ID: 1159931399

View in Genome Browser
Species Human (GRCh38)
Location 18:74316021-74316043
Sequence CAGGGGGAGGAAAGGGCGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1268
Summary {0: 1, 1: 0, 2: 3, 3: 113, 4: 1151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159931399_1159931413 16 Left 1159931399 18:74316021-74316043 CCACCCGCCCTTTCCTCCCCCTG 0: 1
1: 0
2: 3
3: 113
4: 1151
Right 1159931413 18:74316060-74316082 ATCTGCAGTGCAGGAGGCCGTGG 0: 1
1: 0
2: 0
3: 31
4: 391
1159931399_1159931414 17 Left 1159931399 18:74316021-74316043 CCACCCGCCCTTTCCTCCCCCTG 0: 1
1: 0
2: 3
3: 113
4: 1151
Right 1159931414 18:74316061-74316083 TCTGCAGTGCAGGAGGCCGTGGG 0: 1
1: 0
2: 2
3: 21
4: 226
1159931399_1159931412 10 Left 1159931399 18:74316021-74316043 CCACCCGCCCTTTCCTCCCCCTG 0: 1
1: 0
2: 3
3: 113
4: 1151
Right 1159931412 18:74316054-74316076 TGACGCATCTGCAGTGCAGGAGG 0: 1
1: 0
2: 0
3: 9
4: 124
1159931399_1159931410 7 Left 1159931399 18:74316021-74316043 CCACCCGCCCTTTCCTCCCCCTG 0: 1
1: 0
2: 3
3: 113
4: 1151
Right 1159931410 18:74316051-74316073 GCCTGACGCATCTGCAGTGCAGG 0: 1
1: 0
2: 1
3: 11
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159931399 Original CRISPR CAGGGGGAGGAAAGGGCGGG TGG (reversed) Exonic
900104066 1:974747-974769 CTGGGGCAGGGAAGGGTGGGAGG + Exonic
900342212 1:2194594-2194616 CAGGGGGAGAATAGAGCGGGAGG + Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900490732 1:2947937-2947959 CAGTGGGAGGGAAGGGGGTGGGG - Intergenic
900700779 1:4047477-4047499 CAGGGAGAGGAAGGGGAGGAAGG + Intergenic
900923406 1:5688212-5688234 CAAGGGGAGGGAAGGGCAGTGGG - Intergenic
901037320 1:6344098-6344120 CAGGGAGAGGAAAGAGCAGCAGG + Intronic
901087784 1:6622170-6622192 CTGGGGGAGGCACTGGCGGGAGG + Exonic
901266436 1:7914227-7914249 AAGGGGGAGGGAAGGGGGCGGGG - Intergenic
901328092 1:8381243-8381265 CAGTCGGAGGAAAGGGAGGAGGG - Intronic
901453959 1:9352825-9352847 CTGGGGGAGGGAGGGGAGGGTGG - Intronic
901464572 1:9413115-9413137 CAGGGTGAGGACAGGGCTGCGGG - Intergenic
901650221 1:10738719-10738741 GAGGGGGAGGAGAGGGAGGCAGG + Intronic
901740338 1:11338069-11338091 GAGGGGGAGGAGAGGGAGGAGGG - Intergenic
901763316 1:11484641-11484663 CAGAGGGAGGAACGGATGGGAGG - Intronic
902364084 1:15959498-15959520 AAGAGGGAGGAGAGGGAGGGAGG + Intronic
902450136 1:16491444-16491466 TGGGGGGAGGAAAGGAGGGGAGG + Intergenic
902490550 1:16777879-16777901 GAGGGGAAGGGAAGGGCTGGTGG + Intronic
902564974 1:17305509-17305531 AAGGCTGAGGGAAGGGCGGGGGG - Intergenic
902723873 1:18322703-18322725 CAGGGGTGGGCAGGGGCGGGAGG - Intronic
902829327 1:19000065-19000087 GAGGAGGAGGAAAGGGGAGGGGG + Intergenic
902857707 1:19221159-19221181 CTGGGGGAGGTATGGGAGGGAGG - Intronic
903004675 1:20290796-20290818 AGGGGGGAGGGAAGGGCGAGGGG + Intergenic
903156404 1:21446551-21446573 AAGGAGGAAGAAAGGGAGGGAGG - Intronic
903221897 1:21873896-21873918 CAGGGGGTGGAGAGGGTGGGGGG - Intronic
903260562 1:22129597-22129619 CAAGGTGAGGGAAGGGCGTGCGG - Exonic
903277809 1:22232930-22232952 GAGGGGGAGGAGAGGGCTGCAGG - Intergenic
903325027 1:22564420-22564442 CTTGGGGAGGAGAGGGCTGGGGG + Intronic
903589611 1:24444712-24444734 CAGGGAGAGGAAAGAGCCGGGGG + Intronic
903789997 1:25886243-25886265 CAGTGGGAGGGAAGGGCAGAGGG + Intronic
904029068 1:27522803-27522825 CAGGCGGAGGACATGGAGGGGGG + Intergenic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904415747 1:30360167-30360189 CAGGTGGAGGAACAGGCTGGAGG - Intergenic
904605553 1:31695971-31695993 CAGGAGGTGGGAAAGGCGGGAGG + Intronic
904767269 1:32860121-32860143 CAGGGGGAGGACAGGTGGGGAGG - Intergenic
904833447 1:33320278-33320300 CAGGAGCAGGAAAAGGCTGGAGG + Intronic
904883059 1:33715021-33715043 CACGGGGAGGCCAGGACGGGCGG + Intronic
905089440 1:35416878-35416900 CTGGGGGAGGGAAAGGCAGGTGG + Intronic
905173514 1:36122986-36123008 CAGGGGGTGGAAAGGGTGAATGG - Intronic
905202716 1:36324538-36324560 GAGGAGGAGGAAAGGGGGAGAGG + Intronic
905461559 1:38126001-38126023 CTTGGGGAGGAATGGGAGGGAGG + Intergenic
905544799 1:38789137-38789159 CAGGGGCAGGCAAGGGGGCGTGG - Intergenic
905572643 1:39017898-39017920 GACCTGGAGGAAAGGGCGGGAGG - Intergenic
905578255 1:39063263-39063285 CTTTGGGAGGAAAAGGCGGGAGG - Intergenic
905772218 1:40645714-40645736 CAGGGGGTGAAAAGGGAAGGGGG + Intronic
905875152 1:41427520-41427542 CCGGGGCAGGAAGGGGCGTGTGG + Intergenic
905887285 1:41498148-41498170 TACGGGGAGGGAGGGGCGGGGGG - Intergenic
906291879 1:44624685-44624707 GAGGAGGAGGAGAGGGCGAGGGG + Intronic
906709674 1:47919861-47919883 CTGGGGCAGGAAAGAGAGGGAGG + Intronic
906929643 1:50156458-50156480 AAGGGGGAGGAGAGGGAAGGTGG + Intronic
906942243 1:50265487-50265509 CAGGTGGAGGAAATAGCAGGTGG - Intergenic
907509202 1:54945832-54945854 GAGGGGGAGAAAAGGGAGGTGGG + Intergenic
907581657 1:55577826-55577848 CAACAGGAGGAAAGGGTGGGTGG + Intergenic
908296540 1:62718579-62718601 GGGAGGGAGGAAAGGGAGGGAGG + Intergenic
908737419 1:67291104-67291126 CTGGGGGAGAAAAGGCAGGGTGG - Intergenic
909169976 1:72282745-72282767 CAGGGGGAGGGAGGGGAGGGAGG - Intergenic
910243668 1:85115699-85115721 CAGGGGGAGGTGGGGGCAGGGGG + Intronic
911618292 1:100038410-100038432 CAGGGTGGGGGAAGGGAGGGAGG - Intronic
912308511 1:108595565-108595587 GAGAGGGAGGAAAGGGAGGGTGG + Intronic
912554190 1:110504271-110504293 CAGGGGGAGGTCAGGGAGGCTGG + Intergenic
912581450 1:110724596-110724618 CAGGGGGAGAAAAGTGTTGGGGG - Intergenic
912703393 1:111894997-111895019 CAGGGGGAGGGAAGGGGAGGAGG + Intronic
912735327 1:112145106-112145128 CAGGGGGAGGATGGGGCAGAAGG + Intergenic
912754856 1:112315738-112315760 CAGGGGTTGGAAATGGTGGGGGG + Intergenic
912869650 1:113292329-113292351 TAGAGAGAGGAAAGGGCGGAGGG + Intergenic
913490357 1:119374149-119374171 CATGGGGAAGAGAGGGCAGGGGG - Intronic
914944695 1:152053587-152053609 CAGGGGCAGGGAAGAGCTGGAGG - Intergenic
915042903 1:152983451-152983473 CAGGGGGAGGAAGGTGAGAGTGG + Intergenic
915086958 1:153395504-153395526 CATGGGGACGGAAGGGAGGGAGG - Intergenic
915105569 1:153533370-153533392 AAGGGGGAGGAAAGGGGTGTAGG + Intergenic
915349959 1:155218050-155218072 CTAGGGCAGGAAAGGTCGGGGGG + Intergenic
915353304 1:155239973-155239995 CAAGGGCAGGAAAGGTCGGGGGG + Exonic
915447498 1:155982233-155982255 CCAGGGGAGGAAAAGGGGGGCGG + Intronic
915461874 1:156075370-156075392 AAGGAGCAGGAAAGGGCGTGAGG - Exonic
915524487 1:156467570-156467592 CCGGGGCAGGGAAGGGCGGGCGG + Exonic
915895395 1:159807910-159807932 CAGGGAGAGGAAAGAAGGGGAGG + Intronic
915973532 1:160370623-160370645 AAGGGGGAGGAAGGGTCGTGGGG - Exonic
916001472 1:160620352-160620374 GTGTGGGAGGTAAGGGCGGGGGG + Intronic
916045714 1:160998669-160998691 CAGTGGTAGGAAAGGGAGGGAGG + Exonic
916445094 1:164864606-164864628 CTGGGGGAGGGAAGGGTGAGGGG + Intronic
916694249 1:167220775-167220797 CGGGGAGAGGAAGGAGCGGGAGG + Intergenic
916872669 1:168933994-168934016 GATGCAGAGGAAAGGGCGGGAGG - Intergenic
917637760 1:176953706-176953728 CATGTGGAGGGAAGGGCGGCAGG + Intronic
917925369 1:179785165-179785187 CAGGGTGAGGAATGGGGGGTGGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918729443 1:187972687-187972709 AAGAGGGAAGAAAGGTCGGGGGG - Intergenic
919163386 1:193861318-193861340 CAGGGGGAGGGAAGGGGATGAGG - Intergenic
919719258 1:200814131-200814153 CGGGGGGAGGGGTGGGCGGGTGG + Intronic
919804834 1:201375379-201375401 CAGGGTGAGGACAGTGAGGGAGG + Intronic
919990260 1:202704416-202704438 AACGTGGAGGAAAAGGCGGGAGG + Intronic
920164534 1:204026283-204026305 GAGGGGGAAGGAAGGGAGGGTGG + Intergenic
920182937 1:204143622-204143644 GAGGGGAAGGAAGGGGCTGGAGG + Intronic
920694328 1:208170414-208170436 CAGGGGGAAGCAGGGGCGGGTGG + Intronic
920863978 1:209736004-209736026 CAGAGGGAGGGAAGAGCGTGAGG - Intergenic
920944599 1:210516293-210516315 CAGCTGGTGGAGAGGGCGGGTGG + Intronic
921262897 1:213399646-213399668 GCGGGGGAGGAGAGGGTGGGCGG - Intergenic
921305448 1:213792098-213792120 GAGCAGGAGGAAAGGGTGGGAGG - Intergenic
921827416 1:219688682-219688704 CATGGTGAGGAGAGGGAGGGTGG - Intronic
921911360 1:220552839-220552861 CAGGGGGTGGAGTGGGCAGGTGG - Intronic
922572011 1:226639900-226639922 CAGTGGTAGGAAAGGCCCGGAGG + Intronic
922604542 1:226881336-226881358 CAGGAGGAGGGAAGGGCAGAAGG - Intronic
922758394 1:228109338-228109360 CAGGGAGAGGCAAGAGTGGGCGG + Intergenic
922875177 1:228934857-228934879 GAGGGGGCAGAAAGGGAGGGAGG + Intergenic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923505345 1:234600421-234600443 CACGGGAAGGAAAGGGGAGGAGG - Intergenic
923774445 1:236965960-236965982 CAGGTGGATGAGAGGGTGGGAGG + Intergenic
924802150 1:247335385-247335407 TAGGAGGAGGAAAGTGAGGGAGG + Intergenic
1062812484 10:477325-477347 GAGGGGGAGGGAGGGGAGGGAGG + Intronic
1063353132 10:5374252-5374274 GAGGGGGAGGGGAGGGCGAGGGG + Exonic
1063357333 10:5412977-5412999 CAGGGGGAGGCGAGGGCCGCTGG + Intronic
1064542918 10:16423340-16423362 CACTGGGAGGCAAAGGCGGGAGG + Intergenic
1066334578 10:34463037-34463059 GAAGGGGAGGAAAGGGAAGGGGG + Intronic
1066370562 10:34815321-34815343 CTGGGGGAGGGGACGGCGGGAGG + Exonic
1066744772 10:38596959-38596981 AAGGAGGAGGAAAGGGAGGGAGG - Intergenic
1067184779 10:44017311-44017333 AAGGGGAAGTAAAGGGTGGGAGG - Intergenic
1067469816 10:46528239-46528261 GAGCTGGAGGAAAGGGCTGGTGG - Intergenic
1068232750 10:54191970-54191992 GAGGGGAAGGAAGGGACGGGGGG + Intronic
1068546509 10:58352503-58352525 CTTGGGGAGGGTAGGGCGGGAGG + Intronic
1069605564 10:69736856-69736878 TAGGGGGAGGAATCAGCGGGTGG - Intergenic
1069639230 10:69944156-69944178 CAGCGGGACCAAAGGGCGAGAGG + Exonic
1069770452 10:70895429-70895451 AAGGGGCAGGAAGGGGTGGGGGG + Intergenic
1070097994 10:73357080-73357102 CACAGGGAGGAAAAGGGGGGTGG + Intronic
1070220801 10:74442151-74442173 GAGGGAGAGGAAAGTGGGGGTGG - Intronic
1070352963 10:75611087-75611109 CAGGGGGAGCACAGGGTGAGAGG + Intronic
1070490321 10:76969899-76969921 CAGGGTGAGGAGAGGGCGAGGGG + Intronic
1070824941 10:79385582-79385604 GAGGGGAAGGAAAGGGAGTGGGG + Exonic
1071153743 10:82666103-82666125 CATTGGGAGGCAAAGGCGGGTGG - Intronic
1071431782 10:85612317-85612339 CAGGAGGAGGTAAGAGCCGGCGG - Intronic
1071457600 10:85862871-85862893 CAGAGGGAGGAAATGGAGGGAGG + Intronic
1071731585 10:88253790-88253812 CAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1071971890 10:90916045-90916067 GGGGAGGAGGGAAGGGCGGGTGG + Intronic
1072066052 10:91872690-91872712 GAGGGGGAGGGAAGGGGGAGGGG + Intergenic
1072079204 10:92012082-92012104 GAGGGGGAGGGGAGGGAGGGAGG - Intronic
1072107999 10:92291686-92291708 CTGGGGGAGGACAGAGCGAGCGG + Intronic
1072641755 10:97216248-97216270 CAGGGGCAGGACACGGTGGGAGG + Intronic
1072727163 10:97821839-97821861 CAGGAGCAGGAAAGGGGGGCAGG + Intergenic
1072787425 10:98293760-98293782 CAGGAGGAGAAAAGGCCAGGTGG + Intergenic
1072794808 10:98346586-98346608 AAGGGGGAGGAAAGGGAAGAGGG + Intergenic
1072881710 10:99234842-99234864 AAGGAGGAGGAACTGGCGGGGGG + Intronic
1073009270 10:100347196-100347218 CGCGTGGAGGTAAGGGCGGGAGG - Exonic
1073171284 10:101510981-101511003 CAGGGGCTGGAAAGGTGGGGAGG - Intronic
1074360913 10:112823602-112823624 CTGGGGGAGGATGGTGCGGGAGG - Intergenic
1074388287 10:113034964-113034986 AAAGGGGAGGAAAGGGAAGGAGG - Intronic
1074606162 10:114969771-114969793 AAGGGGGAGGCTGGGGCGGGGGG + Intronic
