATATAACTGG - Intergenic
996845772 5:127897411-127897433 AGTTCATTGAAGTATTTAGCTGG + Intergenic
997087239 5:130816143-130816165 AATTATTTGAAGGATATAGTTGG - Intergenic
997680336 5:135745843-135745865 AATTATGTCAAGAAAATAGCTGG + Intergenic
999110286 5:149114425-149114447 ACTTATTTAAAGGAAATAGCAGG - Intergenic
999280643 5:150363153-150363175 AGCTATATCAAGAATATTGCTGG - Intronic
1000454687 5:161435427-161435449 ATTTATTCAAAGAATATAGAAGG + Intronic
1000933130 5:167276909-167276931 AGATAATTAGAGAATATAGCTGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001617335 5:173053647-173053669 AATTATTTTAAGAATTTGGCCGG + Intergenic
1001838821 5:174855707-174855729 AGTTATTCACAGAAGATAGCAGG - Intergenic
1002116950 5:176969732-176969754 AGTTATTTTAATAATAAACCTGG - Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005175884 6:23044244-23044266 AGTTATTTGGACAAAATAACTGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005468394 6:26137907-26137929 AGTTATTTGAGGAATTGAGAAGG + Intronic
1005593537 6:27353485-27353507 ATTTCTTTGAAGAATATAATTGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007575038 6:42919882-42919904 AGGTATTTTAAAAATGTAGCCGG + Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008233316 6:49012284-49012306 GCTTATTTGAATAATATTGCAGG - Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008823430 6:55661739-55661761 AGTTCTGTGAAGAATATCACTGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010108012 6:72190934-72190956 AGTTATCTGCAGAAGACAGCAGG + Intronic
1010899283 6:81406066-81406088 AGTCTTTTGAAAAATATGGCAGG + Intergenic
1011012084 6:82713953-82713975 ACTGATTAGGAGAATATAGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011257140 6:85434351-85434373 AGTTCTGTGAAGAATATAGTTGG + Intergenic
1011323665 6:86125277-86125299 AGTGAGTTGAAGAGAATAGCAGG - Intergenic
1011569680 6:88721716-88721738 AGTAATTTGAAGATTGTAGGTGG - Intronic
1011628669 6:89303554-89303576 AGTTCTGTGAAGAATATCTCTGG - Intronic
1011837493 6:91451463-91451485 AGTAATTTGAAGAAGAAATCAGG - Intergenic
1012001905 6:93664421-93664443 AGATATTTGCAGAAGATAGTAGG - Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013857155 6:114587094-114587116 ATTTATTTTAAAAATGTAGCTGG + Intergenic
1014082639 6:117305236-117305258 ATTTTTTTGCAGAATAAAGCAGG - Intronic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014904593 6:127010848-127010870 AGTTTTTTAAAGCAGATAGCAGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015834696 6:137407681-137407703 AGTTCTGTGAAGAATATTGTTGG + Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017105422 6:150883473-150883495 AACTATTAGAAGAATAGAGCTGG - Intronic
1017382759 6:153849012-153849034 AGTTATATGAAGAATAGTGCAGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018289914 6:162281519-162281541 AGCTATGTGTAGGATATAGCAGG - Intronic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1020710788 7:11602160-11602182 ATTTATTAGAAAAATATATCTGG - Intronic
1020987410 7:15153861-15153883 AGTTATGTGAAGAATAATGGTGG + Intergenic
1021109985 7:16682545-16682567 AATTCATTCAAGAATATAGCAGG - Intronic
1021967597 7:25936540-25936562 AGTTCTGTGAAGAATATCACTGG - Intergenic
1023961528 7:44930957-44930979 AGTTTTTTTAAGCATAGAGCAGG - Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024531334 7:50395061-50395083 TGTTATTTTAACAATATAACAGG - Intronic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1027968971 7:85052224-85052246 AGCAATTTGAAGAATGTATCTGG - Intronic
1028063474 7:86350772-86350794 AATTGTTTGAACAAGATAGCTGG + Intergenic
1028119972 7:87046413-87046435 ATTTCTTTGAAGAATATCGTAGG - Intronic
1028345091 7:89770037-89770059 AGTTCTTTTAAGTATATACCTGG - Intergenic
1028346092 7:89784883-89784905 AGTTCTTTGAAGAATGTAGTTGG - Intergenic
1029300232 7:99577019-99577041 ACTTATTTAAAAAATATGGCTGG - Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030744503 7:113148706-113148728 AGTTATTTTAAGAGTATAATTGG + Intergenic
1031319976 7:120312518-120312540 AGTGATTTGTAGAAGATATCTGG + Intronic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1031735171 7:125350554-125350576 GATTATTTGAAGAATAAAGGGGG + Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1034019954 7:147631446-147631468 AGTTCTGTGAAGAATATTGATGG - Intronic
1035818965 8:2571104-2571126 AGTCATTTGAAGTGTATACCAGG - Intergenic
1036282308 8:7411110-7411132 TGTTATTAGATGAATATAGGAGG + Intergenic
1036339160 8:7900460-7900482 TGTTATTAGATGAATATAGGAGG - Intergenic
1036590679 8:10165160-10165182 AGCTCTTAGAAGAATACAGCTGG + Intronic
1036942601 8:13065948-13065970 AGTCATTTGAAGAAGAGACCTGG + Intergenic
