ID: 1159928669

View in Genome Browser
Species Human (GRCh38)
Location 18:74291343-74291365
Sequence GCTCCCAGGTGTGCACGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159928666_1159928669 -9 Left 1159928666 18:74291329-74291351 CCGCCGCGCAGGGCGCTCCCAGG 0: 1
1: 0
2: 0
3: 22
4: 272
Right 1159928669 18:74291343-74291365 GCTCCCAGGTGTGCACGCGCAGG 0: 1
1: 1
2: 2
3: 22
4: 126
1159928658_1159928669 27 Left 1159928658 18:74291293-74291315 CCCGGAAGGCTGCTCCAGCACCA 0: 1
1: 0
2: 2
3: 30
4: 301
Right 1159928669 18:74291343-74291365 GCTCCCAGGTGTGCACGCGCAGG 0: 1
1: 1
2: 2
3: 22
4: 126
1159928657_1159928669 28 Left 1159928657 18:74291292-74291314 CCCCGGAAGGCTGCTCCAGCACC 0: 1
1: 0
2: 1
3: 18
4: 168
Right 1159928669 18:74291343-74291365 GCTCCCAGGTGTGCACGCGCAGG 0: 1
1: 1
2: 2
3: 22
4: 126
1159928662_1159928669 7 Left 1159928662 18:74291313-74291335 CCACCTAGCGAGGATGCCGCCGC 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1159928669 18:74291343-74291365 GCTCCCAGGTGTGCACGCGCAGG 0: 1
1: 1
2: 2
3: 22
4: 126
1159928661_1159928669 13 Left 1159928661 18:74291307-74291329 CCAGCACCACCTAGCGAGGATGC 0: 1
1: 0
2: 1
3: 7
4: 87
Right 1159928669 18:74291343-74291365 GCTCCCAGGTGTGCACGCGCAGG 0: 1
1: 1
2: 2
3: 22
4: 126
1159928659_1159928669 26 Left 1159928659 18:74291294-74291316 CCGGAAGGCTGCTCCAGCACCAC 0: 1
1: 0
2: 0
3: 23
4: 222
Right 1159928669 18:74291343-74291365 GCTCCCAGGTGTGCACGCGCAGG 0: 1
1: 1
2: 2
3: 22
4: 126
1159928663_1159928669 4 Left 1159928663 18:74291316-74291338 CCTAGCGAGGATGCCGCCGCGCA 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1159928669 18:74291343-74291365 GCTCCCAGGTGTGCACGCGCAGG 0: 1
1: 1
2: 2
3: 22
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159928669 Original CRISPR GCTCCCAGGTGTGCACGCGC AGG Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900478713 1:2888101-2888123 CATCCCACGTGTGCACGCACCGG + Intergenic
900678394 1:3902378-3902400 GCTCCCAGGTGCTCGGGCGCAGG + Intergenic
900799649 1:4729305-4729327 GGCCCCAGGTCTGCACTCGCAGG - Intronic
913103870 1:115594565-115594587 ACAGCCAGGTGTGCAGGCGCAGG - Intergenic
913518212 1:119622956-119622978 TCTCGCCGGTGTGCACGCGCAGG + Exonic
913518235 1:119623124-119623146 TCTCGCCCGTGTGCACGCGCTGG + Exonic
913518303 1:119623484-119623506 GCTCGCCCGTGTGCAGGCGCAGG + Exonic
915107932 1:153545960-153545982 GTTCCCAGGTGGGCACCCGTGGG + Intronic
918177159 1:182056759-182056781 GCTCGCCCGAGTGCACGCGCTGG + Exonic
1062806107 10:420562-420584 GCTCCGAGGTGTGAAAACGCTGG + Intronic
1066191343 10:33058774-33058796 GCTCTCAGATGTGCAGGCTCAGG - Intergenic
1066354613 10:34670293-34670315 GCGAGCCGGTGTGCACGCGCTGG - Intronic
1066460464 10:35608303-35608325 GCGCCCCCGGGTGCACGCGCCGG + Exonic
1067146176 10:43695455-43695477 GCTCCCAGGGGTGCAGGTCCGGG + Intergenic
1072951195 10:99848016-99848038 GCTCCCAGCTGTGCACAATCAGG + Intronic
1075163242 10:120042647-120042669 GCTTCCAGGTGTGCTCTCCCAGG - Intergenic
1076854246 10:133108142-133108164 ACTCCCAGGTGTGCTCGGGGAGG - Intronic
1077009406 11:373492-373514 GCTCCCAGGTGTCCAAGCCCAGG + Exonic