1074755861 10:116623745-116623767 CGCGGGGTGGGAAGGGCGGGTGG - Intronic
1074885438 10:117689323-117689345 AAGGGGGAAGAAGGGGAGGGAGG + Intergenic
1074912633 10:117925444-117925466 CAGGGGGAGGTAAGAGCAGGCGG - Intergenic
1074928864 10:118103167-118103189 CACTGGGAGGAAAGGAAGGGTGG + Intergenic
1075237686 10:120745810-120745832 CAGGGGGAGGAAAGGGTTTGGGG + Intergenic
1075259701 10:120952011-120952033 AATGGGGAGAAAAGGGTGGGGGG + Intergenic
1075382402 10:122029912-122029934 CAGGGGGTGGGGAGGGTGGGAGG + Intronic
1075453156 10:122567474-122567496 CAGAGGGAGGAAAGGCCAGCTGG - Intronic
1075529158 10:123212907-123212929 ATGGGGAAGGAAAGTGCGGGGGG - Intergenic
1075686137 10:124366621-124366643 CAGGGAGAGGAAGGGTTGGGAGG + Intergenic
1076219664 10:128723026-128723048 TATGGGGAGGAAATGGTGGGTGG + Intergenic
1076274125 10:129182234-129182256 CAGGGGAAGGGAAGGGAGAGGGG - Intergenic
1076318909 10:129564289-129564311 GAGGGGGAGGAAGGAGGGGGAGG - Intronic
1076504783 10:130964421-130964443 CAGGAGTAGGAAAGTGCAGGGGG + Intergenic
1076542089 10:131220791-131220813 CAGGATGAGGAAAGGGGGTGGGG + Intronic
1076660926 10:132055760-132055782 CCGGGGGAGGCAAGGGTGAGAGG - Intergenic
1076668554 10:132106443-132106465 GAGGGGGAGGAACGGGGGCGGGG - Intronic
1076674328 10:132140374-132140396 CAGCGGGAGGAGGCGGCGGGAGG + Intronic
1076772597 10:132674548-132674570 CTGGGGGAGAGAAGGGAGGGTGG + Intronic
1076806688 10:132862421-132862443 CAGGGAGAGGACAGGGTGGGTGG + Intronic
1076870467 10:133190468-133190490 CAGGGGGAGGAGACGGCAGCCGG + Intronic
1077015988 11:399400-399422 CAGGTGGAGGAGGGGGCAGGTGG - Intronic
1077185783 11:1234766-1234788 CAGGGGGCGGGGAGGGCAGGGGG + Intronic
1077246062 11:1539186-1539208 CTGGGGGAGGCCAAGGCGGGCGG + Intergenic
1077286481 11:1768201-1768223 CAGGGGCAAGCAAGGGCTGGAGG + Intergenic
1077368599 11:2171296-2171318 CAGAGGGAGGCAGGGGCAGGTGG + Intronic
1077898655 11:6473347-6473369 CAGAGGATGGAAGGGGCGGGGGG + Intronic
1078134170 11:8638565-8638587 GAGGAGGAGGATAGGGTGGGGGG - Intronic
1078542315 11:12222220-12222242 CGGGGGGAGGTCAGGGCTGGCGG + Intronic
1078807929 11:14725449-14725471 CAGAGGGAGGAAAGGAGGGAGGG - Intronic
1079121494 11:17688296-17688318 CAGAGGAGGGAAAGGGCAGGGGG + Intergenic
1079129413 11:17738611-17738633 CAGTGGGAGGAGAGGGCCAGGGG - Intronic
1079156167 11:17949727-17949749 CAGGGGAGGTAAAGGGAGGGTGG + Intronic
1079165575 11:18038902-18038924 CTGGGAGAGGGAAGGGAGGGAGG + Intronic
1079368232 11:19827958-19827980 CAAGGGGAGGAAGGGGAGGGTGG + Intronic
1079470653 11:20774229-20774251 GAGGGGGAGGAAAGGAAGGAAGG - Intronic
1080042069 11:27769470-27769492 CAGGGTGCAGAAAGGGTGGGAGG + Intergenic
1080687080 11:34524728-34524750 CAGGGAGAGGAAAGGGCACCTGG - Intergenic
1081115367 11:39192919-39192941 GAGGGAGAGGCACGGGCGGGCGG - Intergenic
1081247092 11:40780863-40780885 TAGGGAGTGGAAAGGGAGGGAGG + Intronic
1081682699 11:45019371-45019393 CTGGGAGAGGAAAGGGCAGTCGG + Intergenic
1081869531 11:46377047-46377069 TGGGGGGAGGTCAGGGCGGGAGG - Intronic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1081932447 11:46881494-46881516 CAGGGGTGGGAAAGGGCTGCTGG - Intronic
1083170636 11:60922241-60922263 CAGGGCAAGAAAAGGGCAGGGGG - Exonic
1083270481 11:61569766-61569788 AAGGGGGAGGAGAGCGGGGGAGG + Intronic
1083298197 11:61726577-61726599 CAAGGGGAGGGAAGGGAGGCAGG + Intronic
1083594076 11:63910815-63910837 CAGGAGGGGGGAAGGGAGGGAGG - Exonic
1083674123 11:64316110-64316132 GAGGGGGAGGAGAGGGCGTGGGG - Exonic
1083691223 11:64409977-64409999 GAGGGGGAAGAACAGGCGGGAGG - Intergenic
1084024182 11:66437627-66437649 CTTTGGGAGGAAAAGGCGGGTGG + Intronic
1084363765 11:68684898-68684920 GAAGGGAAGGACAGGGCGGGCGG - Intronic
1084536718 11:69761617-69761639 CATTGGGAGGAAGAGGCGGGCGG + Intergenic
1084568351 11:69944295-69944317 CAGGGTGCGGACAGGGCAGGAGG + Intergenic
1084730067 11:71067093-71067115 GAGGTGAAGGAAAGGGCGTGTGG + Intronic
1084884294 11:72193384-72193406 GGGAGGGAGGAAAGGGAGGGAGG + Intronic
1084884299 11:72193397-72193419 GGGAGGGAGGAAAGGGAGGGAGG + Intronic
1085037051 11:73307125-73307147 CAGACGGAGGCAGGGGCGGGAGG + Intergenic
1085037188 11:73307739-73307761 GAGGGGGAGGGAAGGGGAGGAGG + Intergenic
1085071154 11:73547146-73547168 TAGGCAGAGGAAAAGGCGGGGGG + Intronic
1085453811 11:76654762-76654784 GAGGGGGAGCAAAGGAGGGGGGG + Intergenic
1085457027 11:76670950-76670972 TGGGGGGATGAGAGGGCGGGAGG + Intergenic
1085473174 11:76771211-76771233 CAGAGGGTGGAAGGGGCAGGAGG - Intergenic
1085476776 11:76794028-76794050 CAGAGGGAGGGATGGGCAGGAGG + Intronic
1085778093 11:79383997-79384019 CATGGGGAAGAAAGGAAGGGGGG - Intronic
1085923611 11:80988681-80988703 CAGGGGAAGGAGTGGGAGGGAGG + Intergenic
1086835530 11:91616976-91616998 CAGGGGCTGGGAAGGGCGGTGGG - Intergenic
1088077098 11:105863613-105863635 CAGGGGCAGGAGTGGGAGGGAGG - Intronic
1088407580 11:109498397-109498419 CTGGGGGAGAGAAGGGAGGGTGG + Intergenic
1088582729 11:111331306-111331328 GAGGGGGAGGGAGGGGCAGGAGG - Intergenic
1088908608 11:114173344-114173366 CAGGGGAGGGGAAGGGAGGGTGG + Intronic
1088995409 11:114991702-114991724 CTGGAAGAGGAGAGGGCGGGTGG - Intergenic
1089623429 11:119736042-119736064 CAAAGGGAGGAAAGTGTGGGTGG - Intergenic
1089654302 11:119935735-119935757 CAAGGGGAGGTGAGGGTGGGTGG - Intergenic
1089757076 11:120695116-120695138 CAGCAGGAGGAGAGGGCTGGGGG - Intronic
1089831671 11:121334432-121334454 CAAGGGGAAGTAAGGGAGGGTGG - Intergenic
1090227341 11:125079658-125079680 CAGGGAGAGAGAAGGGAGGGTGG - Intronic
1090273488 11:125404006-125404028 CAGGGGGCGGAAGGGGTAGGGGG + Intronic
1090383208 11:126341336-126341358 CAGGGGCAGGAAAGGGCCTCAGG - Intronic
1090939080 11:131371997-131372019 CAGGGGGAGAAGAGGGCGAGGGG - Intronic
1091142816 11:133250510-133250532 GAGAGGGAGGGAAGGGAGGGAGG + Intronic
1091488778 12:915216-915238 AAGGGGCAGGAAAGGCCTGGAGG + Intronic
1091797144 12:3303941-3303963 CAGGGGGAGGCAGAGGCTGGAGG + Intergenic
1092159831 12:6310310-6310332 CAGGGGGAGGACCGGACGGCCGG + Intergenic
1092204334 12:6606517-6606539 TGGGGGGCGGAAAGAGCGGGTGG - Intronic
1092239484 12:6828371-6828393 GAGGGAGAGGAAAGGGGGGAAGG - Intronic
1092731391 12:11538443-11538465 CAGGGTGAGGCAGGGACGGGAGG + Intergenic
1092948289 12:13476543-13476565 CAGGGCCATGAAAGGGCTGGTGG + Intergenic
1093917660 12:24823686-24823708 CAGGAGGAGGAGAGGGAGGGTGG - Intronic
1093955638 12:25214863-25214885 CAGGGGGAAAAGAGGGCGGTAGG + Intronic
1094151469 12:27288845-27288867 AAGGGGGAGTAAATGGCAGGGGG - Intronic
1094636702 12:32233509-32233531 AAGGGGGAAGAACGGGAGGGAGG - Intronic
1095472713 12:42553521-42553543 CAGGGGGTGGGTGGGGCGGGGGG + Intronic
1096073693 12:48789284-48789306 CTGGGGGAGGAAGCGGCCGGAGG - Intergenic
1096146849 12:49284367-49284389 CTGAGGAAGGAAAGGGCAGGGGG - Intergenic
1096528387 12:52228082-52228104 GAGGGGGAGGGGAGGGGGGGAGG - Intergenic
1096542267 12:52314466-52314488 CAGTGGGATGAAAGGTGGGGAGG + Exonic
1096557286 12:52411190-52411212 CAGGGGGAAGAAAGGAGGTGAGG + Intergenic
1096677223 12:53232298-53232320 CAGGGGCAGGCAGGGGAGGGAGG - Intronic
1096718915 12:53506965-53506987 CTGGGGGTGGAAAGGGCAGGAGG - Intronic
1097176638 12:57147212-57147234 CAGGGGGAGGGCAGGGAGGAAGG - Intronic
1097182377 12:57178794-57178816 CAGGGGGAGGAGAGTGGGCGAGG + Intronic
1098435239 12:70461512-70461534 CAGGGGGAAGAGAGGGAGTGGGG - Intergenic
1098551734 12:71770075-71770097 CAGAGAGAGGACAGGGTGGGTGG + Intronic
1098731083 12:74037613-74037635 CTGGGGGAGAGAAGGGTGGGTGG - Intergenic
1098929740 12:76397335-76397357 CAGGGGGTGGGGAGGGGGGGTGG + Intronic
1099475742 12:83105540-83105562 CAGGAGGAGGAAAGAGTGAGGGG + Intronic
1099899740 12:88693098-88693120 AAGGGGGAGGGAAGGACGGAGGG + Intergenic
1100260518 12:92928874-92928896 CCGGGGGCGGGGAGGGCGGGTGG - Intronic
1101076959 12:101140301-101140323 CAGGGGGAAGGAAAGGTGGGTGG - Intergenic
1101396818 12:104355963-104355985 GAGGGTGAGGAAAGGGTGGAAGG + Intergenic
1101694288 12:107109830-107109852 CAGGGGGAGGCAAGGGCTTATGG + Intergenic
1102167860 12:110820762-110820784 CAGGGGGAGGGAAGGGGAGGGGG - Intergenic
1102197439 12:111034970-111034992 AAGGGGATGGAAGGGGCGGGGGG - Intronic
1102230232 12:111257207-111257229 GAGGGGGAGGAAGGAGAGGGAGG - Intronic
1102614911 12:114145173-114145195 CAGGGGTAGGAAAGAAAGGGAGG - Intergenic
1102689893 12:114752084-114752106 CAGGATGGGGAAAGGGCGGGGGG - Intergenic
1102854040 12:116277762-116277784 CGGGGGGAGCGAGGGGCGGGCGG + Intergenic
1102919032 12:116778085-116778107 GAGAGGGAGGAAAGGCAGGGAGG - Intronic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103377632 12:120469315-120469337 CGGGGGGAGGGGAGGCCGGGGGG + Intronic
1103484875 12:121275916-121275938 CTTTGGGAGGACAGGGCGGGTGG + Intronic
1103913787 12:124365719-124365741 CAGGTGGAGGGAGGGGAGGGAGG - Intronic
1103938087 12:124486996-124487018 CAGGGGTAGGATGGGGTGGGAGG - Intronic
1103958534 12:124593223-124593245 CAAGGAGAGGGAAAGGCGGGTGG - Intergenic
1104034250 12:125087539-125087561 CATGGAGGGGAAAGGGAGGGAGG - Intronic
1104172823 12:126298933-126298955 GAGAGGGAGGAAAGTGAGGGAGG + Intergenic
1104602044 12:130161220-130161242 CGGGGGAAGGGAATGGCGGGGGG + Intergenic
1104749667 12:131230205-131230227 GAGGGGCAGGTGAGGGCGGGGGG + Intergenic
1105446502 13:20461974-20461996 CTGGGGGAGGAGGAGGCGGGAGG + Intronic
1105900200 13:24746539-24746561 CATGGGCAGGGAAGGGCGCGCGG + Intergenic
1106423604 13:29604733-29604755 CAGGAGGTGGAAAGGGAGGCGGG - Intergenic
1106730980 13:32541212-32541234 CTTCGGGAGGTAAGGGCGGGTGG - Intergenic
1106841622 13:33690604-33690626 AAAGGGCAGGAAAGGGCTGGGGG + Intergenic
1107760627 13:43674575-43674597 GTGGGGGAGGGAAGGGAGGGAGG + Intronic
1108794767 13:54017808-54017830 AAGGGGAGGGAAAGGGAGGGAGG + Intergenic
1109950994 13:69501939-69501961 CAGGGGGAGAGAAGGCAGGGTGG + Intergenic
1110554946 13:76849256-76849278 CTTGGGGAGGCCAGGGCGGGCGG + Intergenic
1111559945 13:89932267-89932289 GAGTTGGAGGAAAGGGTGGGAGG - Intergenic
1112023162 13:95389706-95389728 GAGGGGCAGGAATGGGAGGGAGG + Intergenic
1112717208 13:102200857-102200879 CATTGGGAGGACAAGGCGGGCGG + Intronic
1113436327 13:110294419-110294441 CAGATGGAGGAATGGGAGGGAGG - Intronic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113660712 13:112104940-112104962 CAGCGGGACGCGAGGGCGGGAGG + Intergenic
1113692788 13:112323632-112323654 CAGGGGCAGGAAGCGGAGGGAGG - Intergenic
1113762432 13:112859008-112859030 TGGGGGGAGAAAAGGGCTGGGGG - Intronic
1113765447 13:112877998-112878020 CAGGGGGTGGGAGGGGCTGGCGG + Intronic
1113807539 13:113118372-113118394 CAGGTGGTGGAAAGGGCCTGAGG + Intronic
1113850211 13:113413569-113413591 CAGGGGTGGGAAAGGGCGAGAGG - Intergenic
1113975641 13:114225552-114225574 AAGGGGGAGGGGAGGGAGGGGGG + Intergenic
1114073190 14:19131739-19131761 AGGGGGGAGGGAAGGGAGGGGGG + Intergenic
1114089076 14:19268244-19268266 AGGGGGGAGGGAAGGGAGGGGGG - Intergenic
1114400445 14:22405401-22405423 CAGGGGGAGGGAAGAGCAAGAGG - Intergenic
1114482524 14:23044534-23044556 GTGGGGGAGGAAAGGTCAGGGGG + Intergenic
1114536203 14:23424595-23424617 CAGGAGGAGGAAAGGGCAGAGGG - Intronic
1114714982 14:24815595-24815617 GTGGGGGAAGAAAGGGCGTGTGG - Intronic
1114726329 14:24941545-24941567 CAGGGGGAGGAGGGAGCAGGAGG + Intronic
1114758228 14:25283610-25283632 CAGGGGGAGAGAAGGCAGGGTGG + Intergenic