1037045041 8:14289369-14289391 AATTATTTGAAGAAAATATAGGG - Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038194052 8:25350268-25350290 AGTTATTTGAAGCATTAAGCAGG + Intronic
1038246457 8:25860893-25860915 GGTTATTTCAAGATTATAGATGG - Intronic
1038306830 8:26412031-26412053 TCTTTTTTCAAGAATATAGCTGG + Exonic
1039282439 8:36000450-36000472 ATTTATGTGAAGAATATTGAAGG - Intergenic
1039416057 8:37394883-37394905 ATTTATTTGAAGGATATAAAGGG - Intergenic
1039809350 8:41031947-41031969 AGTTATTTTAAGAAGATTGTAGG - Intergenic
1041299163 8:56392976-56392998 AGTTAGTAGACGAATATATCCGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044214129 8:89587384-89587406 AGTTCTTTGAAGAATATTGTTGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045754119 8:105521871-105521893 AGTTATTTGAAAGATTTGGCTGG - Intronic
1046128677 8:109941632-109941654 AGTTATCTGAAGAAGATTGTGGG + Intergenic
1046417642 8:113937824-113937846 AGTTGTCTGAAGAAGATGGCAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1048115753 8:131520196-131520218 TGTTATGTGAAGTATCTAGCAGG + Intergenic
1050062594 9:1725709-1725731 AGTTATTTGTTGAATGTAGGTGG + Intergenic
1050107564 9:2181693-2181715 ATTTACTTGAAGAATAAAGTTGG - Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051290669 9:15542519-15542541 TATTATTTTAAAAATATAGCTGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052590248 9:30483000-30483022 AGTTTTGTGAAGAATATTGTTGG - Intergenic
1053335821 9:37269968-37269990 AGTTATCTGAGGAAAATAGAGGG + Intronic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054834657 9:69664113-69664135 AACTATTTGGAGAAGATAGCCGG + Intronic
1055246689 9:74254205-74254227 CATTATTTGAAGATTAAAGCAGG - Intergenic
1055548064 9:77402518-77402540 AGCTATTTAAAGTACATAGCAGG - Intronic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058704706 9:107628679-107628701 ATTTATTTGAAAAATTTGGCTGG - Intergenic
1059545349 9:115170386-115170408 AACTATTTGGAGAATATAGCAGG - Intronic
1060285173 9:122244772-122244794 AGTTATTTGAAGTTTAAAACAGG - Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187020030 X:15371362-15371384 CTTTTTTTCAAGAATATAGCTGG + Intronic
1187166948 X:16813033-16813055 AGTCATCTGAAAAATATATCTGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188144023 X:26587262-26587284 AGTACTTTAAAGAATATAGTGGG - Intergenic
1188515334 X:30979766-30979788 AGTGATTTGAACAGTATACCTGG + Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189899256 X:45689019-45689041 AGTTATGTGAAGAATCTCGATGG + Intergenic
1189899507 X:45691434-45691456 AGTTATGTGAAGAATCTCGATGG - Intergenic
1190255269 X:48757773-48757795 AGTTATCTGCAGAGAATAGCAGG - Intergenic
1191095709 X:56671205-56671227 AGTTATCTGTGGAAGATAGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1191932924 X:66394130-66394152 AGTTATCTGCAGAAGACAGCAGG - Intergenic
1192019305 X:67368191-67368213 AGTTCTGTGAAGAATGTTGCTGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193067842 X:77278285-77278307 ATTTAATTGAGGCATATAGCTGG - Intergenic
1193581180 X:83265015-83265037 AGTTCTTTGAAGAATGTCACTGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193912348 X:87321319-87321341 AGTTTTTTGAAGAATAAAATAGG + Intergenic
1194133619 X:90111987-90112009 AGTTCTTTGAAGAATATTATTGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194364993 X:93003889-93003911 AGTTCTTTGAAGAATGTCACTGG + Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195460933 X:105123284-105123306 ATATATTTAAAGAATATTGCAGG - Intronic
1195681031 X:107546816-107546838 AGTTGTTGGGAGAAGATAGCAGG + Intronic
1195824624 X:108984861-108984883 ATTTATGTGAAAAATATTGCTGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197044411 X:121978294-121978316 AGTTACCTGCAGAATATGGCAGG - Intergenic
1197242867 X:124138287-124138309 AGTTCTGTGAAGAATATTGTTGG + Intronic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197293817 X:124692708-124692730 AGTTATTTGAAAATTCTGGCCGG + Intronic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197792017 X:130265195-130265217 ATCTATTTGTAGAAAATAGCTGG + Intronic
1198145601 X:133853767-133853789 AGATATTTAAAGTATAGAGCTGG + Intronic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199144445 X:144348997-144349019 AGGTATCTGAAGAAGATAGCAGG + Intergenic
1199844991 X:151686264-151686286 AGCTATTTGCAGAGTATATCTGG + Intergenic
1199932641 X:152539829-152539851 AGTTATTGCAAGAATATTACAGG - Intergenic
1200479402 Y:3682091-3682113 AGTTCTTTGAAGAATATTATTGG - Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200560470 Y:4695472-4695494 AGTAATTTAAAGAGTATAGTTGG + Intergenic
1200673220 Y:6120147-6120169 AGTTCTTTGAAGAATGTCACTGG + Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic