ID: 1159926708

View in Genome Browser
Species Human (GRCh38)
Location 18:74276073-74276095
Sequence TGCCAGGCTCACAGAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 466}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159926708_1159926716 19 Left 1159926708 18:74276073-74276095 CCACCTCCTCTGTGAGCCTGGCA 0: 1
1: 0
2: 4
3: 42
4: 466
Right 1159926716 18:74276115-74276137 CTGGAGATCTTGACTCCAAACGG 0: 1
1: 0
2: 0
3: 12
4: 119
1159926708_1159926718 24 Left 1159926708 18:74276073-74276095 CCACCTCCTCTGTGAGCCTGGCA 0: 1
1: 0
2: 4
3: 42
4: 466
Right 1159926718 18:74276120-74276142 GATCTTGACTCCAAACGGTAGGG 0: 1
1: 0
2: 0
3: 0
4: 38
1159926708_1159926717 23 Left 1159926708 18:74276073-74276095 CCACCTCCTCTGTGAGCCTGGCA 0: 1
1: 0
2: 4
3: 42
4: 466
Right 1159926717 18:74276119-74276141 AGATCTTGACTCCAAACGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 35
1159926708_1159926719 30 Left 1159926708 18:74276073-74276095 CCACCTCCTCTGTGAGCCTGGCA 0: 1
1: 0
2: 4
3: 42
4: 466
Right 1159926719 18:74276126-74276148 GACTCCAAACGGTAGGGTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 80
1159926708_1159926713 0 Left 1159926708 18:74276073-74276095 CCACCTCCTCTGTGAGCCTGGCA 0: 1
1: 0
2: 4
3: 42
4: 466
Right 1159926713 18:74276096-74276118 TCAAAACCAGGCAACTGACCTGG 0: 1
1: 0
2: 4
3: 19
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159926708 Original CRISPR TGCCAGGCTCACAGAGGAGG TGG (reversed) Intronic
900093817 1:932302-932324 GGCCAGGCAGACGGAGGAGGGGG - Intronic
900251216 1:1671017-1671039 TGGCAGGCTCCCAGAGGAGAGGG - Intronic
900331402 1:2136502-2136524 TGCCAGGAGCACCGAGGATGTGG + Intronic
900534961 1:3172218-3172240 TGCCTGTTTTACAGAGGAGGAGG + Intronic
900592241 1:3465300-3465322 TGCTGGGAGCACAGAGGAGGGGG + Intronic
900934930 1:5759119-5759141 TCCCAGGCTCTAAAAGGAGGAGG + Intergenic
901756807 1:11446362-11446384 TGCCAGCATCACAGAGGTGCTGG - Intergenic
901876435 1:12169441-12169463 TCCCAGGATCACAGAGCTGGGGG + Intronic
901978088 1:13011335-13011357 TACCAGGGTCACACAGGTGGTGG + Intronic
902003998 1:13217603-13217625 TACCAGGGTCACACAGGTGGTGG - Intergenic
902023221 1:13363347-13363369 TACCAGGGTCACACAGGTGGTGG - Intergenic
902087155 1:13872410-13872432 AGCCAGGCTCACAAAGGACAGGG + Intergenic
902542038 1:17162652-17162674 GGCCAGTCTCCCAGAGGAAGGGG + Intergenic
902625370 1:17673315-17673337 TGCCGGGCTCAGAGGGGAGGGGG - Intronic
903137250 1:21317650-21317672 TGCCTAGCTCACAGAGGGGAGGG - Intronic
903856847 1:26342899-26342921 TTCCAGGATCACAGATGGGGAGG + Intronic
904233343 1:29096163-29096185 TGGCATTCGCACAGAGGAGGTGG + Intronic
905023756 1:34836171-34836193 TGGCAGCTTCCCAGAGGAGGTGG - Intronic
905894238 1:41534782-41534804 TGCTGGGCTCCCAAAGGAGGCGG + Intronic
906241262 1:44243551-44243573 GGCGAGACTCCCAGAGGAGGTGG + Intronic
906280768 1:44551952-44551974 AGTCAGGCCCTCAGAGGAGGTGG - Intronic
906925369 1:50110280-50110302 TTGAAGGCTCACAGAGGCGGTGG - Intronic
907185511 1:52606140-52606162 TGCCAGGCCCAGAGATGAAGTGG + Intronic
907666233 1:56435976-56435998 TGCCAGGCTGGAGGAGGAGGGGG - Intergenic
907709569 1:56866630-56866652 TGCCTGGCTCTCAGAGGCTGTGG + Intronic
908510770 1:64848441-64848463 TGGCAACCTCACAGAGGAGATGG + Intronic
910088356 1:83431324-83431346 TGCCAGGGTTAAGGAGGAGGTGG - Intergenic
911132220 1:94400588-94400610 TGCCAGCCTGACATAAGAGGTGG + Intergenic
912143146 1:106756428-106756450 TTACAGGCTCACAGATGAAGAGG + Intergenic
913389876 1:118298644-118298666 TGCCAGGCTGAAAGAAGAAGAGG + Intergenic
913984290 1:143551221-143551243 TCCCTGGCTCACAGAGTGGGGGG + Intergenic
915284246 1:154842644-154842666 GGGAAAGCTCACAGAGGAGGTGG - Intronic
915444718 1:155968051-155968073 TGCCAGGGGAACAGGGGAGGCGG - Intronic
919739314 1:200972718-200972740 TGCAAAGCAAACAGAGGAGGCGG + Intronic
919747354 1:201017104-201017126 AGGCAGGCTAACAGGGGAGGGGG + Intronic
919807225 1:201387257-201387279 TGCCAGGGCCACCAAGGAGGAGG + Intronic
919854258 1:201694900-201694922 TGAAAGGCTCACACAGCAGGAGG + Intronic
920040225 1:203090701-203090723 TGCCAGCCTCACAGAGGGAGAGG - Intronic
920134291 1:203757068-203757090 GGAAAGGCTCACAGAGGTGGTGG + Intergenic
921954395 1:220967221-220967243 TGCCAAGCACAGAGGGGAGGAGG + Intergenic
922420708 1:225459660-225459682 TGCTAGGATCACACAGGAGGTGG + Intergenic
922958467 1:229625556-229625578 TGCCGGGCTCGGGGAGGAGGTGG - Intronic
923357642 1:233176394-233176416 TGGCTGGGTCACAGAGAAGGGGG - Intronic
923713248 1:236403786-236403808 GGCCTGGCTCACAGAGGCTGCGG - Intronic
924190245 1:241543924-241543946 TTCCAGGATCTCAGAGGAGGAGG - Intronic
924367324 1:243309078-243309100 TGCCAGGCTCAGAGAAGAAAAGG - Intronic
924843412 1:247738992-247739014 TGACAGCCTCACAGTGTAGGGGG - Exonic
1064217219 10:13410295-13410317 TTCCAGGCTTTCAGAGGTGGAGG + Intergenic
1064290523 10:14030051-14030073 AGCCAGACTCACAGAGGAACAGG + Intronic
1067293807 10:44962943-44962965 GGCCAGGCTCTCAGAGGAAGGGG + Intronic
1069057764 10:63862665-63862687 TGGCAGCCTCACAGGGGTGGGGG + Intergenic
1069948335 10:72002381-72002403 TGCCAGGCCCAGAGGGAAGGGGG + Intronic
1069958172 10:72064144-72064166 GACCAGGCTCTCAGAGGAGGAGG - Intronic
1070300747 10:75202066-75202088 TGCCAGGATAAGAGATGAGGAGG - Intergenic
1070440211 10:76435709-76435731 TGCCATGCTCATAGAGGGGTTGG + Intronic
1070466011 10:76724400-76724422 TTCCAGGTGCACACAGGAGGTGG - Intergenic
1070758385 10:79007664-79007686 TGACAGGGCCACAGAGGAGTCGG + Intergenic
1071500526 10:86200453-86200475 TGCTAGGCTCGCAGAGGGGCAGG + Intronic
1071561950 10:86651937-86651959 AGCCAAGCTTGCAGAGGAGGAGG + Intergenic
1072419509 10:95278029-95278051 TGCCATTATCACTGAGGAGGAGG - Intronic
1072588659 10:96806272-96806294 TGTCGGGCTGATAGAGGAGGGGG - Intergenic
1072632160 10:97153926-97153948 TCCCAGGCTCCCAGAGCAGGAGG - Intronic
1073136624 10:101223960-101223982 TGGCGGCTTCACAGAGGAGGTGG - Intergenic
1074808029 10:117073675-117073697 TGTCAGACTCCTAGAGGAGGGGG - Intronic
1075093938 10:119458865-119458887 TGCCAGGCTCAAGGAGGCTGCGG - Intronic
1075597290 10:123741426-123741448 AGCCAGCCTGACAGAGGAAGGGG - Intronic
1075793126 10:125099689-125099711 TGCCAAGCTACCAGGGGAGGTGG + Intronic
1076027400 10:127127075-127127097 GCCAAAGCTCACAGAGGAGGTGG + Intronic
1076562561 10:131376808-131376830 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562578 10:131376867-131376889 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562595 10:131376926-131376948 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562612 10:131376985-131377007 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562629 10:131377044-131377066 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562646 10:131377103-131377125 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562663 10:131377162-131377184 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076562680 10:131377221-131377243 CACCAGGCCCACAGGGGAGGAGG + Intergenic
1076610999 10:131725877-131725899 TGCAGGGCCCACAGAGGTGGAGG + Intergenic
1076812281 10:132893441-132893463 TCCCAGGTTCACCCAGGAGGAGG - Intronic
1076869309 10:133185788-133185810 ACCCAGGCTCTCACAGGAGGGGG - Intronic
1076869842 10:133187912-133187934 GGCCAGGCTCATGGAGGTGGAGG - Intronic
1077213915 11:1387290-1387312 TGACAGTTTCACAGAGGAGCTGG + Intergenic
1078793060 11:14564209-14564231 TACCAGGGTAACAGAGTAGGTGG - Intronic
1079027421 11:16960305-16960327 TGCCTGGCACCCAGAGCAGGAGG + Intronic
1080429486 11:32185178-32185200 CGCCAGGTACACAGAAGAGGCGG - Intergenic
1080642386 11:34165358-34165380 TGCCAGGGGCACAGAGGAGGAGG + Intronic
1080826293 11:35851945-35851967 TGCCAGGCTAACACAGGTGTAGG - Intergenic
1081608455 11:44542960-44542982 GGCGGGGCTCAAAGAGGAGGAGG + Intergenic
1081743918 11:45459776-45459798 TGCCAGGGTCACAGAGCATTAGG + Intergenic
1081963514 11:47155326-47155348 TGCCAGGCACACAGATGGGCAGG - Intronic
1082842182 11:57698794-57698816 GGCCAGGCTCTTATAGGAGGTGG - Exonic
1083544202 11:63537071-63537093 TGCCAGTTACGCAGAGGAGGTGG - Intronic
1083892067 11:65600432-65600454 TTCCAGGCTCAGAGAGGTTGAGG + Intronic
1083894063 11:65611462-65611484 TGCCAGGCTCAGGGAGGCTGAGG + Intronic
1083931971 11:65851039-65851061 TGCCTGGCTCCCTTAGGAGGTGG + Exonic
1084218920 11:67666087-67666109 GGCCAGGGTCCCAGAGTAGGTGG - Intronic
1084561353 11:69907270-69907292 TACCAGGTCCAGAGAGGAGGTGG + Intergenic
1084778747 11:71395379-71395401 AGCCAGGCCCGCAGATGAGGTGG + Intergenic
1085323785 11:75591480-75591502 TACCAGCCTCACGGAGGAGGTGG - Intronic
1085475505 11:76786355-76786377 GGAAAGCCTCACAGAGGAGGTGG + Intronic
1087168354 11:95026115-95026137 TGCCTGGCACACAGAGGACATGG + Exonic
1087923799 11:103896519-103896541 TGCCTGGCACATAGAGGAGTAGG + Intergenic
1088469636 11:110178569-110178591 GGACAGGTTCACAGAGAAGGTGG + Intronic
1088656690 11:112006338-112006360 TGCCCTGCTCCCAGAGGTGGGGG - Intronic
1088689694 11:112315222-112315244 TGCCATGAACATAGAGGAGGAGG + Intergenic
1088774908 11:113073012-113073034 TGCCAGGGTCTGGGAGGAGGGGG - Intronic
1089149717 11:116355498-116355520 AGCCAGACTCAGAGAGGTGGGGG + Intergenic
1089876733 11:121729241-121729263 TGCCAGGGTTAAGGAGGAGGTGG - Intergenic
1090963954 11:131581960-131581982 TGCCCTGCTCACAGAGGAACAGG + Intronic
1091164686 11:133464709-133464731 TACCAGGAACACAGAGGAGGGGG + Intronic
1091635662 12:2194625-2194647 TACCAGGCTCACAGTGGAGAGGG - Intronic
1091675845 12:2488718-2488740 TGCCAGGCTCCATGAGAAGGTGG + Intronic
1091783792 12:3230375-3230397 AGTCAGGCTCACAAGGGAGGGGG - Intronic
1091971326 12:4789434-4789456 TGGAAGGCTCACATAGGAGGTGG + Intronic
1092957143 12:13561308-13561330 AGCCAGGCCCAAAGAGGTGGTGG + Exonic
1093800391 12:23365086-23365108 TGGCAGGCTCACAGAGGCTGGGG - Intergenic
1094056787 12:26276123-26276145 TGCCAGACTCACATAGCTGGTGG - Intronic
1094230466 12:28096821-28096843 TGAGAGACTCACAGAGGAAGAGG + Intergenic
1094495229 12:30985083-30985105 TTCCAGGCCCACAGATGATGTGG - Intronic
1096183919 12:49566150-49566172 TGCCAGCCGCTCAGAGGATGAGG - Exonic
1096255575 12:50059983-50060005 AGCCTGGCCCACAGAGGAGGAGG + Intronic
1097647916 12:62259483-62259505 TGCCAAGGTCACACAGCAGGTGG - Intronic
1098072974 12:66695891-66695913 GGAAAGGTTCACAGAGGAGGTGG + Intronic
1098649582 12:72947611-72947633 TGACAGGCACACAGTGGAGAAGG + Intergenic
1102004657 12:109581463-109581485 TGCCAGACACACCGAGTAGGCGG - Exonic
1102544678 12:113645962-113645984 TGCCAGGCTCAGAGAGACGTCGG - Intergenic
1102965082 12:117119526-117119548 TCCCAAGCTCACACAGGAAGTGG - Intergenic
1104702655 12:130918746-130918768 TGTGAGGCTCACAGAGGCGAGGG - Intergenic
1104898507 12:132175776-132175798 TGCCAGCCCCACACGGGAGGAGG + Intergenic
1106384027 13:29267007-29267029 TGACAGGCACAGGGAGGAGGAGG + Intronic
1106554201 13:30796151-30796173 TGGCAGGGGCACAGAGGAAGGGG + Intergenic
1108681857 13:52787451-52787473 TGCCAGGCTGGGACAGGAGGGGG - Intergenic
1110470476 13:75854421-75854443 TGACAGGAAGACAGAGGAGGGGG + Intronic
1112051084 13:95644334-95644356 CGCCAGGCGCCCACAGGAGGTGG - Intronic
1112537411 13:100273763-100273785 AGCCAGGCTCCCAGAGGAACCGG + Intronic
1112546208 13:100373580-100373602 TGCCAGGGGCAGAGAGGAAGGGG + Intronic
1113270390 13:108667532-108667554 TCACAGACTCACAGAGGAGATGG - Intronic
1113393233 13:109918188-109918210 AGTCAGGCACTCAGAGGAGGAGG - Intergenic
1113409707 13:110073839-110073861 GGCAAGGCTCTCAGAGGAAGAGG - Intergenic
1113576000 13:111395838-111395860 TGCCAGGAGGACAGAGGAGAGGG - Intergenic
1114482350 14:23043782-23043804 TGCCAGGGTCACACAGTAAGTGG + Exonic
1115382589 14:32756918-32756940 TGCCAGCCTGACAGTGGGGGAGG + Intronic
1115760289 14:36574062-36574084 TGCCAAGCTCAGTGAGGAGAGGG + Intergenic
1118359598 14:65044775-65044797 TGCCCTGCACCCAGAGGAGGTGG - Intronic
1118593739 14:67420232-67420254 TGCCAGCCTCAGAGGAGAGGTGG - Intergenic
1118651332 14:67898416-67898438 TGCCAGGGGCTGAGAGGAGGAGG + Intronic
1118734502 14:68691773-68691795 TGCCAGGCACAGAGACCAGGAGG - Intronic
1119261563 14:73240929-73240951 TGCCTGCCTCACAGAGGGGTGGG - Intronic
1119398741 14:74348146-74348168 GGCCAGGCTTGCAGAGGAGGTGG - Intronic
1119476705 14:74934696-74934718 TTCCAGCCTCTCGGAGGAGGTGG - Intergenic
1120888341 14:89469567-89469589 GTCCAGGTCCACAGAGGAGGTGG - Intronic
1121033856 14:90682779-90682801 TGGCAGGCTGGCAAAGGAGGCGG + Intronic
1121216619 14:92253476-92253498 AGTCAGGAGCACAGAGGAGGTGG + Intergenic
1121337447 14:93085989-93086011 TGGCTGGCTGACGGAGGAGGGGG - Intronic
1121467679 14:94126531-94126553 TGGAAGTCTGACAGAGGAGGAGG - Intergenic
1121473287 14:94173744-94173766 TGCCCGGCTGACGGGGGAGGGGG - Intronic
1122180568 14:99951284-99951306 GCCCAGGCACGCAGAGGAGGTGG + Intergenic
1122252120 14:100447424-100447446 TGCCAGCCTTGCAGTGGAGGAGG + Intronic
1122540809 14:102496806-102496828 TGCCAGTCTCACGGGGGAGATGG - Intronic
1123645291 15:22433494-22433516 AGCCAGGCTCCCAGGGGACGGGG + Intergenic
1123751149 15:23359227-23359249 AGCCAGGCTCCCAGGGGACGGGG - Intronic
1124283524 15:28383145-28383167 AGCCAGGCTCCCAGGGGACGGGG - Intronic
1124299174 15:28528468-28528490 AGCCAGGCTCCCAGGGGACGGGG + Intronic
1124482112 15:30087702-30087724 AGCCAGGCTCCCAGGGGATGGGG - Intronic
1124488570 15:30139802-30139824 AGCCAGGCTCCCAGGGGATGGGG - Intronic
1124543656 15:30608774-30608796 AGCCAGGCTCCCAGGGGATGGGG - Intronic
1124614153 15:31229479-31229501 TGCCACGCACACACAGGGGGTGG - Intergenic
1124754958 15:32398520-32398542 AGCCAGGCTCCCAGGGGATGGGG + Intronic
1125316110 15:38433280-38433302 TGACAGTCTGACAGAGAAGGAGG + Intergenic
1125530722 15:40411794-40411816 TGCAAGGCCCCCAGAGGTGGGGG + Intronic
1125714156 15:41809832-41809854 TGCCTGCCTCACAGAGAAGGTGG - Intronic
1126473826 15:49046140-49046162 TGCCAGGCTCCCAGGTGAGGGGG + Intronic
1127849300 15:62899038-62899060 TGCCAGGACCAGAGAGAAGGAGG + Intergenic
1128062447 15:64743473-64743495 TGCCAGGCACCCGGAGGAAGCGG - Intronic
1128227601 15:66013055-66013077 AGCAAGGCCCACAGAGGAGTGGG + Intronic
1128421251 15:67493281-67493303 TGCCTGGGTCACACAGTAGGTGG + Intronic
1128737445 15:70061208-70061230 TGACAGCCTCACCGTGGAGGCGG - Intronic
1128789230 15:70420684-70420706 TACCAGGCACAAAAAGGAGGAGG - Intergenic
1128934979 15:71738397-71738419 AGACAGGCTCACAGAGGTGAGGG - Intronic
1129775230 15:78232456-78232478 TGCAAAGCTCACAGAGGACTGGG - Intronic
1129787785 15:78320861-78320883 TGCCAGGCAGACAGAGGGGAGGG + Intergenic
1130211166 15:81923910-81923932 TGCCAGGGGCAGAGAGGAGCAGG + Intergenic
1132519428 16:380724-380746 TGCCAAGCTCAGAAAGCAGGAGG + Intronic
1132691703 16:1184504-1184526 TCCCAGGCTCACAGAGGATGAGG - Intronic
1132819373 16:1855538-1855560 TTCCAGACTCACTGAGGGGGTGG + Intronic
1132940837 16:2507307-2507329 TGCCAGGCTAGCAGACCAGGAGG - Intronic
1133796910 16:9053504-9053526 AGCCAGGTGGACAGAGGAGGAGG - Intergenic
1134091846 16:11395761-11395783 GGCCAGGGAGACAGAGGAGGTGG + Intronic
1134816679 16:17211600-17211622 TCCCAGGCTCAGAGAGGGTGAGG + Intronic
1136282734 16:29223368-29223390 TGTCAGCCCCACAGAGGAGAAGG + Intergenic
1136524662 16:30821188-30821210 TGCCACGCTCACACAGGCGCCGG + Intergenic
1136683937 16:31983321-31983343 AGCCAGGCCCCCAGAGGAGGAGG - Intergenic
1136784564 16:32926873-32926895 AGCCAGGCCCCCAGAGGAGGAGG - Intergenic
1136885219 16:33926933-33926955 AGCCAGGCCCCCAGAGGAGGAGG + Intergenic
1136910855 16:34142895-34142917 TGCAAGGATTACAGAGGTGGAGG - Intergenic
1136990496 16:35148687-35148709 ACCCAGCCTCATAGAGGAGGGGG - Intergenic
1138529931 16:57629491-57629513 GGCCAGGCTCAGGGAGGGGGTGG + Intronic
1138558312 16:57785706-57785728 TCCCACGCTGGCAGAGGAGGGGG + Intronic
1138900426 16:61262707-61262729 TCCCAGGCACCCAGAGGAAGTGG - Intergenic
1139436989 16:66942043-66942065 TGCCAGGGGCAGGGAGGAGGTGG - Intronic
1139583552 16:67886770-67886792 TGACAGGCAGAGAGAGGAGGAGG - Intronic
1139588940 16:67922488-67922510 AGGCTGGCTGACAGAGGAGGTGG - Intronic
1141402715 16:83764588-83764610 TGGGAGCCTCACAGAGGAAGGGG - Intronic
1141470676 16:84236372-84236394 AGACAGGCTCAGAGAGGAGGTGG + Intronic
1141668935 16:85481340-85481362 TACCAGGCTCAGAGGGGAAGAGG + Intergenic
1142032283 16:87844544-87844566 TGGCCGCATCACAGAGGAGGGGG - Intronic
1142105517 16:88300337-88300359 TGACAGGCTCAGAGGGGTGGAGG - Intergenic
1203087223 16_KI270728v1_random:1190879-1190901 AGCCAGGCCCCCAGAGGAGGAGG - Intergenic
1142474051 17:179655-179677 TGCCAGGGGCAGAGGGGAGGGGG + Intronic
1142480761 17:216851-216873 TGCCATGGTCACAGGAGAGGGGG + Intronic
1143091224 17:4450105-4450127 GGACAGGGTCAGAGAGGAGGAGG - Intronic
1143139524 17:4733417-4733439 TGACAGGCTCAGAGAGGAGATGG + Exonic
1143336114 17:6172818-6172840 TGCCAGCTTCACTGGGGAGGGGG - Intergenic
1143659880 17:8318336-8318358 TCCCAGGGCCACAGAGCAGGGGG + Intronic
1144847896 17:18229583-18229605 AGCAAGGCTCACAGAGGTGCAGG - Intronic
1144859563 17:18292352-18292374 CACAAGGCTCACAGTGGAGGTGG + Intronic
1145769981 17:27486005-27486027 TGCCTGGCTCACAGTGGGGTAGG + Intronic
1148227766 17:45910844-45910866 TGCCAGGTTCTCCTAGGAGGCGG + Intronic
1148716156 17:49717627-49717649 TGCCAGGCTCCAGGAGGAGGAGG + Exonic
1148782339 17:50129349-50129371 TGCCGGGCTGTCAGGGGAGGGGG - Intronic
1149284949 17:55152214-55152236 TGTCAGGCTCACAGAAAGGGGGG - Intronic
1149364327 17:55926350-55926372 TTTCAGGCACACAGTGGAGGTGG - Intergenic
1150645467 17:66975050-66975072 TGGCAAGCCCACAGAGGTGGAGG + Intronic
1151349979 17:73525965-73525987 TCCCAGGCTCACAGGGGAGATGG + Intronic
1151360514 17:73585810-73585832 TCCCAGGGTCACACAGGAAGTGG - Intronic
1152228104 17:79102004-79102026 TGGCAGCCTCAGGGAGGAGGGGG - Intronic
1152268611 17:79310616-79310638 CTGCAGGCTCACAGAGGAGAAGG + Intronic
1153013777 18:565196-565218 AGCCAGGCTGGCAGGGGAGGTGG + Intergenic
1153607275 18:6847033-6847055 TCCCTGGCTCCCACAGGAGGAGG + Intronic
1154192370 18:12241419-12241441 TGCCAGGGTCTGGGAGGAGGGGG - Intergenic
1156297270 18:35804018-35804040 AGCGAGGCTCAGGGAGGAGGTGG - Intergenic
1157619336 18:49007068-49007090 TGCCAGGCTGAGAGAGGAGTGGG - Intergenic
1159324724 18:66900187-66900209 TGCCAGGCTAAAAGAGTAGGAGG - Intergenic
1159926708 18:74276073-74276095 TGCCAGGCTCACAGAGGAGGTGG - Intronic
1160026016 18:75216929-75216951 CGCCAGACTCACCGAGGAGGAGG + Intronic
1160693091 19:469117-469139 TGCCAGTCTAACAAAGGATGAGG - Intronic
1160899916 19:1422465-1422487 CGCCAGGCACACACAGGTGGCGG + Intronic
1161006506 19:1939960-1939982 TGTGAGGCTGACGGAGGAGGAGG - Intergenic
1161216339 19:3096711-3096733 TTTCAGGCTCACAGAGTGGGAGG - Intronic
1161257973 19:3320344-3320366 CGCCGGGCACACAGAGGGGGAGG - Intergenic
1161523541 19:4739088-4739110 GGTGGGGCTCACAGAGGAGGGGG - Intergenic
1161582953 19:5090744-5090766 TGCCAAGGTCACACAGCAGGAGG + Intronic
1161865418 19:6829155-6829177 TGCCAGGCTCCTAGATGAGCAGG + Intronic
1161972568 19:7590770-7590792 CGCCAAGCTCACAGAGGGGCAGG + Intergenic
1162081285 19:8219322-8219344 TGCCTGGGTCTCAGAGGAGCTGG - Intronic
1162367126 19:10256507-10256529 TGCCAGCCTCACAAAGGCAGGGG - Intronic
