ID: 1159941641

View in Genome Browser
Species Human (GRCh38)
Location 18:74413017-74413039
Sequence GCCACGGAGATGAGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159941641_1159941650 15 Left 1159941641 18:74413017-74413039 CCCAGGACCCTCATCTCCGTGGC 0: 1
1: 0
2: 2
3: 34
4: 206
Right 1159941650 18:74413055-74413077 TTCACCCTGGACCCCCAGGAGGG 0: 1
1: 0
2: 2
3: 28
4: 514
1159941641_1159941653 21 Left 1159941641 18:74413017-74413039 CCCAGGACCCTCATCTCCGTGGC 0: 1
1: 0
2: 2
3: 34
4: 206
Right 1159941653 18:74413061-74413083 CTGGACCCCCAGGAGGGCAGTGG 0: 1
1: 1
2: 6
3: 63
4: 531
1159941641_1159941647 11 Left 1159941641 18:74413017-74413039 CCCAGGACCCTCATCTCCGTGGC 0: 1
1: 0
2: 2
3: 34
4: 206
Right 1159941647 18:74413051-74413073 CACCTTCACCCTGGACCCCCAGG 0: 1
1: 0
2: 3
3: 31
4: 341
1159941641_1159941657 28 Left 1159941641 18:74413017-74413039 CCCAGGACCCTCATCTCCGTGGC 0: 1
1: 0
2: 2
3: 34
4: 206
Right 1159941657 18:74413068-74413090 CCCAGGAGGGCAGTGGATGAAGG 0: 1
1: 0
2: 4
3: 34
4: 396
1159941641_1159941646 2 Left 1159941641 18:74413017-74413039 CCCAGGACCCTCATCTCCGTGGC 0: 1
1: 0
2: 2
3: 34
4: 206
Right 1159941646 18:74413042-74413064 TAAGCTGTTCACCTTCACCCTGG 0: 1
1: 0
2: 0
3: 13
4: 119
1159941641_1159941649 14 Left 1159941641 18:74413017-74413039 CCCAGGACCCTCATCTCCGTGGC 0: 1
1: 0
2: 2
3: 34
4: 206
Right 1159941649 18:74413054-74413076 CTTCACCCTGGACCCCCAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159941641 Original CRISPR GCCACGGAGATGAGGGTCCT GGG (reversed) Intergenic
902069602 1:13723108-13723130 GCCAAGGAGAGAAGGGGCCTGGG - Intronic
902447546 1:16476603-16476625 GCCACAGCGCAGAGGGTCCTTGG - Intergenic
902467446 1:16626818-16626840 GCCACAGCGCAGAGGGTCCTTGG - Intergenic
902507138 1:16945917-16945939 GCCACAGCGCAGAGGGTCCTTGG + Intronic
903690603 1:25170704-25170726 GCCATGGAGATGGGGGTGATTGG - Intergenic
904311643 1:29632963-29632985 GCCAGGGAGATGAGGGGCTGGGG - Intergenic
904806826 1:33137939-33137961 GCCGAGGAGCTGAGGGTCCAGGG + Intergenic
905733107 1:40309974-40309996 GCCAGGGTGAGGAAGGTCCTAGG - Exonic
905733417 1:40311412-40311434 GCCACGGAGATGGGGGTGTCTGG - Intronic
907391584 1:54161666-54161688 GCCCTGGAGGTCAGGGTCCTGGG - Intronic
907467800 1:54651059-54651081 GCCAGGGAGATGAGAGAGCTGGG - Intronic
918064791 1:181092627-181092649 GCCACCTAGCTGTGGGTCCTTGG + Intergenic
918573005 1:186021119-186021141 GCCATGCAGATGAGGATACTTGG + Intronic
919932436 1:202230082-202230104 GCCACTCAGATAAGGGTCCCAGG - Intronic
919979763 1:202635548-202635570 GCCCCAGAGATGAGGTTTCTTGG - Intronic
919997563 1:202767349-202767371 GCCACTGTGAGGAGGGCCCTGGG - Intronic
921320057 1:213930019-213930041 GAGAGGGAGAGGAGGGTCCTTGG - Intergenic
922585171 1:226728846-226728868 GCCACAGGGATAAGGGTGCTAGG - Intronic
1063031629 10:2240859-2240881 CCCATGGAGCTGAGTGTCCTGGG - Intergenic
1064271515 10:13870411-13870433 GCAAGGGAGAGGATGGTCCTTGG - Intronic
1065827303 10:29584145-29584167 GGCACGGAGGTGAGGGCCCATGG - Intronic
1065950553 10:30647013-30647035 GGCACGGAGGTGAGGGCCCATGG + Intergenic
1066281584 10:33923289-33923311 GACATGGAGAGGAGGGACCTTGG - Intergenic
1067535437 10:47106360-47106382 TCCACTTATATGAGGGTCCTAGG - Intergenic
1069901416 10:71708623-71708645 ACCTCCGAGATGAGGGGCCTGGG + Intronic
1071482949 10:86078774-86078796 GCCAGGGGGCTGGGGGTCCTAGG - Intronic
1071567901 10:86681027-86681049 GCCAGTGAGATGAAGTTCCTGGG - Intronic
1074544784 10:114394099-114394121 GTCACGGTGATTAGGGTCCCAGG - Intronic
1076411454 10:130254546-130254568 ACGACGGAGATGACGGTGCTGGG - Intergenic
1077343695 11:2037007-2037029 GCCACTGAGGTGGGGCTCCTAGG - Intergenic
1079087343 11:17456025-17456047 TCTACCGAGAAGAGGGTCCTAGG + Intronic
1084007790 11:66332408-66332430 GCCAGGGAGATGGGGATGCTGGG - Exonic
1084536129 11:69758315-69758337 CCCAGGCAGCTGAGGGTCCTTGG + Intergenic
1085917151 11:80903445-80903467 GCAATGGAGATGAGGTTCCCAGG - Intergenic
1086240481 11:84684324-84684346 GCCACAGAGATGATGGTGCAAGG - Intronic
1088585595 11:111357744-111357766 GCCACCCAGATGAGAGGCCTGGG + Intronic
1089755119 11:120680860-120680882 TACAGGGAGAAGAGGGTCCTTGG - Intronic
1202826681 11_KI270721v1_random:92196-92218 GCCACTGAGGTGGGGCTCCTAGG - Intergenic
1091768762 12:3138252-3138274 GCCAGGGAGACGAGAGCCCTGGG + Intronic
1095990323 12:48029913-48029935 GCCAAGGTGATGAGGGGCCAGGG + Intergenic
1098148076 12:67517706-67517728 GCCGCGGAGATGTGAGTGCTAGG + Intergenic
1099346727 12:81509486-81509508 CCCAAGGAGATTAGGGGCCTTGG + Intronic
1102207080 12:111098077-111098099 ACCATGGAGAGGAGGGTCGTAGG + Intronic
1102687188 12:114734300-114734322 GCCACTCAGATGAGGGTCTTGGG - Intergenic
1103612982 12:122135340-122135362 GCCAGGGTGAGGAGGGCCCTAGG + Exonic
1104231794 12:126892029-126892051 GCCAGGGAGATGAGGGACTGTGG - Intergenic
1104772341 12:131371259-131371281 GCCACGGGGATGAGCAGCCTAGG - Intergenic
1106081867 13:26506931-26506953 GACAAGGAGATGAGGGTCTGGGG - Intergenic
1108310750 13:49187599-49187621 GCCACTGTGAGGAGGGCCCTGGG - Intronic
1111568652 13:90048791-90048813 GCCACGGAGATTGTAGTCCTTGG - Intergenic
1112541263 13:100315716-100315738 GCCACAGAGAAGAGGCCCCTAGG - Intronic
1113908280 13:113830394-113830416 GCCACGGGGAGGAGGGGCCCAGG - Intronic
1113908307 13:113830469-113830491 GCCACGGGGAGGAGGGGCCCGGG - Intronic
1113908335 13:113830544-113830566 GCCACGGGGAGGAGGGGCCCGGG - Intronic
1114075365 14:19158704-19158726 GCCGCGGAGAAGCGGGGCCTGGG + Intergenic
1114086686 14:19240446-19240468 GCCTCGGAGAAGCGGGGCCTGGG - Intergenic
1114086905 14:19241276-19241298 GCCGCGGAGAAGCGGGGCCTGGG - Intergenic
1117207584 14:53460079-53460101 ACCACCCAGATGATGGTCCTGGG - Intergenic
1117546048 14:56795343-56795365 GCCAGGGAGGAGAGGGTCATTGG + Intergenic
1119546254 14:75473880-75473902 GCCGCGGAGAGGAGGGAACTAGG + Intronic
1122629118 14:103099327-103099349 GCCACGGTGCCGAGGGCCCTGGG + Intergenic
1202898787 14_GL000194v1_random:24267-24289 GCCACGGAGAAGGGAGGCCTGGG - Intergenic
1202898832 14_GL000194v1_random:24464-24486 GCCACGGAGAAGGGGGTCCTGGG - Intergenic
1202899479 14_GL000194v1_random:27161-27183 GCCACGAAGAAGCGGGGCCTGGG - Intergenic
1124372789 15:29112921-29112943 GCCACTGATATGAGGTACCTGGG - Intronic
1124495383 15:30183586-30183608 GCCCCAGAGATGAGGTTTCTTGG - Intergenic
1124748190 15:32355060-32355082 GCCCCAGAGATGAGGTTTCTTGG + Intergenic
1128355170 15:66921327-66921349 CCCACAGAAATGAGCGTCCTTGG + Intergenic
1128995499 15:72291514-72291536 GCTAGGCAGATGGGGGTCCTTGG + Intronic
1129460967 15:75699927-75699949 TCCACTGAGGTGAGGGTCCCAGG - Intronic
1130511521 15:84593803-84593825 TACACAGAGATGAGGCTCCTGGG + Intergenic
1131375344 15:91918451-91918473 GCCATGGAGATGATAGTTCTGGG + Intronic
1134626608 16:15726975-15726997 GCCGGGGAGCTGCGGGTCCTGGG - Exonic
1137366735 16:47865973-47865995 GGCTGGGAGATTAGGGTCCTTGG + Intergenic
1137556001 16:49470707-49470729 GCCTGGGAGAGGAGGCTCCTGGG + Intergenic
1139511125 16:67429193-67429215 GAAGCTGAGATGAGGGTCCTGGG - Intergenic
1142697269 17:1640386-1640408 GCCGCTGAGCTGAGGGTCCTGGG + Intronic
1143636223 17:8165047-8165069 CCCACGGAGATGAAGGGCCCAGG + Intergenic
1146612795 17:34322479-34322501 GGCACAGATATGTGGGTCCTGGG + Intergenic
1146752190 17:35391717-35391739 GCCACACAGATCCGGGTCCTGGG - Intergenic
1148977749 17:51544467-51544489 GCCACTGAGATCAGAGTCCCAGG - Intergenic
1148988907 17:51648250-51648272 GCCAAGGGGATGTGGGTGCTTGG + Intronic
1149598243 17:57876463-57876485 GCCAAGGAGATCAGGGTCTAGGG - Intronic
1155959858 18:31985037-31985059 GGCATGGAGCTCAGGGTCCTAGG + Intergenic
1159941641 18:74413017-74413039 GCCACGGAGATGAGGGTCCTGGG - Intergenic
1160720770 19:596026-596048 TCCAAGGGGCTGAGGGTCCTGGG + Intronic
1161330205 19:3683300-3683322 TCCACGGAGATCTGGGTCCAGGG + Intronic
1161984011 19:7644182-7644204 GCCTCGGAGAGGTGGGACCTGGG + Intronic
1166849286 19:45750911-45750933 GCCTCAGAGAAGAGGGGCCTTGG + Intronic
1166945632 19:46394272-46394294 ACCACGGAGATGAGAGCCATGGG - Intergenic
1167014275 19:46830119-46830141 GCTGCGGAGATGAGGTTCCTTGG + Intergenic
1167095398 19:47372696-47372718 GACACGGGGTTGAGGCTCCTGGG - Intronic
1202647922 1_KI270706v1_random:158257-158279 GCCACGGAGAGGTGGGGCTTGGG + Intergenic
1202647973 1_KI270706v1_random:158473-158495 GCCACGGAGAAGTGGGGCCTGGG + Intergenic
925836592 2:7952448-7952470 GCCAAGGAAATGAGGATCCCAGG - Intergenic
926214124 2:10893215-10893237 CCCACAGAGCTGGGGGTCCTAGG - Intergenic
931155593 2:59625089-59625111 GCCACGGATTTGAGGGTCCCGGG + Intergenic
932290091 2:70569784-70569806 ACCACAGAGAGGAGTGTCCTAGG - Intergenic
934486980 2:94724982-94725004 GCCACGGAGGTGGGGGAGCTAGG + Intergenic
934488459 2:94738918-94738940 GCCACGGAGGTGGGGGAGCTAGG - Intergenic
936837585 2:116726911-116726933 GCCAGGGAGATGAGAGACCTAGG + Intergenic
937242412 2:120470806-120470828 GCCACAGAGCTGGGTGTCCTGGG + Intergenic
938079514 2:128362282-128362304 GCCACTGAGATGAGATTCTTAGG + Intergenic
938489328 2:131753754-131753776 GCCACGGAGAAGGGGGGCCTGGG + Intronic
938489703 2:131755192-131755214 GCCACGGAGAAGTGGGGCCTGGG + Intronic
938490013 2:131756424-131756446 GCCGCGGAGAAGCGGGGCCTGGG + Intronic
944989709 2:205221513-205221535 GAAAGGGAGATGTGGGTCCTAGG + Intronic
945307195 2:208269629-208269651 GCCAAGGTGATGAAGGTCCTGGG - Intronic
947542860 2:230990708-230990730 GCCGCGGAGGTGGGGGTCCCAGG - Intergenic
947909895 2:233793999-233794021 GCCTCGTGGATGAGGCTCCTAGG - Intronic
948070064 2:235113929-235113951 GTCTTGGAGATGAGGGGCCTGGG - Intergenic
1168997798 20:2145835-2145857 GCCAGGGAGAGGGGGGTGCTGGG - Exonic
1169002589 20:2178765-2178787 GCCCAGGAGCTGAGGGCCCTGGG - Intergenic
1169251401 20:4064016-4064038 GCCACACAGATGAGGGACCTAGG + Intergenic
1173582819 20:44159560-44159582 CCCTCGGAGAAGGGGGTCCTGGG - Intronic
1173790444 20:45824551-45824573 GGCACGGTGATGAGGATGCTGGG - Exonic
1176187268 20:63787856-63787878 GCGACGGAGAGGAGGGACCAGGG + Intronic
1176603448 21:8812327-8812349 GCCACGGAGAAGCGGGGACTGGG - Intergenic
1176603874 21:8814256-8814278 GCCACGGAGAAGTGGGGCCTGGG - Intergenic
1176618325 21:9039657-9039679 ACCTCGGAGAAGTGGGTCCTGGG - Intergenic
1176618419 21:9040063-9040085 GCCACGGAGAAGCGGGGCCTGGG - Intergenic
1176618855 21:9041933-9041955 GCCACGGAGAAGCGGGACCTGGG - Intergenic
1176706193 21:10121273-10121295 GCCACGGAGAAGCAGGGCCTGGG + Intergenic
1176706521 21:10122801-10122823 GCCGCGGAGAAGCGGGGCCTGGG + Intergenic
1176706673 21:10123389-10123411 GCCGCGGAGAAGCGGGGCCTGGG + Intergenic
1176706979 21:10124639-10124661 GCCACGGAGAAGGGGGGCCTGGG + Intergenic
1176707031 21:10124836-10124858 GCCACGGAGAAGGGAGGCCTGGG + Intergenic
1176707134 21:10125226-10125248 GCCGCGGAGAAGCGGGGCCTGGG + Intergenic
1176707295 21:10125833-10125855 GCCACGGAGAAGCGGGGACTGGG + Intergenic
1178875130 21:36408377-36408399 GAAATAGAGATGAGGGTCCTAGG + Intronic