1077171366 11:1167707-1167729 GCCCCCAGGTGTGGACACCCAGG - Intronic
1082597833 11:55107411-55107433 GCTCCCAGATGTTCATTCGCAGG - Intergenic
1083766677 11:64844723-64844745 GCGCCCAGGTGAGGGCGCGCTGG - Intergenic
1088580626 11:111312302-111312324 GCTCCCAAGTGTTCACCTGCTGG - Intergenic
1091281118 11:134382419-134382441 GCGCACATGTGTGCACGCGTAGG + Intronic
1092484072 12:8886652-8886674 GCTACCAGTTGTGCCCGCTCTGG + Intronic
1099202359 12:79690915-79690937 GCTCCCAGGTGTGCCGAAGCTGG + Exonic
1104903531 12:132201755-132201777 GCTCTCAGGTGTCCCCCCGCGGG - Intronic
1104927001 12:132318970-132318992 GCTGCCCGGTGTGCATGAGCAGG - Intronic
1109184384 13:59251844-59251866 GCACGCAGGTGAGCAGGCGCAGG + Intergenic
1112091731 13:96090588-96090610 GCTCCCGGGTGCGCCCGGGCCGG - Intergenic
1113610941 13:111644867-111644889 GCTCCCAAGTGTGCACCGGGAGG + Intronic
1113847545 13:113401311-113401333 GCTCCCAGGACTGCAGGGGCAGG + Intergenic
1119748557 14:77061792-77061814 GCCCCGAGGTGGGCAGGCGCAGG + Intergenic
1122880947 14:104690179-104690201 GCTTCCAGCTGCCCACGCGCAGG + Intronic
1202852820 14_GL000225v1_random:31570-31592 GCTCCCTACTGCGCACGCGCGGG + Intergenic
1123450605 15:20357225-20357247 GCCCCCAGGAGAGCACACGCAGG - Intergenic
1127961913 15:63896330-63896352 TCTCCCAGGTGTGCTCCAGCGGG + Intergenic
1132323163 15:100942150-100942172 TCTCCAAGGTGTGCACTTGCAGG + Intronic
1132573304 16:653400-653422 GCTCCCCCGTGTCCACGAGCAGG - Exonic
1136462098 16:30417908-30417930 TCTCGCCCGTGTGCACGCGCAGG - Exonic
1136462124 16:30418076-30418098 TCTCGCCCGTGTGCACGCGCCGG - Exonic
1136483216 16:30555568-30555590 TCTCGCCGCTGTGCACGCGCCGG + Exonic
1136483232 16:30555652-30555674 TCTCGCCGGTGTGGACGCGCAGG + Exonic
1136487575 16:30583186-30583208 GCTCCCCGGAGTGGACCCGCTGG + Exonic
1136490431 16:30604488-30604510 GCTCGCCCGAGTGCACGCGCCGG + Exonic
1136490477 16:30604740-30604762 GCTCCCCAGAGTGCACACGCCGG + Exonic
1138544479 16:57707495-57707517 GGACCCAGGAGTGCACCCGCAGG - Exonic
1138590445 16:57996648-57996670 GCTCGCGGGCGTGCACGCCCTGG + Exonic
1141836131 16:86540846-86540868 ACTCCCAGGTGTGCACTCCTCGG - Intronic
1142997697 17:3770704-3770726 GCTCCCAGGCTTGAACACGCTGG - Intronic
1144786792 17:17836608-17836630 GCTCCGTGCTGTGCTCGCGCGGG - Intronic
1144951614 17:18997416-18997438 GCTTCCAGGCTTGCAGGCGCAGG + Intronic
1152304731 17:79513877-79513899 GCTACCAGATGTGCAGGGGCAGG - Intronic
1152337834 17:79708109-79708131 GCCCCCAGGAGAGCACCCGCAGG + Intergenic
1152571537 17:81123318-81123340 GCTCCCAGATGGTCACGCCCAGG + Exonic
1152747551 17:82048418-82048440 CCTCCCAGGTGCGCAAGTGCTGG + Exonic
1156151594 18:34249931-34249953 GCTCCCAAGAGTGCACCCACAGG + Intergenic
1157729359 18:49990371-49990393 GCCCCCAGCTGTGCACCCGCTGG + Intronic
1159928669 18:74291343-74291365 GCTCCCAGGTGTGCACGCGCAGG + Intronic
1159928677 18:74291384-74291406 GCTCCCAGGTGTACACGCGCAGG + Intronic
1159928684 18:74291426-74291448 CTCCCCAGGTGTGCACGCGCAGG + Intronic
1159928691 18:74291467-74291489 GCGCCCAGGTGTACACTAGCAGG + Intronic
1159928699 18:74291508-74291530 GCTCCCAGGTGTGAGCGCGCAGG + Intronic