1162803388 19:13123371-13123393 TGCCAGGCTCTCCAAGGAGCTGG + Intronic
1163086071 19:14980174-14980196 AGCCAGGCTCAGAGAGGGAGAGG - Intronic
1163188550 19:15658587-15658609 TCCAAGGCTCCTAGAGGAGGGGG + Intronic
1163216239 19:15879550-15879572 TCCAAGGCTCCTAGAGGAGGGGG - Intronic
1163228068 19:15979106-15979128 TGCCGGGCACACAGTGGAGGAGG + Intergenic
1163612395 19:18308261-18308283 CGCCAGGCACACAGAGGGTGTGG - Intronic
1164618024 19:29678231-29678253 TTCCAGGCTGACAGCCGAGGGGG + Intergenic
1164869951 19:31634580-31634602 TGCCAGGCTCAGGAAGGATGTGG + Intergenic
1165055478 19:33173760-33173782 AACAGGGCTCACAGAGGAGGAGG - Intronic
1165930640 19:39356241-39356263 TGCCCAGCTCTCAGAGAAGGTGG + Intronic
1166945488 19:46393693-46393715 TGCCAGGCACACGGAGGTGGGGG + Intergenic
1167791970 19:51688872-51688894 TGACAGGAGCAGAGAGGAGGAGG + Intergenic
925990554 2:9250988-9251010 GGGCAGGCTCACCAAGGAGGTGG + Intronic
926934390 2:18072579-18072601 GGCCAGGAGCCCAGAGGAGGGGG - Intronic
927215259 2:20665003-20665025 TGCCAGCCACACACAGGATGAGG + Intergenic
927704551 2:25289075-25289097 GGCAAGGCTCACAGTCGAGGAGG - Intronic
927981675 2:27378491-27378513 TCCCAGTCCCACAGAGCAGGAGG - Exonic
929576811 2:43057276-43057298 TGCCAGGCTGACAGGGCTGGTGG + Intergenic
929961828 2:46502860-46502882 TGCCAGGGTCACACAGCAGCTGG + Intronic
930698928 2:54439801-54439823 TGCCAGGCCCAAAGAGTAGATGG + Intergenic
931431977 2:62215640-62215662 TGCCAGACTCCCGGAGGTGGTGG + Intronic
931785834 2:65618825-65618847 AGCCAGGCTCCCAGAGGACAGGG - Intergenic
934652005 2:96098173-96098195 GCCCAGGCCCAGAGAGGAGGAGG + Intergenic
934951101 2:98576336-98576358 TGAATGGCTCACAGAGTAGGGGG - Intronic
934952673 2:98589008-98589030 TGGCAGGAACACAGAGGGGGTGG + Exonic
935594180 2:104867025-104867047 AGCAGGGCGCACAGAGGAGGGGG - Intergenic
935606621 2:104977860-104977882 AGCCAGGCTAACAGAGCAGTTGG + Intergenic
935887244 2:107635558-107635580 TGCCAGAGTCACAGAGGGAGGGG + Intergenic
937400558 2:121579485-121579507 TGCCAGGGACTGAGAGGAGGAGG - Intronic
938507758 2:131904758-131904780 TGCCAGGCTTCCTGGGGAGGAGG - Intergenic
939201573 2:139042328-139042350 TTCCAGGTCCACTGAGGAGGTGG - Intergenic
940389955 2:153120814-153120836 TGCCAGGCTCACAGCTGGAGGGG + Intergenic
941361493 2:164557262-164557284 TGCCAGGCAGCCTGAGGAGGGGG + Intronic
943312594 2:186345188-186345210 TTCCAGGCTCACAGAACAGTTGG - Intergenic
945007277 2:205422280-205422302 AGCCAGAGTCACAGAGGAGGCGG + Intronic
946088042 2:217194436-217194458 TGCCTGCCTCACAGAGCAGAGGG + Intergenic
946391310 2:219418420-219418442 TGGCGGGCGCACGGAGGAGGCGG - Exonic
946409643 2:219509643-219509665 TGGGAGGCTCAGAGAGCAGGAGG + Intergenic
946428891 2:219614198-219614220 TGTCAGTGCCACAGAGGAGGAGG + Exonic
947577727 2:231289774-231289796 GGGTAAGCTCACAGAGGAGGAGG - Intronic
947756704 2:232571203-232571225 TGCCTGCCGCACAGAGCAGGCGG + Intronic
947838094 2:233189506-233189528 GGCCAGGGTCATAGAGGAGAAGG - Intronic
948532099 2:238615532-238615554 TGCTGGGCTTACAGAGGATGTGG + Intergenic
1168832353 20:853542-853564 TTCCAGGAACACAGAGAAGGTGG + Intronic
1168940978 20:1711448-1711470 TGCCTGACTCACAGTGTAGGCGG - Intergenic
1169090688 20:2859827-2859849 TCCCAGGGTCCCAGAGCAGGTGG - Intronic
1169803758 20:9538455-9538477 TTCCAGGCTCACAAAGGGAGAGG - Exonic
1170622256 20:18005895-18005917 TGTCAGGCTGACAGAACAGGGGG + Intronic
1171382343 20:24743172-24743194 TGCCAGGGTCCCAGTGGTGGAGG - Intergenic
1171485097 20:25480565-25480587 TGCCAGGGTCACGGAGGAAATGG + Intronic
1172645568 20:36467101-36467123 GGCCAGGCTCTGAGAGGATGGGG + Intronic
1173018782 20:39249771-39249793 TGCTAGAGCCACAGAGGAGGTGG - Intergenic
1173542345 20:43863537-43863559 TGCCATGCACAGAGAGGAGAAGG - Intergenic
1173571419 20:44079177-44079199 AGCCAGCCTGACAGGGGAGGAGG - Intergenic
1173662148 20:44742266-44742288 TGCCTGGCTCACAGAGGCTTTGG + Intergenic
1173823048 20:46030894-46030916 TCCCAGGGTCACTGGGGAGGTGG - Intronic
1174264378 20:49320613-49320635 AGCAAGGCTCAGAGAGGAGAGGG + Intergenic
1174356733 20:50003392-50003414 TGCCAGGAGCTGAGAGGAGGAGG - Intergenic
1175659454 20:60799745-60799767 TGCCAGGGTTTGAGAGGAGGTGG + Intergenic
1176035457 20:63034119-63034141 AGCCTGGCTCACACAGGAGATGG + Intergenic
1176230067 20:64028031-64028053 AGCCAGCTCCACAGAGGAGGTGG + Intronic
1176785726 21:13253805-13253827 TGCCAGGCTTCCTGGGGAGGAGG + Intergenic
1176973270 21:15290113-15290135 TGCCTGTCCCACAGAGGAAGTGG - Intergenic
1179350332 21:40604891-40604913 TGCCTGCCTCACATAGGAGGAGG - Intronic
1180127542 21:45802583-45802605 GGACAGGCTGACGGAGGAGGAGG + Intronic
1180172624 21:46067700-46067722 GGCCAGGCCCACTGAGGTGGAGG + Intergenic
1180253129 21:46602796-46602818 TGCAAGGCTCCAAGATGAGGTGG + Intronic