1179174969 21:39001463-39001485 GTCTTGGAGAGGAGGGTCCTTGG - Intergenic
1180136744 21:45866845-45866867 GTCACGGAGATGCGTGTACTAGG + Intronic
1180291179 22:10852292-10852314 GCCTCGGAGAAGCGGGGCCTGGG + Intergenic
1180345731 22:11703885-11703907 GCCACGGAGAAGCGGGGACTGGG - Intergenic
1180346159 22:11705833-11705855 GCCACAGAGAAGTGGGGCCTGGG - Intergenic
1180353496 22:11822129-11822151 GCCACGGAGAAGCGGGGACTGGG - Intergenic
1180353930 22:11823990-11824012 GCCACGGAGAAGTGGGGCCTGGG - Intergenic
1180384316 22:12168335-12168357 GCCACGGAGAAGTGGGGCCTGGG + Intergenic
1180384745 22:12170228-12170250 GCCACGGAGAAGCGGGGACTGGG + Intergenic
1180493984 22:15881714-15881736 GCCTCGGAGAAGCGGGGCCTGGG + Intergenic
1181810548 22:25401227-25401249 GCCTCTGAGAGGAGGGGCCTGGG - Intronic
1183773762 22:39949008-39949030 GCCACAGACTTGAGGGTCTTTGG - Intronic
1184551694 22:45207881-45207903 GCCCCTGAGCTGAGAGTCCTGGG + Intronic
1185098801 22:48826549-48826571 GCCAGGGAGACAAGGGGCCTAGG - Intronic
949972555 3:9422111-9422133 GCCTAGGAGATGAGGATTCTAGG + Intronic
953232138 3:41074687-41074709 GACCCTGAGATGAGGGTTCTGGG - Intergenic
953417678 3:42732278-42732300 GCCACAGAGATGAGGGACTGGGG + Intronic
959098415 3:101982758-101982780 GCCACAGAGATGAGATTCCCAGG - Intergenic
959359469 3:105369444-105369466 ACCACGGATCTGAGGGTCCAGGG - Intronic
961438065 3:126932891-126932913 GCCGCTGGGCTGAGGGTCCTAGG + Intronic
961787979 3:129358964-129358986 GCCATGGAGAGAAGGGTTCTGGG + Intergenic
963238662 3:142981229-142981251 GCCAGGGAGAGAAGGCTCCTTGG - Intronic
968463093 4:735685-735707 GCCATGGAGCAGATGGTCCTGGG + Intronic
969494732 4:7520055-7520077 GCCCTGGTGATGAGGGCCCTTGG + Intronic
970600269 4:17636579-17636601 GCCAATGAGCTGAAGGTCCTCGG + Exonic
973338233 4:48977602-48977624 TCTACGGAGCTGATGGTCCTTGG - Intergenic
973374243 4:49276659-49276681 GCCACGGAAAAGTGGGGCCTGGG + Intergenic
973383169 4:49333580-49333602 GCCACGGAAAAGTGGGGCCTGGG - Intergenic
973386778 4:49518595-49518617 GCCACGGAAAAGTGGGGCCTGGG - Intergenic
974821469 4:67071414-67071436 GCAACCCAGAAGAGGGTCCTTGG + Intergenic
981199457 4:141963002-141963024 GCCACTGAGATGGGGCTCCTGGG + Intergenic
981356402 4:143794319-143794341 CCCAAGGAGATGGGGTTCCTTGG - Intergenic
981377728 4:144035191-144035213 CCCAAGGAGATGGGGTTCCTTGG - Intergenic
985064119 4:186104914-186104936 GGCGCGGAGCTGAGCGTCCTCGG + Intronic
985537696 5:473979-474001 CCCACGGAGCTGAGGGCACTAGG - Intronic
986301591 5:6482225-6482247 GACATGGAGATGAGGGCCCAGGG - Intronic
986633804 5:9800674-9800696 GCCATGGTCATGAGGGTCATGGG + Intergenic
990603718 5:57386311-57386333 GCCAGGGAGCAGAGAGTCCTGGG + Intergenic
991609045 5:68431848-68431870 GACACTGAGATGTGTGTCCTTGG + Intergenic