1115486535 14:33916090-33916112 CAGAGGCAGGAAAGGGTGCGGGG - Intergenic
1115498192 14:34027250-34027272 GAGGGGGAGGAGAGGGGAGGAGG + Intronic
1115498202 14:34027272-34027294 GAGGGGGAGGAGAGGGGAGGAGG + Intronic
1115498264 14:34027396-34027418 GAGGGGGAGGGAAGGGGGAGGGG + Intronic
1115498282 14:34027429-34027451 GAGGGGGAAGAAGGGGAGGGGGG + Intronic
1116786203 14:49291482-49291504 CAGGGGAAGGGAAGGGAGGGAGG + Intergenic
1117006351 14:51425082-51425104 CAAAAGGAGGAAAGGGCTGGGGG - Intergenic
1117569550 14:57032953-57032975 CAGTGGGAGGCCAAGGCGGGTGG - Intergenic
1117726744 14:58682240-58682262 CCTGGGGAGCAAAGGGAGGGAGG - Intergenic
1117758980 14:59006196-59006218 CTAGGAGAGGAAAGGGCAGGGGG + Intergenic
1117846761 14:59920044-59920066 GAGGGGGATAAAAGGGTGGGGGG - Intronic
1117846863 14:59920480-59920502 CAAGAGAAGGAAAGGGAGGGTGG + Intronic
1117931462 14:60846119-60846141 CAAGGGGAGGAAAGGAAGAGAGG - Intronic
1117992602 14:61449326-61449348 GAGGGGGAGGAAAGGAGGGAGGG - Intronic
1118219315 14:63840480-63840502 AAGGAGGAGGGAAGGGAGGGAGG - Intergenic
1118384148 14:65241418-65241440 TAGGGGGAGGAAAGAGTGGAGGG - Intergenic
1118550614 14:66945466-66945488 CTGGGGGAAGAAAGTGTGGGAGG + Intronic
1118753046 14:68820327-68820349 AAGGGGGAGGTGAGGGCAGGTGG - Intergenic
1119391156 14:74291986-74292008 CAGGGAGAGGAATCAGCGGGAGG + Intronic
1119539413 14:75428540-75428562 ACGGGGGAGGAGAGCGCGGGAGG - Intronic
1119616225 14:76100743-76100765 CAGGGGCAGGAGAGGGGGTGCGG + Intergenic
1119649271 14:76372162-76372184 CTGGGGTGGGAAAGGGCGGGTGG + Intronic
1120937923 14:89916731-89916753 CAAGGAGAGGAAGGGGCAGGAGG - Intronic
1121050547 14:90816588-90816610 CCGAGGGAGGAAAGGCGGGGTGG + Intergenic
1121272322 14:92646235-92646257 CAAGCGGAGGAAAGGGCCGAGGG - Intronic
1121312971 14:92945086-92945108 GAGGCGGAGGACAGAGCGGGCGG - Intronic
1121317510 14:92971013-92971035 GAGGGGAAAGAAAGGGCGTGTGG - Intronic
1121637725 14:95465174-95465196 CAGGAGGAGGAAGGGAGGGGAGG + Intronic
1121955685 14:98210522-98210544 CAGGGCGAGGAAGGCGGGGGAGG + Intergenic
1122002150 14:98667258-98667280 GAGAGGGAGGAAAGGGAGGAAGG - Intergenic
1122012160 14:98759182-98759204 GAGGAGGAAGAAAGGGAGGGAGG - Intergenic
1122030460 14:98908096-98908118 CAAGGGAAGGAAGGGGCAGGTGG - Intergenic
1122031959 14:98918943-98918965 CAGGGGGAGGCCAGAGAGGGAGG - Intergenic
1122034085 14:98935004-98935026 CAAGGGGAGGACAGGGCAGAGGG + Intergenic
1122039871 14:98979556-98979578 CAGGAGGAAGAAAGTGAGGGGGG - Intergenic
1122047493 14:99034435-99034457 GAGGGGGAGGAAAAGGAGGGAGG + Intergenic
1122059910 14:99130126-99130148 CAGGGGAAGGAGAGGGCGTGGGG - Intergenic
1122161844 14:99790819-99790841 CAGGGAAAGGAAATGGGGGGAGG - Intronic
1122359432 14:101150842-101150864 GAGGGGGAAGGAAGGGAGGGAGG - Intergenic
1122365257 14:101191403-101191425 CAGGGGTAGGGATGGGAGGGTGG - Intergenic
1122631361 14:103109145-103109167 CAGGTGGTGGAGAGGGAGGGAGG - Intronic
1122637896 14:103138794-103138816 CAGCGCGGGGACAGGGCGGGCGG + Intergenic
1122931197 14:104933698-104933720 CTGAGTGAGGGAAGGGCGGGAGG + Exonic
1122978818 14:105181923-105181945 CAGGGGGAGGGAAGGGCAGCTGG - Intergenic
1123018053 14:105384853-105384875 CAGGGGGAGGAGGCGGTGGGGGG - Intronic
1123154129 14:106208156-106208178 CAGAGTGAGGAAAGAGCTGGAGG + Intergenic
1123880729 15:24675995-24676017 CAGGCCGCGGAAAGGGCGCGGGG - Exonic
1124172460 15:27388085-27388107 AGGAGGGAGGAAAGGGAGGGAGG + Intronic
1124212008 15:27771130-27771152 CAAGGGGAGGGAAGGAAGGGAGG - Intronic
1124394702 15:29291080-29291102 TAGGGGGAAGAAAGGGATGGGGG - Intronic
1124635385 15:31361572-31361594 CAGGGGGAGGAAATGAAGGCTGG + Intronic
1124838993 15:33224286-33224308 CAAGGGGCGGGGAGGGCGGGGGG + Intergenic
1124887794 15:33702951-33702973 CAGGGTGAGGAAAGAGAGAGAGG + Intronic
1125903832 15:43371664-43371686 CGGGGCGAGGAAAGGGCCTGAGG + Intronic
1126665940 15:51076733-51076755 CAGGGGCAGGGCAGGGCTGGAGG - Intronic
1126900903 15:53313491-53313513 TAAGGGGATGAAAGGGCAGGCGG + Intergenic
1127071860 15:55295201-55295223 AAGGAGAAGGAAAGGGAGGGAGG + Intronic
1127582339 15:60349830-60349852 GAGGGGAAGGAAAGGGAGGGAGG + Intronic
1127736159 15:61840837-61840859 CAAAGGAAGGAAAGGGAGGGAGG - Intergenic
1127987803 15:64087784-64087806 CAGATGGGGGAAAGGGTGGGAGG - Intronic
1128028681 15:64460869-64460891 CTGGGGGAGGAAAGAGGCGGCGG + Intronic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128366639 15:67008280-67008302 CAGGGGGAGGATGGGGCCAGGGG - Intergenic
1129460073 15:75696175-75696197 CAGGAGGGGGAAGGGGTGGGAGG - Intronic
1129667455 15:77587533-77587555 AAGGGGCAGGTAAGAGCGGGAGG - Intergenic
1129698399 15:77753716-77753738 CTGAGGGAGGAGAGGGCTGGAGG + Intronic
1129818133 15:78574135-78574157 CAGGGGGAGGCCAAGGCGGGCGG + Intronic
1129922796 15:79334498-79334520 CAGGTGAAGGAAGGGTCGGGGGG + Intronic
1130234530 15:82121752-82121774 GAGTGGGAGGAAGGGGCGGGAGG + Intergenic
1130307096 15:82720501-82720523 CAGGGGGAGGGGAGGGGGAGGGG - Intergenic
1130521943 15:84669121-84669143 GAGGCAGAGGAAAGGGCTGGAGG - Intergenic
1130651859 15:85766587-85766609 GAAGGGAAGGAACGGGCGGGAGG - Intronic
1130663577 15:85850822-85850844 CTGGGGGAGAAAAGGAAGGGGGG - Intergenic
1130967724 15:88709661-88709683 CAGGTGGATGAATGGGTGGGCGG + Intergenic
1131135702 15:89933518-89933540 CAGGGGCAGGAGTGGGAGGGAGG + Intergenic
1131422924 15:92322166-92322188 CAGGGGGTGGACAGGGAGAGTGG + Intergenic
1131514175 15:93066387-93066409 CAGGTGGGGGAAACGGGGGGCGG + Intronic
1131701627 15:94942985-94943007 GAGGAGGAGGAAAGGGAGGAGGG + Intergenic
1131805179 15:96114774-96114796 CAGGGGGAGAAAAGTGGGGAAGG - Intergenic
1131857722 15:96616578-96616600 CAGGGAGACCAAAGGCCGGGAGG - Intergenic
1132010737 15:98274048-98274070 AAGGGGGAAGAAAGGGAGGTGGG - Intergenic
1132777666 16:1604720-1604742 CTGGAGGAGGGAAGGGCGGTTGG + Intronic
1132844222 16:1992554-1992576 CCGGAGGAGGAAAGGTCGGTGGG - Intronic
1132978384 16:2721514-2721536 GACGGGGAGGGAAGGGTGGGAGG - Intergenic
1133002018 16:2856571-2856593 CAGGGTAAGGAAAGAGGGGGAGG - Intronic
1133022147 16:2971447-2971469 CATGGGTAGGGAAGGGCGGGTGG + Intronic
1133284879 16:4686026-4686048 CAGCGGGAGGTATGGGAGGGAGG + Intronic
1133392688 16:5422549-5422571 GAGGGGGAAGAAAGGGGAGGAGG + Intergenic
1133392803 16:5422943-5422965 AAGGGGGAGGAAAGAGGAGGAGG + Intergenic
1133392830 16:5423016-5423038 GAGAGGGAGGAAGGGGAGGGAGG + Intergenic
1133392860 16:5423105-5423127 GAGAGGGAGGAAGGGGAGGGAGG + Intergenic
1133885747 16:9826000-9826022 GAGGGGGAGGAATGAGAGGGGGG + Intronic
1134881386 16:17747555-17747577 AAGGAGGGGGAAAGGGAGGGAGG + Intergenic
1135179373 16:20259547-20259569 CAGGGGGTAAAAAGGGAGGGAGG + Intergenic
1135295827 16:21278397-21278419 AAGGGGGAGGAGAGGGCTGGCGG - Intronic
1135775867 16:25257446-25257468 CAGGCTGAGGAAAGGCTGGGCGG + Exonic
1135960356 16:26989904-26989926 CAGGGTGAGGAAAAGGAGGGCGG - Intergenic
1136370156 16:29831101-29831123 CAGGTGGAGGACAGGTAGGGTGG - Intronic
1136932606 16:34432684-34432706 CAATGGGAAGAGAGGGCGGGAGG - Intergenic
1136971966 16:34979130-34979152 CAATGGGAAGAGAGGGCGGGAGG + Intergenic
1137000132 16:35222123-35222145 CAGGGGCAGGAAAGGGGAGGAGG - Intergenic
1137476219 16:48811692-48811714 CCTGGGGAGCGAAGGGCGGGAGG - Intergenic
1137617618 16:49856672-49856694 CCGGAGGAGGAAGGGGCGCGCGG + Intronic
1138183281 16:54957655-54957677 GAAGAGGAGGAAAGGGGGGGAGG - Intergenic
1138186209 16:54979495-54979517 GAGGGGGAGGAGCGGGGGGGCGG + Intergenic
1138338197 16:56269335-56269357 CACGGGGAGGGAAGGCTGGGAGG - Intronic
1138433174 16:56982360-56982382 CAGGGAGAGGAAAGGGGGCCAGG - Intronic
1138444416 16:57054669-57054691 GAGGGTAAGGAAAGGGAGGGTGG - Intronic
1138500357 16:57438706-57438728 AAGTGGGAGGAAAGGGTTGGTGG - Intronic
1138523486 16:57587322-57587344 GAGGGGGAAGGAAGGGAGGGAGG - Intronic
1138621240 16:58212957-58212979 GAGGAGGAAGAAAGGGAGGGAGG + Intergenic
1138667747 16:58586357-58586379 GAGGGGGAGGGGAGGGCAGGGGG + Intronic
1139332661 16:66205557-66205579 GAGGGGGAACAAAGGGAGGGAGG + Intergenic
1139653345 16:68373552-68373574 CAGGAGGAGGAGAGGGTGTGGGG - Intronic
1139818614 16:69700088-69700110 GGAGGGGAGGAAAGGGAGGGAGG - Intronic
1140258616 16:73358034-73358056 CAGAGGGAGGAAATGGTGGGAGG - Intergenic
1140328079 16:74025296-74025318 CTGGGGGAGGTGAGGGCGGCAGG - Intergenic
1140604537 16:76518849-76518871 CAGAGGCAGGAAATGGCGGAGGG - Intronic
1140924719 16:79571227-79571249 CAGGGGGATGAGCGGGAGGGAGG + Intergenic
1141013650 16:80427058-80427080 CAGTGGTGGGAAAGGGAGGGAGG - Intergenic
1141038478 16:80650958-80650980 CAGGGGCTGGGAAGGGCGGGGGG + Intronic
1141221142 16:82070325-82070347 CAGTGGTAGGAAGGGGCTGGAGG - Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141634035 16:85304306-85304328 CAGGAGAAGAAAAGGGCAGGAGG - Intergenic
1141970836 16:87481514-87481536 CAGGGAGAGAAACGGGGGGGGGG + Intronic
1142020774 16:87780867-87780889 CAGAGGGAGGAAGGCGTGGGTGG - Intergenic
1142145061 16:88489457-88489479 CAGAGGCAGGAAAGGCAGGGAGG + Intronic
1142177422 16:88651507-88651529 CAGGGGGAGGAAATGGGGGCTGG - Intergenic
1142254386 16:89006856-89006878 GAGGGGGAGGGAGGGGAGGGGGG - Intergenic
1142255700 16:89012701-89012723 CAGGTGGATGAATGGGTGGGTGG - Intergenic
1142261495 16:89044572-89044594 CAGGGGAAGGGAATGGAGGGGGG - Intergenic
1142265553 16:89062606-89062628 TGGGGAGAGGACAGGGCGGGAGG + Intergenic
1142300833 16:89257054-89257076 GAGGGCGAGGAAGGGGAGGGCGG - Intergenic
1142470551 17:161125-161147 AAGAGGGAGGAGAGGGCAGGAGG - Intronic
1142495651 17:305073-305095 CGGGAGGGGGACAGGGCGGGAGG + Intronic
1142597120 17:1035343-1035365 TAGGGGGTGGAAGGGGTGGGGGG - Intronic
1142727996 17:1830231-1830253 CGAGGGGAGGAGATGGCGGGGGG + Intronic
1142847912 17:2691014-2691036 CAGGGGGAGGAAAGCGGAGTTGG + Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1143181368 17:4986390-4986412 AAGGATGAGGAAAGGGAGGGAGG + Intronic
1143373781 17:6455692-6455714 CAGGGGGAAGAAGGGAGGGGAGG + Intronic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143503320 17:7351268-7351290 GGGAGGGAGGAAAGGCCGGGAGG - Intronic
1143862662 17:9902130-9902152 AAGGAGGAGGAAAGGGAGGAGGG - Intronic
1144698150 17:17319710-17319732 CAGGGGCAGGGAGGGACGGGAGG + Intronic
1145224907 17:21119957-21119979 CAGCGGGAGGGACGGGGGGGGGG + Intergenic
1145225656 17:21126080-21126102 CAGAGGAAGGAAGGGGCGGGGGG - Intronic
1145305703 17:21673988-21674010 CAGGAGGAAGAAACTGCGGGCGG - Intergenic
1145307010 17:21680967-21680989 CAGGAGGAGGAAAGCCCAGGCGG - Intergenic
1146190044 17:30756949-30756971 CACTGGGAGGCCAGGGCGGGTGG + Intergenic
1146747681 17:35346502-35346524 GAGGGAGGGGAAAGGGCGGGAGG - Intergenic
1146790294 17:35747076-35747098 CTGGGGGAGGATGGGGTGGGGGG + Exonic
1147306034 17:39565043-39565065 CAGGGGCAGGGAAGGGCGTGGGG - Intergenic
1147341428 17:39755020-39755042 CTGGGAGAGGAAAGGGAGGCCGG - Intergenic
1147390542 17:40106655-40106677 GAGGTGGAGGAAAGGGAGAGGGG + Intergenic
1147428392 17:40357020-40357042 CAGAGGGAGAAAGGGGCTGGCGG - Intronic
1147705203 17:42421432-42421454 CAGGGAGAGGAAGGGGAGAGGGG + Intronic
1147845301 17:43400346-43400368 AGGTGGGAGGAAAGGGAGGGGGG - Exonic
1148051766 17:44773099-44773121 GAGGAGGAGGGAAGGGAGGGAGG - Intronic
1148575377 17:48706871-48706893 CAGGGGGTGGGAAGAGAGGGAGG - Intergenic
1148603443 17:48910565-48910587 CAGGGGGAGGGGAGGGAGAGAGG - Intronic