1180703384 22:17794066-17794088 TGGCAGCATCACAGAGGGGGCGG + Intronic
1180751578 22:18128303-18128325 TGCCAGGCTCAGAGAGTCAGTGG + Intronic
1181802941 22:25359018-25359040 GGCCAGGGTCACACAGCAGGAGG - Intronic
1182437768 22:30341590-30341612 TTCAAGGCTCACAGGGGAGCTGG + Intronic
1182508606 22:30803018-30803040 TCCCAGGCTCGGAGAGGCGGTGG + Intronic
1183102464 22:35592427-35592449 GGCCAGGGTCACAGAGCAGTTGG - Intergenic
1183195229 22:36349086-36349108 AGCCAGCCTCAAGGAGGAGGTGG - Exonic
1183272580 22:36871408-36871430 AGCCAGGCTCAGAAAGCAGGTGG - Intronic
1183287681 22:36977620-36977642 AGCCAGGCTGACAGAGGTGCTGG + Intergenic
1183717599 22:39542863-39542885 CGCCAGGCTCACACAGGCAGTGG + Intergenic
1184252355 22:43268017-43268039 TTCCAAGCTCACAGCAGAGGGGG - Intronic
1184254820 22:43280857-43280879 TGACAGGGTGACTGAGGAGGAGG - Intronic
1184254850 22:43280978-43281000 TGACAGGGTGACTGAGGAGGAGG - Intronic
1184254879 22:43281096-43281118 TGACAGGGTGACTGAGGAGGAGG - Intronic
1184254908 22:43281214-43281236 TGACAGGGTGACTGAGGAGGAGG - Intronic
1184254938 22:43281335-43281357 TGACAGGGTGACTGAGGAGGAGG - Intronic
1184261480 22:43319673-43319695 TGCAAGCCTGACAGAGGAGCGGG + Intronic
949706507 3:6824212-6824234 TGCCAGGCTCAGGCAGGAAGAGG - Intronic
950040035 3:9914510-9914532 TGCCTGGCTCATAGGGGTGGGGG + Intronic
950074446 3:10177411-10177433 TGCCTGGTTCAGAGTGGAGGTGG - Intronic
950083266 3:10238890-10238912 TGCCACACTCATGGAGGAGGAGG - Exonic
950097463 3:10338289-10338311 AGGCAGGCTCACACAGAAGGAGG - Exonic
950867044 3:16197437-16197459 TGGCAAGCACACAGAGGAGAGGG - Intronic
952845338 3:37683342-37683364 TGCCAGACTTACAAGGGAGGTGG - Intronic
953005787 3:38978118-38978140 TGCCAAGATCACAGAGCTGGTGG + Intergenic
953154575 3:40357558-40357580 TGACAGGTTCACAAAGGAGTTGG - Intergenic
953961167 3:47266985-47267007 TGGCAGGCTCAGAGAGGCTGGGG - Exonic
954279023 3:49562710-49562732 TCCCATCTTCACAGAGGAGGAGG - Intronic
954317620 3:49809869-49809891 TGCCGGGCCCACTGTGGAGGAGG + Exonic
955929404 3:64041148-64041170 TCCCAAGCTTTCAGAGGAGGTGG - Intergenic
959455583 3:106556952-106556974 TGACTGGCTCAATGAGGAGGTGG - Intergenic
961329308 3:126129366-126129388 TGCAAGGGGCACAGAGCAGGTGG + Intronic
961673956 3:128553779-128553801 GAACAGGCTCACAGAGGAGCTGG + Intergenic
961745244 3:129060407-129060429 TGCCTGCCTCACAGAGGTGTGGG - Intergenic
962455110 3:135557935-135557957 TGGCAGGCTCATAGAAGAGAGGG + Intergenic
962971428 3:140405171-140405193 AGACATGCTAACAGAGGAGGTGG + Intronic
964396073 3:156247507-156247529 GGCCAGATTCCCAGAGGAGGCGG - Intronic
967312677 3:188121054-188121076 GGCCAGGCTCACAGAGAAGGTGG + Intergenic
967865557 3:194187167-194187189 TTTCAGGCTCACACAGGCGGTGG - Intergenic
968532208 4:1098440-1098462 TCCCAGGCTCCCAGAGGCAGAGG + Intronic
968717904 4:2175541-2175563 TTCCATGCTCTCAGGGGAGGTGG - Intronic
968780675 4:2578857-2578879 GGCTAGGCTGAGAGAGGAGGAGG + Intronic
968866481 4:3215952-3215974 TGCCTGTCCCACAGAGGTGGGGG + Intronic
968935255 4:3606958-3606980 GGCCAGGCTCAGGGAGGAGGAGG + Intergenic
969495009 4:7521494-7521516 TCCCAGGATCAGAGAGGAAGAGG - Intronic
969587642 4:8103738-8103760 TGCCCAGGTGACAGAGGAGGGGG + Intronic
969609276 4:8217998-8218020 TTCCAGGCCCACAGGGGTGGCGG + Intronic
970176557 4:13345592-13345614 TTGCAGGCCCACAGAGGTGGAGG + Intergenic
972040459 4:34589290-34589312 TGGCAGTGTCACAGAGGAGAGGG - Intergenic
972601505 4:40576922-40576944 TCCCAGGGTCACAGAGCTGGTGG + Intronic
973134948 4:46695701-46695723 TGCCAGGGCCACACAGCAGGAGG - Intergenic
975586780 4:75957906-75957928 TACCAGTCTCAGTGAGGAGGAGG - Exonic
975721796 4:77255435-77255457 TGCTAGGAACACAGAAGAGGTGG - Intronic
978148758 4:105409443-105409465 TGCCCTGCCCACAGAGGTGGAGG - Intronic
978544032 4:109851302-109851324 TTCCATGGCCACAGAGGAGGTGG + Intronic
979531931 4:121777741-121777763 TGCCAGGATGACAGAGTAGGTGG + Intergenic
979838042 4:125398406-125398428 TGCCTGACAAACAGAGGAGGTGG - Intronic
980296805 4:130929771-130929793 TGCCAGGGCCTGAGAGGAGGGGG - Intergenic
981197987 4:141942891-141942913 TCCTAGGCACAGAGAGGAGGGGG - Intergenic
982057887 4:151571207-151571229 AGCCAGGAGAACAGAGGAGGTGG + Intronic
982273269 4:153614044-153614066 TGGAAAGCTCCCAGAGGAGGTGG + Intronic
983928982 4:173432652-173432674 TGCCTGCCTCAGACAGGAGGAGG - Intergenic
984560444 4:181262446-181262468 GACCAGGCTCACGGAGGAGATGG + Intergenic
985573619 5:663678-663700 GGCCAGGCTCACAGTACAGGAGG - Exonic
985657214 5:1138530-1138552 AGAGAGGCACACAGAGGAGGAGG - Intergenic
985680226 5:1252258-1252280 TGCCAGGCTCGCAGTGGAGCTGG - Intergenic
987940889 5:24534852-24534874 TGCCAGGCTCACATATGAAGAGG + Intronic
989020118 5:36995132-36995154 TGCCAAGATCATAGAGAAGGAGG + Intronic