1001163792 5:169345000-169345022 GCAATCGAGATGTGGGTCCTGGG + Intergenic
1001658123 5:173369656-173369678 GCCAAGGAGATGAAGTGCCTGGG - Intergenic
1003569624 6:7247419-7247441 GCCAGGCAGGAGAGGGTCCTTGG + Intronic
1005105898 6:22223786-22223808 TTCAAGGAGATGAGGGACCTTGG - Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007832375 6:44648235-44648257 GCCACGGAGCTGGGGTTCCTTGG - Intergenic
1019162521 6:170078620-170078642 GACACGGTGATGAAGGACCTCGG - Intergenic
1019162526 6:170078651-170078673 GACACGGTGATGAAGGACCTCGG - Intergenic
1019162559 6:170078867-170078889 GACACGGTGATGAAGGACCTTGG - Intergenic
1019162577 6:170078989-170079011 GACACGGTGATGAAGGACCTCGG - Intergenic
1022442864 7:30448153-30448175 GCCCAGGAGTTGAGAGTCCTGGG - Intronic
1027851754 7:83460737-83460759 GGCACGGAGATAAGGGGCCGGGG - Intronic
1030304165 7:108002638-108002660 GCCCGGGGGATGAGGGTCCGCGG + Intronic
1032439701 7:131933110-131933132 TCCACGGAGATGAGGAGCTTGGG - Intergenic
1034867044 7:154650637-154650659 GTGACTGAGCTGAGGGTCCTGGG - Intronic
1037662954 8:20942885-20942907 GCCATGCAGATCAGTGTCCTGGG + Intergenic
1039828350 8:41193719-41193741 GCCACAGAGATGAGAGTGTTGGG + Intergenic
1041780391 8:61572639-61572661 GCCATGGAGATGAGGGAAGTGGG - Intronic
1043816888 8:84812617-84812639 GGGACGGAGATGAGGTTCCCAGG + Intronic
1049292710 8:141812980-141813002 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292718 8:141813004-141813026 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292775 8:141813165-141813187 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292799 8:141813235-141813257 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292863 8:141813417-141813439 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049292949 8:141813644-141813666 GTCAGGGAGATGAGGGTGCTGGG - Intergenic
1049313050 8:141943545-141943567 GCCGCAGAGAGGAGGGTCCACGG - Intergenic
1053643478 9:40108390-40108412 GCCACGGAGAAGCAGGGCCTGGG + Intergenic
1053643814 9:40109919-40109941 GCCGCGGAGAAGCGGGGCCTGGG + Intergenic
1053644280 9:40111794-40111816 GCCACGGAGAAGGGGGGCCTGGG + Intergenic
1053644333 9:40111991-40112013 GCCACGGAGAAGGGAGGCCTGGG + Intergenic
1053644437 9:40112382-40112404 GCCGCGGAGAAGCGGGGCCTGGG + Intergenic
1053761553 9:41352494-41352516 GCCACGGAGAAGCGGGGCCTGGG - Intergenic
1053761724 9:41353107-41353129 GCCGCGGAGAAGCGGGGCCTGGG - Intergenic
1053761825 9:41353496-41353518 GCCACGGAGAAGGGAGGCCTGGG - Intergenic
1053761877 9:41353693-41353715 GCCACGGAGAAGGGGGGCCTGGG - Intergenic
1053762338 9:41355570-41355592 GCCGCGGAGAAGCGGGGCCTGGG - Intergenic
1053920616 9:42985719-42985741 GCCACGGAGGTGGGGGAGCTAGG - Intergenic