1148638372 17:49166346-49166368 GAGGGGGAGGGAGGGGAGGGAGG + Intronic
1149121776 17:53177045-53177067 GAGGTGGAGGAAATGGAGGGAGG - Intergenic
1149430509 17:56593302-56593324 CAGGAGGAGGAGAAGGGGGGTGG + Intergenic
1149461477 17:56833476-56833498 CAGGGGGCGGAAACCGCGGCCGG + Intronic
1149696990 17:58623807-58623829 GAGGGGGAGGGAAGGGGAGGGGG + Intronic
1150479409 17:65497797-65497819 CAGGGGAAGGAAAGTGGGAGAGG + Intergenic
1150519614 17:65852386-65852408 GAGGGAGAGGGAAGGGAGGGAGG - Intronic
1151383822 17:73743195-73743217 GAGGGGCAGCCAAGGGCGGGAGG - Intergenic
1151474823 17:74339504-74339526 CAGTGGGAGGGAAGGGGGCGAGG - Intronic
1151474842 17:74339563-74339585 CAGTGGGAGGGAAGGGGGCGAGG - Intronic
1151555169 17:74843002-74843024 GAGCGGGAGGAAGGGGCGGCCGG + Exonic
1151755690 17:76074329-76074351 CGGGGGGAGGAAACGCGGGGCGG - Intronic
1151887620 17:76932526-76932548 CAGGGGTGGGAAAGGGGGCGGGG - Intronic
1151952703 17:77363977-77363999 CAGGGGGAGAAAAGTGAGGAGGG + Intronic
1151983590 17:77528422-77528444 CAGGGGGAGGGAAGGTGAGGAGG - Intergenic
1152336723 17:79703122-79703144 GAGGGGGAGGAAGGGGAGGAAGG - Intergenic
1152433453 17:80261489-80261511 CTGGGGGAGTCCAGGGCGGGAGG + Intronic
1152501924 17:80717838-80717860 CAGGGGAATGCAAGGGAGGGCGG - Intronic
1152582173 17:81170985-81171007 AAGGGGGAGGCCAGGGCTGGAGG - Intergenic
1152633906 17:81422796-81422818 CCCGAGGAGGAAAAGGCGGGAGG + Intronic
1152690558 17:81715974-81715996 CAGGTGGCGGGAGGGGCGGGCGG - Intronic
1152699047 17:81810285-81810307 CAGGGAGAGGATAGGGCTGGAGG + Intronic
1152724890 17:81940302-81940324 CAAGGGGAGGGAGGGGCGTGGGG - Exonic
1152793297 17:82293380-82293402 CGGGGGGAGGGAGGGGAGGGTGG + Intergenic
1152869484 17:82744410-82744432 CAGGGGCAGGGAAGGGCACGAGG - Intronic
1152898188 17:82925599-82925621 CATGGGGAGGGAAGGGCGTGGGG - Intronic
1153836749 18:8970480-8970502 CAGGGAGGGGGAAGGGAGGGAGG + Intergenic
1154148498 18:11886685-11886707 CTGGGGGAGGAAAGGGCTCATGG - Intronic
1154194442 18:12255025-12255047 CAGGGGGGACAAGGGGCGGGTGG + Intronic
1155071774 18:22323149-22323171 CAGGAGGAGGAGAGGGCTGGGGG + Intergenic
1155352187 18:24917640-24917662 CAGGGGAGGAAGAGGGCGGGGGG + Intergenic
1156359284 18:36370043-36370065 CAGGGGTAGGGAAGGGTGAGAGG + Intronic
1156489520 18:37487956-37487978 CAGGGGGTGGAGACGGCAGGGGG - Intronic
1156900766 18:42298127-42298149 CTGGAAGAGGAAAGGGCAGGAGG + Intergenic
1157242781 18:46026777-46026799 CTGGGGGAGGATGGGGCAGGAGG + Intronic
1157608408 18:48940505-48940527 CTTGGGGAGGAAAGGGTGGGTGG + Intronic
1157610455 18:48952056-48952078 AAGGGGGAGGGAAGGGGGCGGGG - Intergenic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1158078433 18:53560061-53560083 GAGGGGGAAAAGAGGGCGGGAGG + Intergenic
1158380081 18:56920042-56920064 GAAGGGGAGAAGAGGGCGGGGGG - Intronic
1158441542 18:57479104-57479126 CAGGGGAAGGAAAGGGAGTGAGG + Exonic
1158669260 18:59460231-59460253 CAGGAGGAGAGAAGGGAGGGTGG - Intronic
1158671033 18:59473878-59473900 TAGGGGGAGGAAATAGTGGGAGG - Intronic
1158833538 18:61305528-61305550 CAGGGGGATGAAAGGATGGGAGG + Intergenic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1159931399 18:74316021-74316043 CAGGGGGAGGAAAGGGCGGGTGG - Exonic
1159963583 18:74575009-74575031 GAGGGGAAGGAAAGGAAGGGAGG + Intronic
1160256882 18:77254660-77254682 AAGGGGAAGGAAAGGGCTGGAGG - Intronic
1160371721 18:78377786-78377808 CAGGGGGAGGCCAGGGCTGTGGG + Intergenic
1160673554 19:377269-377291 CAGGGGGGGGAGAGGCTGGGTGG - Intergenic
1160730987 19:641685-641707 CAGGGCGAGGAAGGGGCCAGGGG + Intronic
1160752519 19:741224-741246 CAGGGTGAGGATGGGGCCGGGGG + Intronic
1160819773 19:1052508-1052530 GAGGGGGAGGAGAAGGGGGGAGG + Intronic
1160826305 19:1082085-1082107 CCTGGGGAGGACAGGGTGGGCGG + Intronic
1160965261 19:1744599-1744621 AAAGGGGAGGAAGGGGAGGGGGG - Intergenic
1161100392 19:2418631-2418653 GAAGGGAAGGAAAGGGAGGGAGG - Intronic
1161100472 19:2418845-2418867 GAAGGGAAGGAAAGGGAGGGAGG - Intronic
1161100528 19:2419001-2419023 GAGGGGAAGGAAAGGGAGGGAGG - Intronic
1161100536 19:2419020-2419042 GAAGGGAAGGAGAGGGCGGGAGG - Intronic
1161100554 19:2419066-2419088 GAAGGGAAGGAGAGGGCGGGAGG - Intronic
1161100576 19:2419130-2419152 GAAGGGAAGGAAAGGGAGGGAGG - Intronic
1161302822 19:3551249-3551271 CAGGGTGAGGACATGGAGGGAGG + Intronic
1161438776 19:4279211-4279233 CAGGGGGAGGGGAGGGGCGGGGG + Exonic
1161479402 19:4503172-4503194 CAGGGGGAGGAAGGGTGGAGGGG - Exonic
1161524094 19:4742897-4742919 AAGGGGGAGGAAAGGAGAGGAGG - Intergenic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161608036 19:5225528-5225550 AAGGAGGAGGCAGGGGCGGGGGG + Intronic
1161734126 19:5979934-5979956 GAAGGGAAGGAAAGGGAGGGAGG - Intergenic
1161792804 19:6370748-6370770 CAAGGGGAGCAGAGGGTGGGGGG + Intergenic
1161821643 19:6533801-6533823 CAGGGGGAGGGAAGGGGGAAGGG - Intronic
1161869981 19:6862532-6862554 GAGAGGGAGGAAAGTGGGGGTGG + Intergenic
1162080482 19:8214939-8214961 GAGGGGGAGGAGAGGGAGGAGGG + Intronic
1162153427 19:8661049-8661071 GAGGGGGAAGGAAGGGAGGGAGG - Intergenic
1162153436 19:8661068-8661090 GAGGGGGAAGGAAGGGAGGGAGG - Intergenic
1162176812 19:8836462-8836484 AAGGAGGAGGAGAGGGGGGGAGG - Intronic
1162416763 19:10543381-10543403 CAGGGGTAGGCAGGCGCGGGAGG - Intergenic
1162578527 19:11513591-11513613 TGGGGGGAGGAGAGGGAGGGAGG + Intronic
1162814839 19:13187520-13187542 GAGAGGGAGGAAAGGAAGGGAGG - Intergenic
1162898803 19:13781702-13781724 GAGGGGGAGGGAGGGGCTGGAGG + Intergenic
1162954627 19:14091085-14091107 GAGGGGGCGGGCAGGGCGGGCGG + Intergenic
1163034623 19:14563673-14563695 CAGGCGGAGGGACTGGCGGGCGG - Exonic
1163506406 19:17709698-17709720 CAGGGGGAGGACAGAGCTGCTGG - Intergenic
1163766302 19:19165249-19165271 CAGGGGGAGGCAGTGGAGGGTGG + Intronic
1163779727 19:19239988-19240010 GAGGGGGAGGAGTGGGAGGGAGG - Intronic
1163880457 19:19916306-19916328 CAGGGGGAGGCCAAGGCGGGCGG - Intronic
1164441690 19:28284445-28284467 GAGGGGGAGGAAAAGGAGGGTGG + Intergenic
1164476836 19:28582040-28582062 CTGGGGGTGGTGAGGGCGGGGGG - Intergenic
1164574165 19:29396093-29396115 CAGGGGGTGGGGAGGGAGGGAGG - Intergenic
1164582708 19:29444552-29444574 TAGGGGCAGGAGAGGGTGGGAGG - Intergenic
1164926127 19:32131433-32131455 GTGGGGGAGGAAAGGGAGGGTGG - Intergenic
1164956667 19:32392358-32392380 GAAGGGGAGGAAGGGGAGGGAGG + Intergenic
1165008397 19:32824743-32824765 CTGGAGGAAGAAAGGGCGGCGGG - Intronic
1165241518 19:34472156-34472178 CAGGGTGAGGACAGGGCACGCGG - Intergenic
1165359337 19:35325980-35326002 GAAGGGGAGGAAAAGGAGGGTGG - Intronic
1165655846 19:37531555-37531577 CAGTGGGAACAAAGGCCGGGGGG - Intronic
1165903405 19:39179148-39179170 CAGGGGCTGGAGAGGGTGGGGGG - Exonic
1166161777 19:40959448-40959470 GAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1166164439 19:40977483-40977505 CAGCAAGAGGAAAGGGCAGGAGG - Intergenic
1166186339 19:41141565-41141587 CAGCAAGAGGAAAGGGCAGGAGG + Intergenic
1166296818 19:41893686-41893708 CTGAGGGAGGAAGGGGCTGGGGG + Intronic
1166296882 19:41893841-41893863 CTGAGGGAGGAAGGGGCTGGGGG + Intronic
1166343111 19:42150414-42150436 GAGGGGGTGGAGAGGGCTGGGGG + Intronic
1166546049 19:43635474-43635496 CTGAGGGAGGAAGGGGCTGGAGG - Intronic
1166677407 19:44748462-44748484 GAGGGAGAGGAAAGGAGGGGTGG - Intronic
1166683520 19:44781843-44781865 TTGAGGGAGGAGAGGGCGGGGGG + Intronic
1166704886 19:44903251-44903273 AGGGGGGAGGGAAGGGAGGGGGG - Exonic
1166719304 19:44988250-44988272 CAGGGGGAGGACATGTGGGGAGG - Intronic
1166768517 19:45266381-45266403 CAGGAGGAGAAAAGGGCTGGAGG - Intronic
1166773404 19:45297974-45297996 CAGGGGCAGGGCGGGGCGGGGGG + Intronic
1166827868 19:45620776-45620798 CAGGGGTAAGGAAGGGAGGGAGG + Intronic
1166851941 19:45765433-45765455 CAGGGACAGGAATGGGAGGGGGG - Exonic
1166861819 19:45815705-45815727 CCGGGGAAGGAAAGGGCAGCCGG + Intronic
1166986329 19:46661627-46661649 CAGGGGGAGAAAAGGGTTAGGGG + Intergenic
1166994475 19:46713788-46713810 CTGGGGGAGGAGAGGGTAGGGGG - Intronic
1166995329 19:46717189-46717211 CCGGGGGCGGAAGGGGAGGGTGG + Intergenic
1167263145 19:48470066-48470088 CTGAGGGAAGAAAGGGCTGGGGG - Intronic
1167286115 19:48599675-48599697 CTGAGGGAGGAGAGGGCTGGGGG + Intergenic
1167312912 19:48747367-48747389 CAGTGGGAGGAGAGGACTGGGGG + Intergenic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167466171 19:49652016-49652038 CAGGGCGAGGCCGGGGCGGGCGG - Exonic
1167493888 19:49806960-49806982 CTTGGGGGGGAAAGGGAGGGAGG - Exonic
1167520654 19:49952441-49952463 CTGTGGGAGGAAGGGGCAGGAGG - Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167557759 19:50206281-50206303 CTGGGGAAGGAAAGGGCTGGGGG + Intronic
1167602901 19:50464950-50464972 CAGGGAGAGGCAGGGGCAGGTGG - Intronic
1167608009 19:50492145-50492167 CAGGGAGAGGAAGGGGAGGCAGG + Intergenic
1167622922 19:50568793-50568815 GAAGGGGAGGGGAGGGCGGGGGG + Intergenic
1167643657 19:50694948-50694970 CAGCTGGAGGACAGCGCGGGGGG + Intronic
1167696594 19:51018987-51019009 CGGTGGGAGGCACGGGCGGGAGG - Intronic
1167733874 19:51279332-51279354 CTTGGGGAGGTAAGGGTGGGTGG + Intergenic
1168058727 19:53878735-53878757 CACTGGGAGGACAAGGCGGGAGG + Intergenic
1168096949 19:54121399-54121421 GATGGGGCGGGAAGGGCGGGAGG + Intronic
1168277633 19:55286135-55286157 CTGAGGGAGGAAGGGGCTGGGGG + Intronic
1168287575 19:55342208-55342230 CAGGGGGGGCACAGGGCTGGGGG - Exonic
1168292944 19:55365896-55365918 TAGGGGGAGATAATGGCGGGGGG + Exonic
1168307553 19:55443474-55443496 GAGGGGGAGGAGAGGGAGGGAGG + Intergenic
1168353103 19:55687591-55687613 CAGGGGCAGGGAAGAGCAGGAGG + Intronic
1168389389 19:55993529-55993551 GAGGGGGAGGGGAGGGGGGGAGG - Intergenic
1168405341 19:56107665-56107687 TAGGGGCAGAAAAGGGAGGGGGG + Intronic
1168649513 19:58084743-58084765 CAGGCGGGGGCTAGGGCGGGCGG - Exonic
925005605 2:440954-440976 CAGGTGGAGCAGAGGGTGGGGGG + Intergenic
925142123 2:1557773-1557795 CCGGGGAAGGAAAGAACGGGAGG + Intergenic
925185940 2:1846489-1846511 CTGGGGGAGGGAAAGGCTGGGGG + Intronic
925186484 2:1850136-1850158 AAGGGGAAGGAAAGGGAAGGAGG - Intronic
925207044 2:2015697-2015719 CAAGGGAAGGAGGGGGCGGGAGG + Intronic
925413851 2:3656010-3656032 CGGGGGGAGGAAGAGGTGGGAGG + Intergenic
925423067 2:3727179-3727201 CAGGGGGAGGGGAGGGGAGGAGG - Intronic
925436455 2:3842426-3842448 CAGGGTGAGGAAGGGGGTGGTGG + Intronic
926001405 2:9336290-9336312 CAGGGGAGAGAAAGGGAGGGAGG - Intronic
926053771 2:9761706-9761728 CAGAGGCAGGAAAGGGAGGGCGG - Intergenic
926115893 2:10213164-10213186 GAGGGGAGGGAAAGGGAGGGAGG + Intergenic
926158209 2:10469679-10469701 GAGGGGAAGGAAAGGGCTGAGGG + Intergenic
926215101 2:10901443-10901465 CAGGGGGAGGAGAGCGGGAGGGG - Intergenic
926423324 2:12718795-12718817 CCCGGGGAGGAGAGGGCGGCGGG + Intronic
926605589 2:14895493-14895515 CTTTGGGAGGAAAAGGCGGGTGG + Intergenic
927159275 2:20242526-20242548 CCGGGTGGGGAAAGGGCGGGGGG + Intergenic
927203555 2:20593072-20593094 CAGTGGGGGGACAGGGCTGGAGG - Intronic
927484408 2:23478909-23478931 CTGGGGGAAGTAAAGGCGGGGGG - Intronic
927772201 2:25873088-25873110 CTGGGTGGGGAAAGGGTGGGAGG - Intronic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
928402264 2:30987704-30987726 GAGGGGGAGGAGGGGGAGGGAGG - Intronic
929080011 2:38113173-38113195 CATGGGTAGGAAAGGGCATGGGG - Intergenic