989182332 5:38590902-38590924 TGCCAGGTTCTATGAGGAGGTGG + Intronic
991513336 5:67405017-67405039 GGCCAGGCAGACAGAGGAAGTGG - Intergenic
992827158 5:80561738-80561760 TGGCAGGCAGACAAAGGAGGAGG + Intronic
992833063 5:80614402-80614424 AGCAAGGCTCTCTGAGGAGGAGG - Intergenic
994018524 5:94996973-94996995 TCCCTGGCTAACAGAGGAGATGG + Intronic
994018618 5:94998287-94998309 TCCCTGGCTAACAGAGGAGATGG + Intronic
995795801 5:115940333-115940355 TTCCAGGCTCACAGAATCGGTGG + Intergenic
997564443 5:134876151-134876173 TGCTAGCCTCACAGAGGGGATGG + Intronic
997579564 5:135008742-135008764 TCCCAGGCCCACTGAGGAGAAGG - Intronic
998421951 5:141995535-141995557 TTCCTGTCTCACATAGGAGGAGG + Intronic
998903284 5:146878137-146878159 AGCCAGTCTCACAGGAGAGGGGG + Exonic
1001100050 5:168806807-168806829 TGACAGGATAACAGAGCAGGCGG - Intronic
1001826734 5:174751386-174751408 TCCCAGGCGCACGGAGGCGGCGG + Intergenic
1001951484 5:175819786-175819808 GGCCAGGCTCAGAGAGGTGAAGG + Intronic
1001970756 5:175953295-175953317 TATTAGGGTCACAGAGGAGGAGG - Intronic
1002187773 5:177462526-177462548 TGCGTTGCTCACAGCGGAGGGGG - Intronic
1002246682 5:177890470-177890492 TATTAGGGTCACAGAGGAGGAGG + Intergenic
1002527857 5:179824911-179824933 CACCAGGGTCACAGATGAGGGGG + Intronic
1002599338 5:180345418-180345440 TCCCAAGCCCACAGGGGAGGTGG + Intronic
1003253856 6:4457402-4457424 TGCCAGAGCCACAGAGGATGAGG + Intergenic
1003300268 6:4874392-4874414 TGCCAGGCACACAGTGGGGAAGG - Intronic
1004073594 6:12325016-12325038 TGGGAGACTCACAGATGAGGAGG + Intergenic
1006909972 6:37557453-37557475 AGCCAGGGTCAGAGAGGATGTGG - Intergenic
1007711209 6:43825565-43825587 AGCCAGGCCCAGAGAGGAAGTGG - Intergenic
1008485480 6:52030576-52030598 TGACAGATTCACAGAGGAGGAGG + Intronic
1010529429 6:76948924-76948946 TGGAGGGCTCACAGGGGAGGTGG + Intergenic
1011027134 6:82881391-82881413 AGAGAGACTCACAGAGGAGGAGG + Intergenic
1011662867 6:89609215-89609237 TGCCTGGCTCACAGCTCAGGAGG + Intronic
1016793746 6:148095245-148095267 AGCAGGGCTCATAGAGGAGGGGG + Intergenic
1017067527 6:150543138-150543160 TGCCAGGCTCACCTAGTAAGTGG - Intergenic
1017168310 6:151431167-151431189 ACACAGGCTCAGAGAGGAGGTGG + Intronic
1017795659 6:157841939-157841961 GGCCAGGATCACTGTGGAGGTGG - Intronic
1018826115 6:167408964-167408986 TTCAAGGCTCACTGAGGCGGCGG - Intergenic
1019401359 7:855896-855918 GGGCAGGCAGACAGAGGAGGAGG - Intronic
1019551842 7:1606934-1606956 TGCCCGGCACGAAGAGGAGGAGG - Intergenic
1019810106 7:3158916-3158938 AGCCAGGATCACAGAGGGGAAGG + Intronic
1021478638 7:21091333-21091355 TGCCAGGCACTCAGAAAAGGGGG + Intergenic
1021908731 7:25362937-25362959 TGTGAAGATCACAGAGGAGGAGG + Intergenic
1023615738 7:42017507-42017529 TCCCAGGCTGAAAGGGGAGGGGG + Intronic
1024140165 7:46455053-46455075 TGCCATGTGCACAGAGAAGGAGG - Intergenic
1024346761 7:48321722-48321744 GGCCAGGCTGGCAGAGGAGATGG + Intronic
1024598006 7:50956096-50956118 AGCCAGTCTCAGAGAGAAGGTGG + Intergenic
1024711316 7:52018407-52018429 CGCCAGGCTGTGAGAGGAGGAGG - Intergenic
1024832140 7:53473395-53473417 TGCCAGAGGCACAGAAGAGGTGG + Intergenic
1024855103 7:53769862-53769884 AGCCAGGATCACAGACCAGGTGG - Intergenic
1024973176 7:55089235-55089257 TGACAGCCTCACAGAAGATGAGG - Intronic
1026140252 7:67699473-67699495 TGGCAGGCTCAGGGAGGAGGGGG + Intergenic
1026198387 7:68192929-68192951 TGCCAGGGGTAGAGAGGAGGAGG - Intergenic
1026520551 7:71114030-71114052 TGCCAGTTACACAGAGGAGTGGG + Intergenic
1026654138 7:72242041-72242063 TGCCAGGGGCTCAGAAGAGGAGG - Intronic
1026802795 7:73410719-73410741 TGCCAGGAGCCCAGAGGTGGGGG + Intergenic
1026852753 7:73735379-73735401 TCGCAGGGTGACAGAGGAGGAGG - Intergenic
1027220570 7:76211296-76211318 TGGCAGGAGCAGAGAGGAGGAGG + Intronic
1027305223 7:76887756-76887778 TGCCAGGGTTAAGGAGGAGGTGG - Intergenic
1029281632 7:99439234-99439256 TCCCGGGATCACAGAGGAGCGGG - Intronic
1029728713 7:102425550-102425572 TCCCAGGCTCAGTGAGGAGATGG + Exonic
1030525702 7:110651877-110651899 TGGCAGGCTTAAAAAGGAGGAGG + Intergenic
1030727079 7:112939261-112939283 ATACACGCTCACAGAGGAGGTGG - Intronic
1032121388 7:129159723-129159745 TGCCAGGCTCACGGAGCATGGGG - Intronic
1032843742 7:135735460-135735482 TGCCAGGCTCACAGTAGGGATGG + Intronic
1033294985 7:140124206-140124228 TGCCAGGGGCTCAGTGGAGGCGG + Intronic
1033454625 7:141491685-141491707 TGCCAAGGTCACATAGGAAGCGG + Intergenic
1033530996 7:142264092-142264114 TGGGAGGCTGACAGGGGAGGAGG - Intergenic
1034479372 7:151307914-151307936 TGCCAGCCTCTGAGGGGAGGTGG - Intergenic
1034557421 7:151858943-151858965 TGCCAGCCTTGCAGAGGAGCAGG - Intronic
1035118726 7:156547166-156547188 AACCAGGCTCACAGACGAGCAGG + Intergenic
