ID: 1159929986

View in Genome Browser
Species Human (GRCh38)
Location 18:74300837-74300859
Sequence TAGCCTTCTCCCAGTTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159929985_1159929986 11 Left 1159929985 18:74300803-74300825 CCATATCAGGACTACAAACAACA No data
Right 1159929986 18:74300837-74300859 TAGCCTTCTCCCAGTTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159929986 Original CRISPR TAGCCTTCTCCCAGTTTGTG AGG Intergenic
No off target data available for this crispr