930136250 2:47906137-47906159 CAGCGGGGGGAGTGGGCGGGCGG + Intergenic
931038458 2:58269078-58269100 CAGTGGGGGGGTAGGGCGGGCGG - Intergenic
931253809 2:60553938-60553960 GGGTGGGAGGAAAGGGTGGGGGG + Intergenic
931473323 2:62562511-62562533 CGTGGGGAGGAAAGGCCTGGGGG - Intergenic
931844148 2:66185370-66185392 CAGGGAGAGGAAAGAGGGTGTGG + Intergenic
931995960 2:67839422-67839444 TAGGGGGAGAAAAGGGGAGGTGG - Intergenic
931999012 2:67866578-67866600 CAGGGTGAGAAAAGGGTTGGGGG + Intergenic
932090221 2:68799742-68799764 CTGGGGGAAGAAGGGCCGGGAGG + Intronic
932145074 2:69309014-69309036 CAGAGGGAGGAAAAGGCAAGTGG + Intergenic
932231868 2:70089605-70089627 CAGGGAAAGGAAAGGAAGGGAGG + Intergenic
932406396 2:71515592-71515614 CAGAAGGAGGAAAGAGCAGGAGG - Intronic
932499150 2:72166756-72166778 AAGGGGCAGGGAAGGGCAGGAGG - Intergenic
932530131 2:72521197-72521219 CAGAGGGAGGAATGGAGGGGAGG - Intronic
932624114 2:73284413-73284435 GAGGGGGAGGAGGGGGCGCGCGG + Exonic
932776000 2:74528866-74528888 CATGGAGATGAATGGGCGGGGGG - Exonic
933069323 2:77837015-77837037 GAGAGGGAGGGAAGGGAGGGAGG + Intergenic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
933280374 2:80326470-80326492 CAGGGAGAGGCAAGGGGGGCAGG - Intronic
933320587 2:80771371-80771393 GAAGGGGAGGGAAGGGAGGGAGG - Intergenic
933360889 2:81282578-81282600 GAGAGGGAAGAAAGGGAGGGAGG - Intergenic
933397258 2:81749433-81749455 CATTGGGAGGCCAGGGCGGGTGG + Intergenic
933483711 2:82891392-82891414 GAGGGAAAAGAAAGGGCGGGAGG - Intergenic
933979457 2:87538539-87538561 CAGGGGGACGAGGGGGCGGCTGG - Intergenic
935187604 2:100748143-100748165 CAGGGGGAGGAGAGGGTGCTGGG + Intergenic
935278881 2:101500755-101500777 CAGGGGGAGGATTGGGAGGGAGG - Intergenic
935339202 2:102044841-102044863 CAGGGGGAAGAGTGGGAGGGTGG + Intergenic
935496731 2:103791595-103791617 CAGGGGGTGGAAAGAGGGGATGG + Intergenic
935706509 2:105861946-105861968 CAGGTGGAAGAAAGGGAAGGGGG - Intronic
936314366 2:111412252-111412274 CAGGGGGACGAGGGGGCGGCTGG + Intergenic
936972038 2:118185567-118185589 AGGGGGGAGGAGGGGGCGGGGGG + Intergenic
937271221 2:120654358-120654380 CAGGGCTAGGACCGGGCGGGAGG - Intergenic
937454778 2:122031832-122031854 GTGGATGAGGAAAGGGCGGGGGG + Intergenic
937916364 2:127100983-127101005 CAAGGGTAGGAATGTGCGGGGGG + Intronic
937973721 2:127568391-127568413 CTGGGGGAGGAAAGGGCAGGAGG - Intronic
938339005 2:130523071-130523093 CCGGGGGAGGGATGCGCGGGTGG + Intronic
938350833 2:130597679-130597701 CCGGGGGAGGGATGCGCGGGTGG - Intronic
938548060 2:132353021-132353043 CAGGTGGAGGAGTGGGCGAGAGG + Intergenic
938644759 2:133319152-133319174 CAGGGGGTGGAAGGGGGCGGGGG - Intronic
939804434 2:146754827-146754849 CGGGGGGAGTTAAGGGTGGGAGG + Intergenic
940214378 2:151289509-151289531 CCGGGGGTGGAAAGGGAGGTGGG - Intronic
941809207 2:169738935-169738957 GAGGGGGAGGAGAGGGAAGGAGG - Intronic
941809214 2:169738953-169738975 AAGGGGGAGGAGAGGGAGGAGGG - Intronic
942043356 2:172085198-172085220 CCTGGGGAGGAAAGCGCGCGAGG + Intronic
942045473 2:172097068-172097090 GAGGGGGCGGAAAGGGGGAGGGG - Intergenic
942135991 2:172925971-172925993 CAGAGGGAGGGAAGGGAGGAAGG + Intronic
942211773 2:173678299-173678321 AAGGAGGAGGAGAGGGAGGGAGG + Intergenic
942312714 2:174670291-174670313 CAGGGAGAGGAAAAGGGAGGAGG - Intronic
942461044 2:176169252-176169274 CAGGGGGTGGGTAGGGCTGGTGG - Exonic
942567732 2:177283153-177283175 CAGGGTGAGGAAAGGGGAGTAGG + Intronic
942776483 2:179588329-179588351 AAGGGGGAGGACGAGGCGGGCGG - Intronic
942787863 2:179720544-179720566 CAAGGGGAGGAGAGGGAGGGAGG + Intronic
942947529 2:181685598-181685620 AAGGAGGAGGAAGGGGAGGGAGG - Intergenic
943082816 2:183276902-183276924 AAGGGGGTGGTAAGGGAGGGAGG - Intergenic
943771356 2:191721278-191721300 CTGGGGGAGGTAGGGGTGGGTGG - Intergenic
943890250 2:193277263-193277285 GAGGAGGAGGAAGGGGAGGGGGG - Intergenic
944197649 2:197072125-197072147 TAGGGGGAGGAAAGGAGGGTGGG + Intronic
944715739 2:202375268-202375290 CAGCGGGGTGTAAGGGCGGGAGG + Intergenic
944782966 2:203039309-203039331 GAGGGGGAGGGGAGGGGGGGAGG - Intronic
944863536 2:203838724-203838746 CAGGAGAGGGAAAGGGCCGGTGG + Intergenic
945057455 2:205881176-205881198 GGGAGGGAGGAAAGGGAGGGAGG + Intergenic
945057494 2:205881277-205881299 GAGAGGGAGGGAAGGGAGGGAGG + Intergenic
945198219 2:207257051-207257073 CCGAGGGTGGGAAGGGCGGGAGG + Intergenic
945918121 2:215726151-215726173 CAGGGAGAGGGGAGGGAGGGAGG + Intergenic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
946039427 2:216771105-216771127 CAGGTGGATGAAAGGATGGGTGG - Intergenic
946310531 2:218880491-218880513 TGGGGGGAGGAAAGGGAAGGCGG + Exonic
946355368 2:219181225-219181247 CAGGAGGGTGAAAGAGCGGGAGG + Intronic
946426723 2:219602416-219602438 CATAGGGAGGAAGGGGAGGGTGG + Intronic
946553022 2:220823657-220823679 GGGAGGGAGGAAAGGGAGGGAGG - Intergenic
946836036 2:223773597-223773619 AAGGGGGAAAAAAGGGAGGGAGG + Intronic
947079772 2:226383141-226383163 GAGGTGGAGGAAAGGGTGAGAGG + Intergenic
947641059 2:231708123-231708145 GAGGGGGAGGGAAGAGGGGGCGG - Intronic
947701420 2:232237718-232237740 CAGGTGGAGGAAATGGTGGGAGG + Intronic
947960899 2:234236355-234236377 GATGGGGTGGAAAGGGAGGGAGG - Intergenic
948185117 2:236014897-236014919 CAGGTGGAGGTGTGGGCGGGTGG - Intronic
948207509 2:236170004-236170026 GAGGAGGAGGAGAGGGCTGGCGG - Intergenic
948229210 2:236337340-236337362 CAGGAGGAGGGAAGGACGGGTGG - Intronic
948257001 2:236575983-236576005 CAGGGGGAAGGAAGGGGAGGGGG - Intronic
948348916 2:237322439-237322461 CAGGAGGTGGAAAGGGAGAGAGG + Intergenic
948463332 2:238140591-238140613 CAAGGGGTGGAAAGGGCTGATGG + Intronic
948518764 2:238522675-238522697 CAGAGGGAGGAATGGGCGTCAGG - Intergenic
948924821 2:241088709-241088731 CAGTGGGAGGAAGAGGCAGGGGG + Exonic
1169081596 20:2800648-2800670 GGGGGGCAGGAAGGGGCGGGGGG - Intergenic
1169217889 20:3803974-3803996 CAGGAGGAGGCAGGGGTGGGAGG - Intronic
1169265792 20:4166723-4166745 CACTGGGAGGCAAGAGCGGGAGG - Intronic
1169810690 20:9606227-9606249 CAGGAGGAAGAGAGGGCGGCAGG - Intronic
1170842560 20:19935796-19935818 AAGGGGGTGCAAAGGTCGGGGGG + Intronic
1170894732 20:20402995-20403017 GAGGGGCAGGAAAGAGCAGGTGG - Intronic
1171012272 20:21515141-21515163 CGGGTGGAGGAAAGGGCAGACGG + Intergenic
1171249689 20:23638218-23638240 AAGGGAGAGGAGAGGCCGGGAGG - Intronic
1171782028 20:29427954-29427976 CAGGGGCAGGGCAGGGGGGGAGG - Intergenic
1171869393 20:30513418-30513440 GAGGGGGAGGACAGGGAGAGAGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172325245 20:34029467-34029489 GGGAGGGAGGAAAGGGAGGGAGG + Intronic
1172788571 20:37486755-37486777 CATGGGGATGGAAGGGCTGGAGG + Intergenic
1172937394 20:38630028-38630050 GAGGAGGAGGGAAGGGAGGGAGG - Intronic
1173142206 20:40494337-40494359 CAGAGGAATGAAAGGGAGGGAGG - Intergenic
1173167524 20:40696102-40696124 CAGGGAGAGGAGGGGGCTGGAGG - Intergenic
1173189349 20:40864319-40864341 CAGGGAGAGGAAAAGTAGGGTGG + Intergenic
1173249008 20:41354766-41354788 CAGGGCCAGCACAGGGCGGGAGG + Intronic
1173305193 20:41841225-41841247 CAGAGGGAGGGAAGGACGGAGGG - Intergenic
1173328885 20:42057820-42057842 CAGGGGGAGGCCAAGGTGGGAGG - Intergenic
1173461094 20:43243959-43243981 CAAGTGGAGGAAAGTGCGGCTGG - Intergenic
1173485412 20:43437471-43437493 GAGGGGAGGGAAAGGGTGGGGGG + Intergenic
1173678873 20:44862001-44862023 GAGGGGGAGGAAAGGAGGGGGGG + Intergenic
1173705158 20:45104799-45104821 CAGGGTAAAGAAAGGGCAGGAGG - Intergenic
1173841090 20:46157737-46157759 CAGGGGGAGGAAGAGGCAGTGGG + Intergenic
1173860861 20:46282749-46282771 CCGGGGGAGGGAAGGGTGGGTGG + Intronic
1174419520 20:50390577-50390599 CAGGAGGAGGCAGGGGTGGGAGG - Intergenic
1174423392 20:50415537-50415559 CAGGGGAAGGGAAAGGCGAGTGG + Intergenic
1174532004 20:51221731-51221753 CAGAGGGAGCAAGGGGTGGGAGG + Intergenic
1174590051 20:51637852-51637874 CAGGGGGCTGAAAGGGTGGGAGG - Intronic
1175143654 20:56879738-56879760 CAGTGGGAGGCCAAGGCGGGTGG + Intergenic
1175391186 20:58628456-58628478 CAGTGGGAGGCAAGCGGGGGAGG - Intergenic
1175854260 20:62111918-62111940 CTGGGGGAGGTGAGGGTGGGAGG + Intergenic
1176052978 20:63130309-63130331 CGGGGGGAGGAGAGGAGGGGAGG - Intergenic
1176109296 20:63404249-63404271 TCGGGGGAGGAAAGAGCAGGTGG + Intergenic
1176109330 20:63404351-63404373 GGGGGGGAGGAAAGAGCAGGTGG + Intergenic
1176109341 20:63404384-63404406 GTGGGGGAGGAAAGAGCAGGCGG + Intergenic
1176109353 20:63404418-63404440 GCGGGGGAGGAAAGAGCAGGCGG + Intergenic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1176125545 20:63473007-63473029 GAGGGGGAGGGGAGGGCAGGGGG + Intergenic
1176142071 20:63549188-63549210 TGGGGGGAGGAGAGGGCGGCGGG - Intronic
1176156948 20:63626827-63626849 CGGGGGGAGGGGAGGGCCGGGGG - Intronic
1176169069 20:63688995-63689017 ATGGGGGAGGAAGGGGCTGGGGG + Intronic
1176172100 20:63700703-63700725 CTGGGGGAGGTAAGGCCGTGAGG + Intronic
1176604689 21:8819672-8819694 CAGGTGGAGGAGTGGTCGGGAGG + Intergenic
1177114887 21:17073384-17073406 GAGGGGGAGGGAAGGGGGAGGGG + Intergenic
1177171788 21:17663066-17663088 TAGGGAGATGAAAGGGAGGGAGG + Intergenic
1177855927 21:26400055-26400077 CAGGAGGAAGCAGGGGCGGGGGG - Intergenic
1178426514 21:32483158-32483180 CAGGGGTAGGAATGGCAGGGAGG - Intronic
1178514069 21:33230765-33230787 CAGGAGGGGGAAGGGGCGAGGGG + Intronic
1178544173 21:33479634-33479656 CAGGGGCAAGAAGGGGCGGCGGG + Intronic
1179030971 21:37719111-37719133 CAGGAGGAGGAGAGGGTGTGGGG + Intronic
1179074547 21:38107593-38107615 CAGGGGGTGGGAAGCGCAGGGGG - Intronic
1179133723 21:38661169-38661191 CAGGGGAGGGAAAGTGTGGGAGG + Intronic
1179273486 21:39869555-39869577 GAGGGGGAGAAGAGGGCAGGAGG - Intronic
1179521214 21:41946471-41946493 GAGGGGGAGAAAGAGGCGGGAGG - Intronic
1179609459 21:42540448-42540470 CAGAGGGATGCAAGGGCGGAAGG + Intronic
1179626771 21:42653545-42653567 GAGGGGGAGGGGCGGGCGGGCGG + Intergenic
1179674823 21:42974410-42974432 CTGGGGGAGGAGAGCGAGGGCGG - Intergenic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1179983019 21:44906165-44906187 GAAGGGGAGGGAAGGGAGGGAGG - Intronic
1180051276 21:45332031-45332053 CAGGGGGAGGGCAGGGGGAGGGG + Intergenic
1180153745 21:45966981-45967003 GAGGGGGAGGGAAGGGGGAGGGG - Intergenic
1180186890 21:46144632-46144654 GAGGGGGAGGAGAGGGAGAGGGG - Intronic
1180239314 21:46489655-46489677 CAGGGAGTGGTAAGGGCTGGAGG + Intronic
1180346979 22:11711277-11711299 CAGGTGGAGGAGTGGTCGGGAGG + Intergenic
1180354725 22:11829367-11829389 CAGGTGGAGGAGTGGTCGGGAGG + Intergenic
1180383527 22:12162965-12162987 CAGGTGGAGGAGTGGTCGGGAGG - Intergenic
1180491631 22:15854092-15854114 AGGGGGGAGGGAAGGGAGGGGGG + Intergenic
1180712151 22:17846686-17846708 CATGTGGAGTAGAGGGCGGGAGG - Intronic
1180802197 22:18637146-18637168 CTGTGGGAGGATAGGGCGGTGGG - Intergenic
1180843938 22:18971356-18971378 CAGTGGGGGGCAAGGGAGGGTGG + Intergenic
1180875044 22:19171283-19171305 CAGGGGAAAGGAGGGGCGGGAGG + Intergenic
1181038938 22:20182893-20182915 CAAGGGGAGGCAGGGGTGGGAGG + Intergenic
1181438038 22:22921664-22921686 ATGGGGGAGGAAATGGCAGGAGG + Intergenic
1181539591 22:23566268-23566290 CTGGGAGAGGAGAGGGCAGGGGG + Intergenic
1181748169 22:24970328-24970350 CAGAGAGAGGAAAGGGCTGGGGG + Intronic
1182267765 22:29132113-29132135 CTTTGGGAGGAAAAGGCGGGTGG - Intronic
1182293422 22:29299309-29299331 CCGGGGGCGGAAAGGGTGGCGGG - Exonic
