ID: 1159933083

View in Genome Browser
Species Human (GRCh38)
Location 18:74334305-74334327
Sequence AAGCAGAAGGGGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2673
Summary {0: 1, 1: 0, 2: 20, 3: 308, 4: 2344}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159933075_1159933083 21 Left 1159933075 18:74334261-74334283 CCAAACAGGGTTTTGAGGACTTC 0: 1
1: 16
2: 37
3: 77
4: 283
Right 1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG 0: 1
1: 0
2: 20
3: 308
4: 2344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159933083 Original CRISPR AAGCAGAAGGGGAAAGAGGA AGG Intronic
Too many off-targets to display for this crispr