1159928713 18:74291555-74291577 GCGCCCAGGCTTGCACGCGCAGG + Intronic
1159928719 18:74291595-74291617 GCGCCCAGGCGTACACGCGCAGG + Intronic
1160950910 19:1666950-1666972 GATCCCAGGTGGGAACGCCCTGG + Intergenic
1161354373 19:3810764-3810786 CCCCCCAGGTGGGCACACGCCGG + Exonic
1165621547 19:37252406-37252428 GCCCACAGGTGTGGAGGCGCAGG - Intergenic
1165788783 19:38478298-38478320 GCTCTCAGGTCTGCAGGCGGTGG + Intronic
1165914012 19:39247168-39247190 GCTCCCACGTGAGCAGGCGCAGG + Intergenic
1165916849 19:39265760-39265782 GCTCCCACGTGAGCAGGCGCAGG - Intergenic
1166283571 19:41810389-41810411 GGTCCCAGCTGTGCAGGCTCTGG + Intronic
1166331601 19:42080958-42080980 GCTCACCTGTGTGCAGGCGCCGG - Exonic
1166733589 19:45071795-45071817 GCTCCCCGGTGTGTGAGCGCCGG + Exonic
1168315119 19:55481691-55481713 GCTCGCCGGTGTGCACGTGGCGG - Exonic
1168315134 19:55481775-55481797 GCTCGCCCGTGTGCACGCGCTGG - Exonic
1168315442 19:55482945-55482967 GCTCGCCCGTGTGCACGCGCTGG - Exonic
1168335901 19:55597637-55597659 GCTCCCCGGTGTGCGAGCGCAGG + Exonic
1168337023 19:55602676-55602698 GCTCCCCCGAGTGCACGCGGTGG - Exonic
1168401663 19:56088898-56088920 GCTCGCCGGTGTGCGTGCGCTGG + Exonic
1168468415 19:56622067-56622089 TCTCCCCGGTGTGCGTGCGCTGG - Exonic
1168468430 19:56622151-56622173 TCTCCCCGGTGTGCGTGCGCTGG - Exonic
1168468478 19:56622487-56622509 TCTCCCCGGTGTGCACGATCTGG - Exonic
1168474151 19:56664037-56664059 GCTCACCGGTGTGCACGAGGCGG + Exonic
1168474167 19:56664121-56664143 GCTCTCCGGTGTGCGTGCGCTGG + Exonic
1168474193 19:56664289-56664311 TCTCGCCCGTGTGCACGCGCCGG + Exonic
1168474237 19:56664541-56664563 GCTCGCCCGTGTGCACGCGCCGG + Exonic
1168681622 19:58319997-58320019 GCTCGCCTGTGTGCACCCGCTGG - Intergenic
1168684358 19:58338960-58338982 GCTCCCCCGTGTGCACCCGCTGG - Exonic
1168684370 19:58339044-58339066 TCTCCCCGGTGTGGATGCGCTGG - Exonic
1168687285 19:58356570-58356592 TCTCGCCCGTGTGCACGCGCCGG + Exonic
1168687347 19:58356906-58356928 GCGCGCCCGTGTGCACGCGCCGG + Exonic
1168689432 19:58368000-58368022 GCTCGCCGGTGTGCGCGCGCTGG + Exonic
1168689462 19:58368168-58368190 TCTCGCCGGTGTGCACGCGCCGG + Exonic
1168703701 19:58456189-58456211 TCTCGCCTGTGTGCACGCGCTGG - Exonic
1168706209 19:58471737-58471759 TCTCGCCTGTGTGCACGCGCTGG - Exonic
1168722627 19:58562578-58562600 GCTCCCCGGTGTGGATGCGCCGG + Exonic
1168722643 19:58562662-58562684 GCTCGCCACTGTGCACGCGCCGG + Exonic
928494040 2:31813520-31813542 GCACACAGGTGAGCAGGCGCAGG + Intergenic
939205042 2:139090832-139090854 GCTCACAGGTGTGAATGGGCTGG - Intergenic
948543038 2:238703504-238703526 TCTCCCAGGTGTGCAGGAACAGG + Intergenic
948545841 2:238728066-238728088 GCTCCCAGATGTGCACCCCTGGG - Intergenic
948650514 2:239440618-239440640 GCTCCCAGGCGAGCCCGAGCTGG - Intergenic
949057503 2:241936573-241936595 GCGCCCTCGTGTGCACGGGCAGG + Intergenic
1169137220 20:3204433-3204455 CCGCCCAGGTGCGCACGCGCAGG + Intronic
1170629947 20:18057520-18057542 CATCCCAGGTGAGCGCGCGCGGG - Exonic
1173139606 20:40470696-40470718 ACTCCCAGGGGGGCAGGCGCTGG - Intergenic