1054324333 9:63705618-63705640 GCCACGGAGAAGCAGGGCCTGGG + Intergenic
1054324669 9:63707147-63707169 GCCGCGGAGAAGCGGGGCCTGGG + Intergenic
1054325129 9:63709037-63709059 GCCACGGAGAAGGGGGGCCTGGG + Intergenic
1054325182 9:63709234-63709256 GCCACGGAGAAGGGAGGCCTGGG + Intergenic
1054325284 9:63709629-63709651 GCCGCGGAGAAGCGGGGCCTGGG + Intergenic
1054325452 9:63710238-63710260 GCCACGGAGAAGCGGGGCCTGGG + Intergenic
1054325508 9:63710432-63710454 GCCACGGAGAAGCGGGGACTGGG + Intergenic
1054350685 9:64015413-64015435 GCCACGGAGAAGGGAGGCCTGGG - Intergenic
1054540147 9:66263611-66263633 GCCACGGAGAAGCGGGGCCTGGG - Intergenic
1054540418 9:66264616-66264638 GCCACGGAGAAGGGAGGCCTGGG - Intergenic
1054540471 9:66264813-66264835 GCCACGGAGAAGGGGGGCCTGGG - Intergenic
1054540934 9:66266689-66266711 GCCGCGGAGAAGCGGGGCCTGGG - Intergenic
1054541274 9:66268214-66268236 GCCACGGAGAAGCAGGGCCTGGG - Intergenic
1060188865 9:121579725-121579747 GCCACAGAGATGAAGCTCCAAGG - Intronic
1060603547 9:124894660-124894682 TTCACTGAGATGGGGGTCCTGGG - Intronic
1061297047 9:129682432-129682454 GCTAGGGAGATGAGCGTCCTTGG - Intronic
1062409216 9:136413888-136413910 GCCACGAAGAAGAGGGAGCTTGG - Intronic
1202791228 9_KI270719v1_random:91361-91383 GCCACGGAGAAGCAGGGCCTGGG + Intergenic
1202791724 9_KI270719v1_random:93512-93534 GCCACGGAGAAGGGGGGCCTGGG + Intergenic
1202791776 9_KI270719v1_random:93709-93731 GCCACGGAGAAGGGAGGCCTGGG + Intergenic
1202791880 9_KI270719v1_random:94100-94122 GCCGCGGAGAAGCGGGGCCTGGG + Intergenic
1202792042 9_KI270719v1_random:94712-94734 GCCACGGAGAAGCGGGGACTGGG + Intergenic
1203697865 Un_GL000214v1:114355-114377 GCCACGGAGAGGTGGGGTCTGGG + Intergenic
1203697916 Un_GL000214v1:114571-114593 GCCACAGAGAAGTGGGGCCTGGG + Intergenic
1203551290 Un_KI270743v1:166416-166438 GCCACGGAAAAGTGGGGCCTGGG - Intergenic
1186508070 X:10110010-10110032 GCCACGGAGAGGTGGGTCAGCGG + Exonic
1188736774 X:33726734-33726756 GCCACGGAGATGGGGATGCGGGG + Intergenic
1190277739 X:48910086-48910108 GCCATGGCTAGGAGGGTCCTGGG - Intronic
1192404627 X:70871916-70871938 GCCAGGGAGATGAGAGAGCTAGG - Intronic
1197762354 X:130036821-130036843 ACCACCCAGATGAGTGTCCTTGG + Intronic
1199233594 X:145467167-145467189 GCAAGGTGGATGAGGGTCCTTGG + Intergenic
1199728016 X:150604109-150604131 TCCATGGAGATGTGAGTCCTTGG + Intronic
1200086429 X:153609527-153609549 GACACGGGGATGAAGGTCATGGG + Intergenic
1201151286 Y:11096887-11096909 GCCTCAGAGAAGAGGGGCCTGGG - Intergenic
1201151904 Y:11099290-11099312 GCCACGGAGAGGGGGGTCCTGGG - Intergenic
1201152122 Y:11100148-11100170 GCCACGGAGAAGCGGGGACTGGG - Intergenic
1201152563 Y:11102023-11102045 GCCACGGAGAAGCGGGGCCTGGG - Intergenic