1182589155 22:31365494-31365516 GAAAGGGAGGAAAGGGAGGGAGG + Intergenic
1182738301 22:32546920-32546942 AAAGGGGAGAAAAGGGAGGGAGG - Intronic
1183177577 22:36235730-36235752 CGGGAGGAAGAAAGGGTGGGTGG + Intronic
1183279031 22:36922429-36922451 CAGGAGGAGGGAAGCGGGGGAGG - Intronic
1183368154 22:37417959-37417981 GAAGGGGAGGAGAGGGAGGGGGG + Intronic
1183379303 22:37482994-37483016 CAGGGAGAGGCTAGGGCTGGTGG - Intronic
1183414262 22:37673582-37673604 CTGGTGGAGGAAGGGGCGTGGGG - Intergenic
1183505933 22:38208873-38208895 CAGAGGCAAGAAAGCGCGGGTGG + Intronic
1183744260 22:39684329-39684351 CATGGGCAGGAGAGGGCTGGAGG - Exonic
1184299036 22:43544077-43544099 CAGGGGGAGGCTGGGGAGGGAGG - Intronic
1184458772 22:44625671-44625693 CAGGGAGATGAAAGGGATGGGGG + Intergenic
1184500062 22:44865960-44865982 CAGGGGGAGGACAGGGGCGTAGG + Intergenic
1184525802 22:45021646-45021668 CGGGGGGAGGAAAGCACGCGGGG - Intergenic
1184693593 22:46128236-46128258 CAGGAGGAGGATGGGGCTGGGGG - Intergenic
1184765294 22:46569130-46569152 CAGGGAGAGGAAAGTGGGCGGGG + Intergenic
1184811131 22:46832904-46832926 CAGGGACAGGGAAGGGCGGATGG + Intronic
1185101049 22:48841013-48841035 CACGGGGAGGCCAGGGCAGGAGG - Intronic
1185150234 22:49160028-49160050 CACGTGGGGGAAAGGGCTGGAGG + Intergenic
1185347479 22:50316920-50316942 GGGGGCGAGGACAGGGCGGGGGG + Intronic
1185350311 22:50332863-50332885 CATGGGGAGGCAGAGGCGGGTGG - Intergenic
1185381281 22:50508437-50508459 CTGGAGGAGGTAAGGGCGGCGGG + Exonic
1185402845 22:50627498-50627520 CATTGGGAGGAAAGGGATGGAGG + Intronic
949787953 3:7762249-7762271 CAGCAGAAGGAAAGGGCGTGGGG - Intergenic
949914162 3:8944545-8944567 GAAGGGAAGGAAAGGGAGGGAGG + Intronic
950044451 3:9940728-9940750 GAGGGGGAGGGGAGGGGGGGAGG + Intronic
950119395 3:10471559-10471581 GAGTGGGAGGAGAGGGAGGGAGG + Intronic
950342542 3:12260191-12260213 CTGGGGGAGGCAAGGAGGGGAGG + Intergenic
950478882 3:13232497-13232519 CAGGGAGAAGAAAGGCGGGGAGG + Intergenic
950602973 3:14051560-14051582 CAGGGTGATGGAAGGGAGGGGGG - Intronic
950921351 3:16697846-16697868 CAGGGGGAAGAAAAGGAGGCAGG + Intergenic
951085052 3:18502584-18502606 CAGGGGGAGGAATGGGAGGTAGG - Intergenic
951543559 3:23805826-23805848 CAGGGGGAGGGGAGCGCGGGTGG + Intergenic
951800282 3:26588216-26588238 CAGAGGGAGGAAAGGGCTGAGGG - Intergenic
952867077 3:37861682-37861704 CAGGGTGAGTGGAGGGCGGGAGG - Intergenic
952949917 3:38514755-38514777 CAGGGGGAGGGGGGGGAGGGTGG - Intronic
953056575 3:39392251-39392273 CGGGGTGAGGATAGGGTGGGTGG + Intronic
953288099 3:41632933-41632955 CAGGTGGAGGAAAGTGCATGAGG + Intronic
953343977 3:42159987-42160009 CTGGGGGAGGAAAGGTGGAGAGG + Intronic
953980982 3:47412907-47412929 AGTGGGGAGGAAAGGGGGGGCGG - Exonic
954061863 3:48074609-48074631 CAGGGTGAGGATAAGGTGGGAGG - Intronic
954248633 3:49351390-49351412 CTTTGGGAGGAAAAGGCGGGTGG - Intergenic
954432955 3:50480926-50480948 AAGGGGGAGGAAGGGGGAGGAGG + Intronic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
955769497 3:62373622-62373644 CGGTGGAAGGAAAGGGGGGGGGG + Intronic
956126384 3:66014845-66014867 CAGTGGGAGCAAAGGCCTGGAGG - Intronic
956212364 3:66814940-66814962 CAGGGAGAGAAAAGGGCTGAAGG - Intergenic
956732889 3:72213237-72213259 CAGGAGGAAGAGAGGGAGGGAGG + Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
956873820 3:73442974-73442996 AAGGAGGAAGAAAGGGAGGGAGG - Intronic
958603050 3:96323635-96323657 GAGGAGGAGGAGAAGGCGGGGGG + Intergenic
958802904 3:98777139-98777161 CAGGAGGAGGAAAGGGCGAAGGG + Intronic
959783684 3:110267452-110267474 AAGGGGGAGGCAAGGCCAGGCGG - Intergenic
960047514 3:113212076-113212098 CGGGGAGAGGAGGGGGCGGGAGG + Intronic
960150518 3:114244566-114244588 CAGGGGAAAGAAAGAGCGAGAGG - Intergenic
960180393 3:114568958-114568980 CAGGGGAAGGCAAGGCCAGGTGG - Intronic
960592394 3:119378665-119378687 CCGGGGGAGGGAAGGGCTGAGGG - Intronic
960736281 3:120784637-120784659 TAGGGGGAGTAAAGGACAGGTGG - Intergenic
961366229 3:126401691-126401713 GAGGGGGAGGAGATGGAGGGAGG + Intronic
961553503 3:127682006-127682028 CTGGGGGAGGAAAGGAAGGCTGG + Intergenic
961705659 3:128783236-128783258 CAGGAGGAGGATAGAGCAGGTGG - Intronic
962072198 3:132044668-132044690 GAGGGGGAGGGAGGGGAGGGAGG + Intronic
962194689 3:133351371-133351393 CAGGGAGAGGAAGGAGCCGGTGG - Intronic
962239821 3:133743025-133743047 GTGGGGGAGGAAAGAGAGGGAGG - Intergenic
962302971 3:134259586-134259608 CAAGGGGAGGAAAAGGAGAGTGG - Intergenic
962316696 3:134363820-134363842 CTGGGGGAGGAAGGGGCCGGAGG + Intronic
962367649 3:134796627-134796649 GAGGCGGGGGAAGGGGCGGGAGG - Intronic
962520871 3:136196351-136196373 AAGGGAGAGGAAAGGGGGGAGGG - Intronic
962936016 3:140081600-140081622 CAGGTGGGGGTAAGGGTGGGAGG - Intronic
962987590 3:140549712-140549734 CATGAGGAGTAAAGGGAGGGAGG - Intronic
962987753 3:140551167-140551189 CATGAGGAGTAAAGGGAGGGAGG - Intronic
963044816 3:141094774-141094796 CAGGGGGGCAAAGGGGCGGGGGG - Intronic
963234945 3:142947316-142947338 CAGGAGGAGGAAGGGGCAGGCGG + Intergenic
963652926 3:148006928-148006950 GAGGAGGAGGAGAGGGAGGGAGG - Intergenic
964245846 3:154652402-154652424 CAGGGGGAGGGAAGGTCTGTAGG + Intergenic
965138128 3:164801048-164801070 CATTGGGAGGCCAGGGCGGGCGG - Intergenic
965634894 3:170770886-170770908 GAGGGGCAGGAAAGGGAGGGTGG + Intronic
966210894 3:177452415-177452437 GAGGGGAAAGAAAGGGAGGGAGG - Intergenic
966230077 3:177642104-177642126 CAGGTGAACGACAGGGCGGGAGG + Intergenic
966869164 3:184278715-184278737 AAAGGGGAAGAAAGGGAGGGAGG - Intronic
967277387 3:187789928-187789950 GAGGGGGAGGGAGGGGAGGGAGG + Intergenic
967627077 3:191699505-191699527 AAGAGGGAGGAAAGGGAGGGAGG + Intergenic
967858187 3:194134096-194134118 CAGGCGGCGGGAAGGGCGGAGGG + Intergenic
967862687 3:194163923-194163945 CAGGAGGAGGAAAGGGAGGAGGG - Intergenic
967922809 3:194625344-194625366 CAGAGGGAGGGAAGGGCTGCTGG - Intronic
968137113 3:196227627-196227649 CAGGAGCAGGTGAGGGCGGGAGG - Intronic
968155158 3:196374884-196374906 GAGGGGGAGGGGAGGGGGGGAGG + Intronic
968564543 4:1304080-1304102 CAGGGGGAGGAGGGTGCGTGGGG - Intronic
968648210 4:1750175-1750197 CAGAGAGAGGAGGGGGCGGGGGG + Intergenic
968693447 4:2008555-2008577 CAGGGGGAGGTGAGGACTGGAGG + Intronic
968799252 4:2731555-2731577 CGGGAGGAGGAATGGGTGGGCGG - Intronic
968862541 4:3184322-3184344 CATGGGGAGGGAAGGGAGTGAGG + Intronic
968921375 4:3523904-3523926 CAGGAGGAGGAAACGGAGGTGGG + Intronic
968954835 4:3712967-3712989 GAGGGGGAGGAGTGGGCGGCTGG - Intergenic
968991648 4:3917357-3917379 GAGGGGGGAGAAAGGGAGGGAGG + Intergenic
969196809 4:5569640-5569662 CAGGGGCAGGCAGGGGTGGGAGG + Intronic
969239290 4:5888503-5888525 GAGGGAGAGGCGAGGGCGGGAGG + Intronic
969616501 4:8255957-8255979 CAGGGGGAGGACAGGGAGGCAGG - Intergenic
971273642 4:25174707-25174729 CAGGAGGAGGAAAGTGTAGGAGG + Intronic
971570934 4:28209983-28210005 GAGGGGGAGGAAGGGGAGGAAGG - Intergenic
972095524 4:35342952-35342974 CTGGGGGAGAAAAGGCAGGGTGG - Intergenic
972129640 4:35816151-35816173 CTGGGGGAGGGAGCGGCGGGGGG - Intergenic
972723160 4:41721024-41721046 CAGGGGGAGGGAAGGCAGGAGGG + Intergenic
973373436 4:49271265-49271287 CAGGTGGAGGAGTGGTCGGGAGG - Intergenic
973387576 4:49523943-49523965 CAGGTGGAGGAGTGGTCGGGAGG + Intergenic
973646572 4:52956428-52956450 CAGGCTGAGGGAAGGGCAGGTGG + Intronic
973649680 4:52986167-52986189 CAGAGGGAAGAAAGGTGGGGAGG - Intronic
974196738 4:58585165-58585187 CTGGGGGAAGAAATGGCTGGGGG - Intergenic
974302696 4:60089259-60089281 CAGGGTGAGAACAGTGCGGGAGG - Intergenic
974444749 4:61965240-61965262 CTTTGGGAGGAAATGGCGGGGGG - Intronic
974746887 4:66088642-66088664 CAGGGGGAGAGAAGGCAGGGTGG + Intergenic
975139089 4:70902294-70902316 GAGGGGAAGGAAAGGGAGGCGGG - Intergenic
975977988 4:80121022-80121044 CTTTGGGAGGAAGGGGCGGGTGG + Intronic
976675248 4:87695435-87695457 GAGGGGGATGGAAGGGAGGGAGG + Intergenic
976695819 4:87918775-87918797 AAGGGGAGGGAAAGGGAGGGAGG + Intergenic
976828269 4:89284197-89284219 CAGGTGAAGGAATGGGTGGGTGG + Intronic
977206921 4:94173573-94173595 GAGAGGGAGGAAAGGTTGGGAGG + Intergenic
977691017 4:99911027-99911049 CAGGGGTTGGGAAGGGAGGGAGG - Intronic
977993452 4:103473798-103473820 TAGGGGAAGGAAAGGGAGGTGGG - Intergenic
978885432 4:113761803-113761825 CAGGCGGAGGGAGCGGCGGGAGG - Intronic
980796013 4:137684069-137684091 CTGTGGGAGGCTAGGGCGGGCGG - Intergenic
980940344 4:139268132-139268154 AAGGGGGAAGGAAGGGAGGGTGG + Intronic
981586688 4:146310950-146310972 CAGGGGGAGGATGGGGGGAGGGG + Intronic
981759547 4:148178665-148178687 CTGGGTGAGGAAAGGGCAAGGGG + Intronic
981990064 4:150907350-150907372 AAGGGGGAGGGAAGGAAGGGAGG + Intronic
982289004 4:153760976-153760998 CTTTGGGAGGACAGGGCGGGCGG + Intergenic
984529713 4:180901654-180901676 CAGGAGGAAGAGAGAGCGGGGGG + Intergenic
984965677 4:185137744-185137766 CAGGGGAAGAAACGGCCGGGCGG - Intergenic
985117444 4:186605571-186605593 AGGGGGGAGGAATGGGAGGGAGG + Intronic
985297399 4:188449857-188449879 CAGGGGGAAGAAAGCGCAGGTGG - Intergenic
985720018 5:1484055-1484077 CAGGGGCAGGTGAGGGCGGCGGG - Intronic
986313611 5:6571827-6571849 AAGGAGGAAGAAAGGGAGGGAGG + Intergenic
986671771 5:10148897-10148919 CATCAGGAGGAAAGGGGGGGAGG + Intergenic
990407272 5:55503901-55503923 AGGGGGGAGGAAGGGGGGGGAGG + Intronic
991738000 5:69644500-69644522 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991760194 5:69911924-69911946 CCGGGGCAGGAAATGGAGGGAGG + Intergenic
991787138 5:70206176-70206198 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991789576 5:70224226-70224248 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991814325 5:70499336-70499358 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991817460 5:70520628-70520650 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991839425 5:70786975-70786997 CCGGGGCAGGAAATGGAGGGAGG + Intergenic
991879584 5:71206566-71206588 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991882024 5:71224595-71224617 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
992150180 5:73895005-73895027 CAGGCTGAGGGAAGGGAGGGTGG + Intronic
992269802 5:75053112-75053134 CAGCGGGGGGAAAGGGCAGCGGG - Intergenic
992295589 5:75323466-75323488 CAGGGGGAGGCCAAGGTGGGAGG + Intergenic
992655248 5:78902753-78902775 CAGAGGGAGGAAAGGGAGTTGGG + Intronic
992994458 5:82318661-82318683 GAGGAGGAGGAAAGGGAGGGAGG + Exonic
993060792 5:83036452-83036474 CGGGGGCAGGAAGGGGCGGGAGG + Intergenic
993744559 5:91580886-91580908 CAGAGGGAGAAAATGGCAGGAGG + Intergenic
994135989 5:96287240-96287262 CAGTGGAAGGAAAGGGGAGGGGG - Intergenic
994185055 5:96807643-96807665 CAGGGCGCGGGAAGGGCGGGGGG - Intronic
995308729 5:110687101-110687123 CAGGGGGAAGAAAGGTCAGAAGG - Intronic
995674332 5:114645049-114645071 GAGGGGGAGGTTAGGGTGGGAGG + Intergenic
996022230 5:118604061-118604083 TAGGCGGAGGAAAGGAGGGGAGG - Intergenic
996245915 5:121263630-121263652 CAGTTGGAGGAGAGTGCGGGTGG + Intergenic
996508530 5:124293667-124293689 CTTGGGGAGGACAAGGCGGGTGG + Intergenic
996591999 5:125158567-125158589 AAGGGGAAGGAAAGGAAGGGAGG - Intergenic
996872922 5:128212122-128212144 CAGGGGAAGGAAAGAACGTGTGG + Intergenic
997180108 5:131819452-131819474 CAGGGGGAGGGAGGGGGAGGGGG + Intronic
997225762 5:132208406-132208428 GAGGGGGAGGGGAGGGGGGGAGG + Intronic
