ID: 1159931290

View in Genome Browser
Species Human (GRCh38)
Location 18:74315527-74315549
Sequence GAGCTCCGGCGCTGAAGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159931290_1159931298 22 Left 1159931290 18:74315527-74315549 CCGGGGCTTCAGCGCCGGAGCTC No data
Right 1159931298 18:74315572-74315594 CCCAGCTTTCCCGCCTTCGAGGG No data
1159931290_1159931296 21 Left 1159931290 18:74315527-74315549 CCGGGGCTTCAGCGCCGGAGCTC No data
Right 1159931296 18:74315571-74315593 ACCCAGCTTTCCCGCCTTCGAGG No data
1159931290_1159931300 25 Left 1159931290 18:74315527-74315549 CCGGGGCTTCAGCGCCGGAGCTC No data
Right 1159931300 18:74315575-74315597 AGCTTTCCCGCCTTCGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159931290 Original CRISPR GAGCTCCGGCGCTGAAGCCC CGG (reversed) Intergenic
No off target data available for this crispr