1175643492 20:60651251-60651273 GCTTCCAGGTGTCCAAGCTCAGG - Intergenic
1176214245 20:63940768-63940790 GCGCCCAGGTGTGCCCAGGCAGG + Intronic
1180051392 21:45333075-45333097 TGTCTCAGGTGTGCATGCGCTGG - Intergenic
1180969317 22:19806871-19806893 GCTCCCAGGTGCCCACGGGGAGG - Intronic
1181079765 22:20406083-20406105 TCTCGCCGGTGTGCACCCGCAGG - Exonic
1185228567 22:49667721-49667743 GCCCCCAGCTCAGCACGCGCAGG + Intergenic
1185228656 22:49667966-49667988 GCCCCCAGCTCAGCACGCGCAGG + Intergenic
1185228690 22:49668064-49668086 GCCCCCAGCTCAGCACGCGCAGG + Intergenic
950096961 3:10336061-10336083 GCTCCCAGGCGGGCAGGGGCTGG - Intronic
950476466 3:13218210-13218232 GCTCCCAGGTGTGCGAGGCCTGG + Intergenic
950659704 3:14459560-14459582 GCTCACTGGTGGGCACGGGCAGG - Intronic
957054137 3:75431414-75431436 GCTCTGAGGTGGGCACGGGCTGG + Intergenic
968178220 3:196569160-196569182 GCGCCCTGGTGTGCAAGCACTGG + Exonic
968566298 4:1315428-1315450 GCGCCAAGCTGTGCAAGCGCCGG + Exonic
968739147 4:2318653-2318675 GGACCCAGGTGTGCACCCACAGG - Intronic
970021521 4:11574594-11574616 GCTCCCTGCTGTGCCCTCGCAGG + Intergenic
985716482 5:1466089-1466111 GCTCCCAGGGCTGCAGGCCCTGG - Intronic
993068910 5:83134003-83134025 GGTTCCAGGTGAGCACGGGCTGG + Intronic
1017631048 6:156396957-156396979 CCTCCCACGCGTGGACGCGCAGG - Intergenic
1019109956 6:169701932-169701954 GCTCCCAGGAGGGCACGCAGAGG + Intronic
1020275583 7:6622668-6622690 GCTCCCCGGTGTGCGTGCGCTGG - Exonic
1020281599 7:6652937-6652959 GCTCGCCGGTGTGCGTGCGCTGG - Exonic
1021747478 7:23757218-23757240 GCCCACAGGTGTGCAGGGGCTGG - Intronic
1026670762 7:72388802-72388824 GGTCGCAGGTGTGCACTGGCTGG + Intronic
1027926776 7:84475100-84475122 GGTCCCAGGAGTGCAGGGGCTGG + Intronic
1029294160 7:99526216-99526238 TCTCCCCTGTGTGGACGCGCTGG - Exonic
1034186260 7:149179543-149179565 GCTCCCCGGTGTGGATGCGCTGG - Exonic
1034200860 7:149282154-149282176 GCTCACCGGTGTGGATGCGCTGG - Exonic
1034219318 7:149431862-149431884 GCTCGCCCGTGTGCGCGCGCTGG + Exonic
1034262395 7:149765133-149765155 GTTCGCCCGTGTGCACGCGCGGG + Exonic
1034343455 7:150372003-150372025 GCTCGCCCGTGTGCACGCGGCGG - Exonic
1034343572 7:150372420-150372442 GCTCCCCGGTGTGCTGCCGCTGG - Exonic
1034347622 7:150397108-150397130 GGTCCCGGGCGTGCGCGCGCTGG - Exonic
1034349696 7:150407869-150407891 GCTCCCCGGTGTGCGTGCGCTGG - Intronic
1035217850 7:157383142-157383164 GATCACAGGTGTGCACCAGCAGG + Intronic
1035340522 7:158157774-158157796 TCTCCCAGGGGAGCAGGCGCAGG - Intronic
1035397556 7:158545073-158545095 GCTCCCAGGTGTGTCCGAGCAGG - Intronic
1049353091 8:142174633-142174655 GCAGCCAGGTGTGCAAGCCCGGG - Intergenic
1049555291 8:143278579-143278601 GCCCCCAGGTGTGCCCGTGGTGG - Intergenic
1049558592 8:143296272-143296294 TCTCGCCCGTGTGCACGCGCTGG - Exonic
1049558648 8:143296524-143296546 GCTCCCCCGTGTGCACGCGCTGG - Exonic
1049636952 8:143694248-143694270 GCTCCCCGGTGTGCACCAGCTGG - Exonic
1049847000 8:144807669-144807691 GCTCGCGGGTGTGGACGCGGTGG - Exonic
1062418000 9:136463169-136463191 GCTCTCAGGTGAGGACGCGTTGG + Intronic
1200049501 X:153421391-153421413 TCTCACCGCTGTGCACGCGCCGG - Exonic