997419594 5:133755501-133755523 CAGGGGGAGGAGAGGATGTGAGG - Intergenic
997476306 5:134144547-134144569 CAGTGGGAAGAATGGGAGGGAGG - Intronic
998092803 5:139380909-139380931 CAGGGGTGGGGAGGGGCGGGTGG + Intronic
998130449 5:139648909-139648931 CCGGGGGAGGAGAGGGAGGTAGG - Intronic
998352202 5:141508954-141508976 CAGCGGAATGAAAGGGCTGGGGG + Intronic
998446258 5:142200641-142200663 CATGGGGAGGAGAGGCCTGGCGG + Intergenic
998703526 5:144732463-144732485 CGGGGGGGGGGAAGGGGGGGTGG - Intergenic
998794199 5:145800275-145800297 GAAGGGGAGGAAAGGGAAGGGGG - Intronic
999030383 5:148284109-148284131 GAGAGGAAGGAAAGGGAGGGAGG - Intronic
999076859 5:148804518-148804540 CAGGGGGAGGAGGGGTCGAGGGG + Intergenic
999249545 5:150174130-150174152 TAGGGGTAGGAAGGGGCTGGAGG + Intronic
999311355 5:150554020-150554042 CAGGGGGAAGAAAGGGGTGCAGG - Exonic
999454020 5:151699731-151699753 CATGGGGAGGCCAAGGCGGGTGG + Intergenic
999490678 5:152047477-152047499 GATGTGGAGGAAAGGGTGGGTGG - Intergenic
999734745 5:154504582-154504604 CAGGGGTAGGGATGGGTGGGGGG + Intergenic
1000045432 5:157518310-157518332 GTGGGGGAGGAAGGGGCGGGGGG + Intronic
1001255498 5:170180053-170180075 CTGGGGGTTGAAAGGGCAGGTGG + Intergenic
1001505551 5:172276735-172276757 AAGGGGGAGAGAAGGGAGGGAGG + Intronic
1001625884 5:173132490-173132512 GAGGGGGAGGAAAGAGGGAGGGG - Intronic
1001625894 5:173132512-173132534 GAGGGGGAGGAAAGAGGGAGGGG - Intronic
1001625904 5:173132534-173132556 GAGGGGGAGGAAAGAGGGAGGGG - Intronic
1001679288 5:173544343-173544365 CTGGGGGATGGAAGGGCAGGTGG + Intergenic
1001980798 5:176035905-176035927 CAGGGGTAGGGAGGGGCTGGTGG - Intergenic
1002161334 5:177315463-177315485 AAGGGGTAGGGAAGGGCTGGTGG + Intergenic
1002196605 5:177504712-177504734 CAGGGGTGGGAAAGGGTGAGGGG - Intronic
1002621992 5:180494522-180494544 CCGGGGGCCGAGAGGGCGGGAGG + Intronic
1002645161 5:180649298-180649320 CGGGATGAGGAAGGGGCGGGCGG - Intronic
1002891337 6:1335384-1335406 CAAGGAGAGGAAAGGGAGGGCGG - Intergenic
1002990144 6:2230944-2230966 TAGGGGAAGGAACGGGGGGGGGG - Intronic
1003102106 6:3184594-3184616 AAGAAGGAGGAAAGGGCTGGGGG + Intergenic
1003153135 6:3569916-3569938 CAGGGAGGGGAGAGGGAGGGAGG - Intergenic
1003153191 6:3570090-3570112 GAGGGAGAGGAGAGGGAGGGAGG - Intergenic
1004109726 6:12705122-12705144 AAGGAGGAGAAAAGGGAGGGAGG + Intergenic
1004418227 6:15444774-15444796 AAGGGCAAGGAAAGGGTGGGAGG - Intronic
1004904209 6:20221245-20221267 CGGGAGGAGAATAGGGCGGGAGG - Intergenic
1005006909 6:21296606-21296628 ACGCGGGAGGAAAGGGCTGGGGG + Intergenic
1005608548 6:27500387-27500409 CAGAGGGAGGGAAGGAAGGGAGG + Intergenic
1005677760 6:28173197-28173219 CATTGGGAGGACAGGGCAGGAGG + Intergenic
1006189823 6:32201044-32201066 CAGAGGGAGGAAAGGGAGCCAGG - Intronic
1006218273 6:32465075-32465097 CAGGGTGAGGCCAGGGCTGGAGG - Intergenic
1006303753 6:33207336-33207358 GAGGAGGAGGAAGGGGAGGGGGG + Intergenic
1006317489 6:33298995-33299017 GGGGGAGCGGAAAGGGCGGGAGG - Exonic
1006333976 6:33411003-33411025 CAGGAGGAGGAGGCGGCGGGGGG - Exonic
1006452399 6:34112726-34112748 CAGGCAGGGGATAGGGCGGGGGG - Intronic
1006479776 6:34282671-34282693 TGGGGGCAGGAAAGGGAGGGTGG + Exonic
1006981949 6:38154268-38154290 CAGGCAGAGGAGGGGGCGGGGGG - Exonic
1007273498 6:40656465-40656487 TAGGGGCAGGAAAGGGGGTGTGG - Intergenic
1007293568 6:40804755-40804777 CAGGGTGAGGAAGGGACAGGAGG - Intergenic
1007673367 6:43575490-43575512 AAGGGGGAGGAGAGGGCTGTGGG + Intronic
1007703467 6:43777689-43777711 CAAGGGGGGGATAGGGAGGGGGG + Intronic
1007720848 6:43884755-43884777 CAGGGGCAGGCAGGGGAGGGAGG - Intergenic
1008863238 6:56176912-56176934 AAGGGGGAGGAAGGGGGAGGAGG + Intronic
1009828355 6:68897456-68897478 GGGAGGGAGGAAAGGGAGGGAGG + Intronic
1010101365 6:72112142-72112164 CAGGGGGAGGAAAGGCCAGGAGG - Intronic
1010243683 6:73642280-73642302 GAGGGGGAGGCAGGGCCGGGGGG - Intronic
1010940760 6:81915163-81915185 CAGTGGGGGGAAGGGGGGGGGGG - Intergenic
1011074429 6:83423162-83423184 CAGGAAAAAGAAAGGGCGGGAGG + Intronic
1012183851 6:96189217-96189239 CAGGGAGAGGTGAGGGCTGGTGG + Intronic
1012223699 6:96681315-96681337 CAGCAGGAGGAAAGGGCAGTAGG + Intergenic
1012398059 6:98822516-98822538 AAGAGTGAGGAAAGGGCTGGAGG + Intergenic
1012444470 6:99293937-99293959 CAGGAGGGGGAAATGGCTGGAGG + Intronic
1012807037 6:103908098-103908120 AAAGGGGAGGAAAGAGTGGGAGG - Intergenic
1013272886 6:108559721-108559743 CAGGGGGAGGGCTGGGCGGCGGG - Intergenic
1013490837 6:110644797-110644819 CAGGGGGAGGGGAGGCAGGGGGG + Intronic
1013576015 6:111483726-111483748 TCGCGGGAGGGAAGGGCGGGCGG + Intergenic
1014191189 6:118498644-118498666 GAAAGGGAGGAAAGGGAGGGAGG + Intronic
1015113391 6:129619345-129619367 CAGGGGGAGGGAAAAGGGGGAGG + Intronic
1015156432 6:130101607-130101629 CAGGGCCTGGAAAGGGCAGGGGG + Intronic
1015189899 6:130461093-130461115 CAGTGGGAGGAAGTGGCAGGTGG - Intergenic
1015543388 6:134338582-134338604 AAGGGAGAGGAGAGGGCTGGTGG + Intergenic
1015790058 6:136957613-136957635 CAGGGCCAGGAAAGGCAGGGAGG - Intergenic
1015790072 6:136957655-136957677 CAGGGCCAGGAAAGGCAGGGGGG - Intergenic
1016510473 6:144837159-144837181 CAGAAGGAAGAAAGGGAGGGAGG - Intronic
1017067958 6:150547694-150547716 GAGGAAGAGGAAAGGGAGGGAGG + Intergenic
1017067964 6:150547713-150547735 GAGGAAGAGGAAAGGGAGGGAGG + Intergenic
1017542652 6:155418552-155418574 GAGGGGGAAGAATGGGCAGGAGG - Intronic
1017795836 6:157843533-157843555 TAGGTGGAGGAAAAGGAGGGTGG + Intronic
1017931918 6:158963417-158963439 AAGGGGGAGGGAAGGGAAGGGGG - Intergenic
1018122899 6:160654958-160654980 CTGGGGGAGGGAAGGCAGGGTGG + Intronic
1018211971 6:161490893-161490915 CAGGGGGAAGAGAGAGAGGGAGG - Intronic
1018393948 6:163362628-163362650 CAGGGGGAGAAGTGGCCGGGAGG + Intergenic
1018426486 6:163687693-163687715 CATGGGGAGGACAGGGCTGCTGG - Intergenic
1018461670 6:164004699-164004721 GAGGGGGAGGGAAGGGGGAGGGG + Intergenic
1018908398 6:168088254-168088276 CAGGGGCAGGTGACGGCGGGAGG - Intergenic
1019313493 7:374117-374139 CAGAGGGAAGGAAGGGAGGGAGG + Intergenic
1019404747 7:877472-877494 CAGAGGGAGGACAGGGAGAGAGG - Intronic
1019562251 7:1664887-1664909 CAGGCTGGGGAAGGGGCGGGTGG + Intergenic
1019562332 7:1665147-1665169 AACGGGGAGGGAAGGGAGGGAGG + Intergenic
1019577485 7:1744502-1744524 CAGAGGGATGGAGGGGCGGGAGG - Exonic
1019729541 7:2622661-2622683 CAGGGGGAGGTGGGGGCAGGAGG - Intergenic
1019729552 7:2622686-2622708 CAGGGGGAGGTGGGGGCAGGAGG - Intergenic
1019779536 7:2931201-2931223 CAGAGGGAGGCCAGGGCGGGGGG - Intronic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1020080120 7:5282489-5282511 AAGGGGGAGGAGTGGGAGGGAGG + Intronic
1020457271 7:8388081-8388103 TAGTGGGAGGAAAGGGCATGAGG - Intergenic
1021510610 7:21428368-21428390 GGGGAGGAGGAGAGGGCGGGAGG + Intronic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021798745 7:24284083-24284105 CAGGGGCGGGAAGTGGCGGGTGG + Intergenic
1021827960 7:24573411-24573433 GAGGGGGAGGAGAGAGAGGGAGG + Exonic
1021887580 7:25155053-25155075 CCGTGGGAGGAAAGGGCTGCTGG + Exonic
1022020856 7:26398504-26398526 CTGGAGGAGGAAGGGGTGGGCGG - Intergenic
1022106409 7:27200361-27200383 GAGGCGGAGGAACGTGCGGGTGG + Intergenic
1022194235 7:28049012-28049034 GAGGGGAAGGGAAGGGAGGGAGG - Intronic
1022289069 7:28983936-28983958 CAGGAGGAGGAGAGAGAGGGAGG + Intergenic
1022903276 7:34831469-34831491 AGGGGGGAAGAAAGGGAGGGAGG + Intronic
1023609461 7:41958568-41958590 GAGGGGAAGGGAAGGGAGGGTGG - Intergenic
1024233085 7:47377710-47377732 AAGGAGGAGGAAAGGGAGGAGGG - Intronic
1024250648 7:47503353-47503375 AAGGGGGAGGAAAGGGTGGCAGG - Intronic
1024266704 7:47612084-47612106 CTTTGGGAGGAAAAGGCGGGTGG + Intergenic
1024737755 7:52323569-52323591 AGGGGGGAGGAAAGGGAAGGGGG - Intergenic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025251431 7:57353904-57353926 CAGGAGGAGGCAGGGGTGGGAGG + Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1025829605 7:65038161-65038183 CGGGGCGGGGAAAGAGCGGGCGG - Intergenic
1026113072 7:67473850-67473872 CAAGGAGAGCAAAGGGCGTGAGG - Intergenic
1026121114 7:67538615-67538637 CAGGAGGAAGAAAGTGGGGGTGG - Intergenic
1026308749 7:69166103-69166125 GAGGGGGAGGAGAGGGGGAGGGG + Intergenic
1026388942 7:69880158-69880180 CAGGAGGAAGAAAGTGGGGGTGG + Intronic
1026458364 7:70592604-70592626 CTTCGGGAGGACAGGGCGGGTGG - Intronic
1026767068 7:73166830-73166852 GAGGAGGAGGAGAGGGAGGGGGG - Intergenic
1026890891 7:73981555-73981577 GGGAGGGAGGAAAGGGAGGGAGG + Intergenic
1026927414 7:74204092-74204114 GAGAGGGAGGGAAGGGAGGGAGG + Intronic
1027540668 7:79460191-79460213 CATGGAGAGGAAAGGGAGGAAGG + Intergenic
1028163343 7:87510326-87510348 CAGGGGTAGGAAAGGGTGAATGG + Intronic
1029111927 7:98217101-98217123 GAGGGGAAGGGAAGGGTGGGAGG + Exonic
1029350851 7:100011853-100011875 CAGGGAGAGGGAAGGGGAGGAGG + Intergenic
1029412836 7:100426830-100426852 GAGGGGGAGGAAAGGGAAGGAGG - Intronic
1029414825 7:100436173-100436195 CGGGCGGCGGAAGGGGCGGGCGG - Exonic
1029440496 7:100584412-100584434 CTGGGGGAGGAGGGGGCCGGGGG + Intronic
1029626323 7:101722359-101722381 GAGGGGGAGGCCACGGCGGGAGG - Intergenic
1029675958 7:102069094-102069116 GAGGAGGAGGAGAGGGCGGCTGG - Intronic
1030099329 7:105931323-105931345 GAGAGGGAGGAAAGGGAAGGTGG - Intronic
1030380005 7:108800843-108800865 GAGGAGGAGGAAAGGGGAGGGGG - Intergenic
1030836750 7:114297088-114297110 CAGGGAGAGGGCAGGGCAGGGGG + Intronic
1030875621 7:114809886-114809908 GAGAGGGAGGAAAAGGAGGGAGG + Intergenic
1031586000 7:123532990-123533012 CAGGAGGAAGAAAGGGGGGTTGG + Intronic
1031868046 7:127061601-127061623 CAGGGGGAGGAAGGGTGTGGGGG - Intronic
1031923447 7:127617834-127617856 AAGGGGGTGGAAGGGGCAGGAGG + Intergenic
1032054367 7:128672642-128672664 CTGGGGGAGGGGGGGGCGGGGGG + Intronic
1032332116 7:130990346-130990368 CTTGGGGAGGCCAGGGCGGGCGG - Intergenic
1033705569 7:143882640-143882662 GGGGGGGAGGGCAGGGCGGGAGG - Intronic
1033786432 7:144737005-144737027 CAGAGGGAGGCAAAGGAGGGAGG + Intronic
1033890430 7:146006398-146006420 CAGGGGGAGGATGGGGGAGGAGG - Intergenic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1034004368 7:147452938-147452960 GAGGGAGAAGAAAGGGAGGGAGG + Intronic
1034120956 7:148627386-148627408 CAGGGGAAGGTAAGAGTGGGAGG + Intergenic
1034264200 7:149773358-149773380 CTGGGGGAGGCAGGGGCAGGGGG + Exonic
1034491703 7:151396391-151396413 CAGGGGCAGGCAAGGAAGGGTGG - Intronic
1034517264 7:151590638-151590660 CAAGGGGTGGCAAGGGTGGGAGG - Intronic
1034546071 7:151790193-151790215 CAGAGGAAGGAAAGGGCTTGGGG - Intronic
1034735563 7:153426196-153426218 GAGGAGGTGGAAAGGGCTGGAGG + Intergenic
1035108254 7:156459807-156459829 CAGGGGCAGAACAGGGCGGCGGG - Intergenic
1035126070 7:156608264-156608286 CAGTGGGAGGAACGGCCTGGAGG - Intergenic
1035287301 7:157814540-157814562 CAGAGGGAGGACAGGGACGGAGG + Intronic
1035403894 7:158586687-158586709 CCGCGGGAGGAAAGGGAGGGCGG - Intronic
1035407266 7:158607270-158607292 CAGCGGGAGGAAAGTGCCAGTGG + Intergenic
1035412746 7:158658197-158658219 CAGGGAGAGGGAAGGGCAGAAGG + Intronic
1035454594 7:158999720-158999742 CAGGGGGAGGAACGAGCACGGGG - Intergenic
1035646951 8:1231804-1231826 GAGGAGGAAGGAAGGGCGGGAGG + Intergenic
1035721706 8:1797686-1797708 GAGGAGGAGGAAAGGGCGCAGGG - Intergenic
1036561278 8:9902299-9902321 CAGGTGGAGGAAATGGAGGAGGG - Intergenic