1035203001 7:157278838-157278860 GGGCAGGCTCACAGGCGAGGGGG - Intergenic
1036383700 8:8259488-8259510 TGCCAGGCACACAGATGCTGAGG - Intergenic
1036791125 8:11720999-11721021 CGCCAGGCTCACAGGGAATGGGG - Intronic
1037094805 8:14972981-14973003 TACCAGGCACACAAAGAAGGAGG - Intronic
1037761951 8:21747371-21747393 GGCCAGCCTTAGAGAGGAGGAGG - Intronic
1038054495 8:23845615-23845637 TGCATGGCACACAGAAGAGGGGG - Intronic
1038144720 8:24884633-24884655 GGCCAGGCTCACAGTGTACGTGG + Intergenic
1038303699 8:26379930-26379952 TACCAGTCTCAGTGAGGAGGAGG - Intergenic
1038700787 8:29847578-29847600 TCCCAGGGCCAGAGAGGAGGTGG - Intergenic
1039903713 8:41771005-41771027 TGCCAGTCACATAGAGGAGTAGG - Intronic
1039907871 8:41799301-41799323 GGCCAGGCTCACTCATGAGGGGG + Intronic
1040452210 8:47559466-47559488 TGACCAGCTCACAGGGGAGGGGG - Intronic
1042207681 8:66345453-66345475 TGCCAGCCACACGGAGGAAGGGG + Intergenic
1042971592 8:74415508-74415530 TGCCTGGCTCACAATGTAGGTGG - Intronic
1044684143 8:94811104-94811126 TGCCAGGCTCACTGTGGGGAAGG - Intergenic
1045221174 8:100201858-100201880 TGCAAGGGTTACAGAGGAAGAGG - Intronic
1045481076 8:102592550-102592572 TGCCAGGCACTGAGATGAGGCGG - Intergenic
1046345085 8:112913416-112913438 AACCAGGCTCACACAGCAGGAGG - Intronic
1047823786 8:128551031-128551053 TCCCATGGTCACAGAGCAGGTGG - Intergenic
1048882588 8:138883078-138883100 TGCCAGGCTCAGCGGGCAGGTGG - Exonic
1049003148 8:139838691-139838713 TGCCAGCCTCTGGGAGGAGGAGG + Intronic
1049045462 8:140147904-140147926 TGCCAGGCACACGGAGGTGCTGG + Intronic
1049317571 8:141977432-141977454 GGCCAGGCTCACTGAGGACCTGG + Intergenic
1049444490 8:142623760-142623782 TGCTGAGATCACAGAGGAGGGGG + Intergenic
1049974368 9:847293-847315 TGCCTGCATCACAAAGGAGGGGG + Intronic
1050347642 9:4708589-4708611 TGCCAGTCTGAAAGAAGAGGAGG - Intergenic
1051482853 9:17578735-17578757 CGCCAGGCTCAAAGGGCAGGAGG + Intergenic
1052018491 9:23498142-23498164 AGCCAGGGTCACACAGGGGGTGG + Intergenic
1053077008 9:35141751-35141773 AGTCATGCTAACAGAGGAGGGGG - Intergenic
1053265981 9:36713976-36713998 TGTCAGGCTCACAATGAAGGGGG - Intergenic
1054454929 9:65424944-65424966 GGCCAGGCTCAGGGAGGAGGAGG - Intergenic
1054771285 9:69086513-69086535 TCCCAGGTTCACATAGGAAGAGG - Intronic
1055108932 9:72540519-72540541 TGCCAGGTTTGGAGAGGAGGTGG - Intronic
1056675887 9:88677089-88677111 TGCCAGGTTCCCAGAAGTGGTGG + Intergenic
1057171173 9:92964094-92964116 TGCTAGGCTCACAGCTGCGGCGG - Intronic
1057182232 9:93036411-93036433 GGCCAGGCTCAGAGATGGGGAGG + Intergenic
1057196925 9:93120680-93120702 TTCCAGGGGCACAGGGGAGGGGG - Intergenic
1057255674 9:93545204-93545226 AGCCAGGCTCTCAGAGTCGGAGG + Intronic
1058865485 9:109158496-109158518 TGCCAGGGGCTGAGAGGAGGGGG - Intronic
1059429085 9:114239459-114239481 GCCCAGGGTCACACAGGAGGAGG + Intronic
1059743749 9:117180507-117180529 TTCCAGGATCACAGAGGAAATGG - Intronic
1059751904 9:117255556-117255578 CGAAAGGCTCAGAGAGGAGGTGG + Intronic
1060002339 9:119969801-119969823 GGCCAGGCTCACAGTGGTGCAGG + Intergenic
1060188842 9:121579612-121579634 GGTCAGGTGCACAGAGGAGGAGG - Intronic
1060942042 9:127548320-127548342 TGCCAGTGTCACAGAGCAGGGGG - Intronic
1061023863 9:128034911-128034933 TGTCATGATCTCAGAGGAGGTGG + Intergenic
1061844516 9:133379573-133379595 AGCCAGGCCCAGAGAGGATGGGG + Intronic
1062187640 9:135227182-135227204 TCCCAGGCCCAGGGAGGAGGAGG - Intergenic
1062252734 9:135606424-135606446 GGCCAGGGTCCCAGTGGAGGAGG - Intergenic
1062253837 9:135611639-135611661 TGCAGGGCTCGCAGAGCAGGTGG + Intergenic
1186213433 X:7273951-7273973 GAACAGGCTCTCAGAGGAGGTGG + Intronic
1187370652 X:18702940-18702962 TCTCAGGCTCAAAGAGGTGGGGG - Intronic
1187899551 X:24014747-24014769 GGCCAGGATCACAGAGTGGGAGG - Intronic
1189265135 X:39709480-39709502 TGGCAGGGGAACAGAGGAGGGGG + Intergenic
1189469290 X:41301542-41301564 TGCCAGGCTCAGAGAGAACCTGG - Intergenic
1189713046 X:43834662-43834684 AAACAGCCTCACAGAGGAGGAGG - Intronic
1190095646 X:47478075-47478097 TGCCAGGGGCTGAGAGGAGGGGG + Intronic
1191023772 X:55891309-55891331 ACACAGGCACACAGAGGAGGAGG - Intergenic
1191671412 X:63751918-63751940 TGTCAGGCTCACAGAGGAGAAGG + Intronic
1191718130 X:64206594-64206616 AGCCAGGCTCACAAAGGATGGGG - Intergenic
1192166556 X:68830533-68830555 TCCCAGGCTCACAAAGGCAGCGG + Intronic
1195162270 X:102182346-102182368 TTTCAGGATCCCAGAGGAGGAGG - Intergenic
1195305093 X:103574183-103574205 GGCCAGGATCAAAGAGGAGATGG - Intergenic
1195741224 X:108066680-108066702 TGCCTATCTTACAGAGGAGGAGG - Intronic
1199879303 X:151960492-151960514 TGGCTAGCTCACAGAGGATGAGG + Intronic
1200593913 Y:5114310-5114332 TGCCATGATCAGGGAGGAGGGGG - Intronic
1201431767 Y:13909806-13909828 TGCCCTGCTCCCAGAGGTGGAGG - Intergenic