1036604511 8:10293738-10293760 AAGGGGAAGGAAAGGGAGGGAGG - Intronic
1037085769 8:14847709-14847731 GGGGAGGAGGAAAGGGAGGGAGG + Intronic
1037467249 8:19172617-19172639 GAAGGGGAGGAAAGGGGAGGGGG + Intergenic
1037806245 8:22059227-22059249 CAGGAGGAAGAAAGGGAGAGAGG + Exonic
1037877387 8:22554683-22554705 CAGGAGGATGAAAGGGATGGAGG + Intronic
1037880279 8:22570260-22570282 CAGGGGAAGGCAAGGGCTGGAGG + Intronic
1038324321 8:26561058-26561080 CAGGGGGAGGGATGGGAGGGGGG + Intronic
1038423795 8:27451679-27451701 CAGGGAGAGGAATGGGGTGGAGG - Intronic
1038735689 8:30167021-30167043 GAAGGAGAGGAAAGGGAGGGAGG + Intronic
1038815762 8:30902382-30902404 CAGGGGGAGGGCAGGAAGGGGGG + Intergenic
1038972016 8:32646900-32646922 GAGGGGGAGGAAAGAGAGAGAGG + Intronic
1039321237 8:36434393-36434415 AAGGAGGAAGAAAGGGAGGGTGG + Intergenic
1039425213 8:37479684-37479706 CAGGGGGAGCACAGGACAGGTGG + Intergenic
1039554718 8:38467831-38467853 CAGGAGGTGAAAGGGGCGGGCGG + Exonic
1039593238 8:38768121-38768143 TAGGGGAAGGGAAGGGAGGGAGG + Intronic
1039912475 8:41835946-41835968 CAGGGAGGGGAGAGGGCAGGGGG + Intronic
1039952796 8:42185022-42185044 CTGGGGGAGGAAAGTCCAGGAGG - Intronic
1039964549 8:42274464-42274486 CAGAGGCAGGAAAGGGTGGTGGG - Intronic
1040483903 8:47852301-47852323 CAAGGGGAGGAATGGACTGGGGG + Intronic
1040843937 8:51815400-51815422 TAGGGGGAAGAACGGGAGGGGGG + Intergenic
1041021719 8:53644893-53644915 GAGGGAGAGGGAAAGGCGGGGGG - Intergenic
1041067289 8:54094274-54094296 GAGGAGGAGGAAAGGCCTGGTGG - Intronic
1041636641 8:60153057-60153079 AAGGGGGGGGACAGGGTGGGAGG + Intergenic
1041726835 8:61026018-61026040 CAGGGGGAGGGAAGGGGGGTGGG - Intergenic
1041762240 8:61379365-61379387 GAGGGTGGGGAAAGGGGGGGAGG - Intronic
1042143856 8:65707062-65707084 CAGGGGGAGGCAGGGGCGGTGGG - Exonic
1042659007 8:71133360-71133382 CTGGGGGAGGACAGGGCTGCAGG - Intergenic
1042844378 8:73155753-73155775 AAGGGGGAGGAAAGGCCAGGTGG + Intergenic
1042892825 8:73631993-73632015 AGGGGGGAGGAGAGGGAGGGAGG + Intronic
1043002541 8:74777258-74777280 CAGTGTGAGGAAGGGGTGGGGGG + Intronic
1043499475 8:80838567-80838589 GAGGAGGAGGAAAAGGGGGGAGG + Intronic
1043986595 8:86699915-86699937 TAGAGGGAGGAAAGGAAGGGAGG - Intronic
1043998418 8:86847663-86847685 AAGGAAGAGGAAAGGGAGGGAGG + Intergenic
1044150827 8:88773336-88773358 CTGGGGGAGAAAAGGCAGGGTGG - Intergenic
1044619104 8:94171982-94172004 GAGGGGGAGGAGGGGGAGGGGGG - Intronic
1044803182 8:95977965-95977987 GAAGGGGAGGAAAGGGAGGAGGG + Intergenic
1045111085 8:98940206-98940228 CCGGGGGAGGAGCGGGCGGAAGG - Intronic
1045156480 8:99479594-99479616 GATGGGGAGGAATGGGAGGGAGG - Intronic
1045277768 8:100722437-100722459 CTGGTGGAGGCAGGGGCGGGCGG - Exonic
1046458465 8:114501704-114501726 CAGAGGGAGGAAAGAGGGAGAGG + Intergenic
1046595346 8:116255045-116255067 CAGGGGGAAGAAAGGGAGAGAGG - Intergenic
1046908196 8:119597025-119597047 CAGATGCAGGAAGGGGCGGGAGG + Intronic
1047528839 8:125657083-125657105 TAGGAGGAGGAAAGGGAGAGGGG - Intergenic
1048007661 8:130432085-130432107 AAGGGGGAGGAAAGGGAAGAGGG + Intronic
1048177356 8:132164695-132164717 AAGGGGAAGGAAAGGGCAAGGGG + Intronic
1048872353 8:138810125-138810147 AAGGAGGAGGAAAGAGAGGGAGG + Intronic
1049082893 8:140457128-140457150 CAGGGCGGGGAAAGCGCCGGGGG + Intronic
1049128100 8:140810555-140810577 CAGTGTGAGGAAGGAGCGGGTGG - Intronic
1049220107 8:141425180-141425202 CCGGGGGAGGGTGGGGCGGGGGG + Intronic
1049241082 8:141537683-141537705 CAGGGGGAGGGCAGGGCTGATGG - Intergenic
1049246484 8:141565552-141565574 CGGGGGCAGGAAAGGGCAAGGGG - Intergenic
1049398531 8:142413058-142413080 CAGGGGGAGGGCGGGGCTGGGGG + Intergenic
1049468928 8:142766717-142766739 AAGGGTGAGGACAGGGAGGGAGG - Intronic
1049514376 8:143045646-143045668 CAGAGGGAGGAAAGTGAGGAGGG - Intronic
1049552379 8:143266635-143266657 CACGCGGAGCAGAGGGCGGGGGG - Intronic
1049748129 8:144271599-144271621 CAGGGCAAGGCCAGGGCGGGAGG + Intronic
1049761668 8:144334474-144334496 GAGGGGGAGGGGAGGGTGGGTGG - Intronic
1049812726 8:144582684-144582706 CAGGAGGAGGATGAGGCGGGTGG + Intronic
1050309613 9:4339788-4339810 TAGGGGGAGGGAAGGGGGAGGGG + Intronic
1050606288 9:7304681-7304703 CAGGTGGATGAATGGACGGGTGG + Intergenic
1050719007 9:8563676-8563698 CAGAGGGAGGCCAAGGCGGGTGG - Intronic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051934786 9:22433869-22433891 GAGGGAGAGGCATGGGCGGGAGG + Intergenic
1052391472 9:27883237-27883259 CAGGAGGAAGAAAGAGCAGGCGG - Intergenic
1052997722 9:34559943-34559965 CAGGGAGAGGAACTGGCGTGAGG - Intronic
1053046149 9:34919454-34919476 CAGAGGCTGGAAAGGGTGGGTGG - Intergenic
1053503546 9:38621428-38621450 CCGGTGGAGGAATGGGCGGGAGG - Intergenic
1053582785 9:39424600-39424622 AAGGGGGAGGAAGGGGCAGTGGG - Intergenic
1053752375 9:41269410-41269432 CAGGTGGAGGAGTGGGTGGGAGG - Intergenic
1053752823 9:41273667-41273689 CAGGTGGAGGACTGGGCGGGAGG - Intergenic
1053846969 9:42249465-42249487 AAGGGGGAGGAAGGGGCAGTGGG - Intergenic
1054104364 9:60983343-60983365 AAGGGGGAGGAAGGGGCAGTGGG - Intergenic
1054257903 9:62833742-62833764 CAGGTGGAGGAGTGGGTGGGAGG - Intergenic
1054258347 9:62838019-62838041 CAGGTGGAGGACTGGGCGGGAGG - Intergenic
1054333422 9:63782022-63782044 CAGGTGGAGGACTGGGCGGGAGG + Intergenic
1054581980 9:66923507-66923529 AAGGGGGAGGAAGGGGCAGTGGG + Intronic
1055453499 9:76452594-76452616 CAGGGGGAGGAGAGGCAGGGAGG + Intronic
1056040507 9:82660656-82660678 AAGGGGGAGGGAAGGGGGAGAGG + Intergenic
1057180100 9:93025153-93025175 CAGGGGAAGTAAAGGGAGTGGGG - Intronic
1057294322 9:93826606-93826628 CGGGCGGAGGCAGGGGCGGGCGG + Intergenic
1057368341 9:94445643-94445665 AAAGGAGAGGAAAGGGAGGGAGG - Intronic
1057424009 9:94934255-94934277 GAGGGAGAGGGAAGGGAGGGAGG - Intronic
1057466245 9:95317253-95317275 CAGGGCGGGGAAAGCGGGGGCGG - Intronic
1057509937 9:95669665-95669687 AAGGGGGAGGCGGGGGCGGGGGG + Intergenic
1057684859 9:97222382-97222404 CAGGTGGAGGAGTGGGCGGGAGG - Intergenic
1057784387 9:98075445-98075467 GAAAGGGAGGAAAGGGAGGGAGG + Intronic
1058531143 9:105905596-105905618 CCGGGGGAGGAGAGAGCGGAGGG - Intergenic
1058811017 9:108639601-108639623 AAGGGAGAGGAGAGGGAGGGAGG - Intergenic
1058888163 9:109338734-109338756 CAGGGGGAGGGAAGGTTGGTTGG - Intergenic
1058946032 9:109857137-109857159 CAGGAGGAGGAAGGGGCAGAAGG - Intronic
1059145660 9:111897079-111897101 TGGGGAGAGGAAAGGGCGGAGGG - Exonic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1059423869 9:114208908-114208930 CAGAGTGAGGAAAGGCTGGGAGG + Intronic
1059814778 9:117900168-117900190 GGGAGGGAGGAAAGGGAGGGAGG - Intergenic
1060150861 9:121287239-121287261 CAGGGGGAGGAGTGGGAGGGAGG + Intronic
1060397526 9:123326596-123326618 CAGGGAGAGGAGAGGTGGGGAGG - Intergenic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1060736587 9:126070193-126070215 CAGGGGGTGGCATGGGCAGGAGG - Intergenic
1060756693 9:126219189-126219211 CAGGGGGAGGCCAGGGCTGGAGG - Intergenic
1061128271 9:128689926-128689948 GAGGGGGAGGAGAGCGAGGGAGG - Intronic
1061215199 9:129217739-129217761 CAAGGTCAGGAAAGGGCAGGTGG + Intergenic
1061237512 9:129351424-129351446 CAGGAGGAGGAAAGGGGGGGAGG + Intergenic
1061237531 9:129351479-129351501 AAGGGGGAGGAAAAGGAAGGGGG + Intergenic
1061390634 9:130315374-130315396 GAGGGGAAGGAAAGGAAGGGAGG - Intronic
1061423278 9:130483791-130483813 AAGGAGGAGGAAAGGGAGAGAGG - Intronic
1061546945 9:131309839-131309861 CAGAGGGAGGAAAGGGGTGAGGG + Intergenic
1061582532 9:131546395-131546417 CAGGCGCTGGAAGGGGCGGGGGG + Intergenic
1061680982 9:132242262-132242284 CGGGGGGAGGGCAGTGCGGGCGG - Exonic
1062135500 9:134925277-134925299 ATGGGGGAGAAAAGGGAGGGTGG - Intergenic
1062159868 9:135074392-135074414 GAGAGGGAGGAAAGGGGAGGAGG + Intergenic
1062215057 9:135384603-135384625 CAGGGAGAGGCAGGGGCGGAAGG - Intergenic
1062321061 9:135990770-135990792 GAGGGGAGGGAAAGGGCAGGAGG - Intergenic
1062321081 9:135990817-135990839 GAGGGGAGGGAAAGGGCGGGAGG - Intergenic
1062321096 9:135990848-135990870 GAGGGGAGGGAAAGGGCGGGAGG - Intergenic
1062332716 9:136051579-136051601 CCACGGGAGGAAAGTGCGGGCGG + Intronic
1062446556 9:136597705-136597727 CAGGGGGAGGGAAGGGTGGAGGG + Intergenic
1062610018 9:137369427-137369449 CAGGAGGAGCAGAGGGCGGGCGG - Intronic
1062708732 9:137960202-137960224 GAGGGGGAGGGAAGGTCGGCCGG + Intronic
1202800427 9_KI270719v1_random:170356-170378 CAGGTGGAGGACTGGGCGGGAGG + Intergenic
1202800872 9_KI270719v1_random:174638-174660 CAGGTGGAGGAGTGGGTGGGAGG + Intergenic
1203697146 Un_GL000214v1:109268-109290 CAGGTGGAGGAGTGGGCGGGAGG - Intergenic
1185449560 X:275222-275244 CAGGGGGAGGAAGGAGGAGGGGG + Intergenic
1185485845 X:481521-481543 CAGAGGGAGGAAGGAGAGGGAGG + Intergenic
1185504925 X:625029-625051 CAGAGGGAGGAAAGGAAAGGAGG - Intronic
1185597370 X:1315165-1315187 CAGGTGGAGAAAAGAGAGGGAGG + Intergenic
1185601208 X:1340740-1340762 CTTGGCGAGGAAAAGGCGGGCGG + Intronic
1185603636 X:1355089-1355111 CAGGAGGAAGAAGGAGCGGGAGG + Intronic
1185610917 X:1393046-1393068 GACGGGGAGAAAAGGGCGGGCGG - Intergenic
1185763932 X:2709068-2709090 CATGTGGAGGAAAAGGCTGGTGG + Intronic
1185822440 X:3218481-3218503 AAGGGGAAGGGAAGGGAGGGAGG + Intergenic
1186005464 X:5066001-5066023 CAGGAGGAAGACAGGGAGGGAGG + Intergenic
1186200822 X:7153452-7153474 AAGGAGGAGGAAAGGAAGGGAGG - Intergenic
1186518639 X:10186234-10186256 AAGGGTGAGGGAAGGGCCGGGGG + Intronic
1187526057 X:20056335-20056357 CAGGGGAGGGAAACGGCAGGAGG - Intronic
1187704273 X:21993902-21993924 CAGGAGGAGGAGAGGGAAGGAGG - Intronic
1187882885 X:23862874-23862896 CAGGGGATGGAAGGGGAGGGAGG + Intronic
1187975956 X:24705691-24705713 CAGGGGCAGGGGAGGGGGGGAGG - Intronic
1188212787 X:27444013-27444035 CGGGGGGAGGGAAGGGGAGGGGG + Intergenic
1188482798 X:30652607-30652629 GAGGGAGAGGAAATGGCGTGTGG + Intergenic
1188981789 X:36733466-36733488 CAGGGGGAGGACTGGGTAGGGGG - Intergenic
1189161109 X:38809891-38809913 CAGAGGGAGGAAGGGACCGGGGG - Intergenic
1189378342 X:40483286-40483308 CAGGAGGAGGAAGGGTGGGGAGG + Intergenic
1189388795 X:40558589-40558611 CAGAAGGCGGTAAGGGCGGGAGG + Intergenic
1189413149 X:40791439-40791461 CAGGGGCAGGATAGGCGGGGGGG + Intergenic
1189783870 X:44542438-44542460 CAGTGGGAGGAATGGGGGTGGGG + Intronic
1190101082 X:47523679-47523701 CAGGGGGAGGCAGGGGAAGGGGG - Intergenic
1190198073 X:48336704-48336726 GAGGGGGAGGAAGGGGAGGGAGG + Intergenic
1192166455 X:68830108-68830130 CAGGGGGTGGGAAGCCCGGGGGG - Intronic
1192393465 X:70754366-70754388 AAGGGGGAGGGAAGAGTGGGAGG + Intronic
1192561706 X:72131761-72131783 CCGGGGCCGGAGAGGGCGGGCGG + Exonic
1196247338 X:113415361-113415383 GAGAGGGAGGAAAGAGTGGGAGG + Intergenic
1196425209 X:115562134-115562156 CTGTGCGGGGAAAGGGCGGGGGG - Intronic
1196516620 X:116620746-116620768 TAGTGGGAAGAAAGGGAGGGCGG - Intergenic
1198411925 X:136379437-136379459 GAAGGGGAGGAGAGGGCAGGGGG - Intronic
1199634962 X:149805808-149805830 CAAGGGGAGGAAAAAGAGGGAGG + Intergenic
1200397452 X:155999509-155999531 CAGGGGTAGGGATGGGCAGGAGG - Intronic
1200797871 Y:7358234-7358256 CTTGGGGAGGAAAAGGCAGGAGG - Intergenic
1200886149 Y:8272560-8272582 CTTGGGGAGGATAGGGTGGGTGG - Intergenic
1201153345 Y:11107331-11107353 CAGGTGGAGGAGTGGGCGGGAGG + Intergenic
1201529628 Y:14977629-14977651 CAGGGGGAGACAAGGCAGGGAGG + Intergenic