ID: 1159944168

View in Genome Browser
Species Human (GRCh38)
Location 18:74431336-74431358
Sequence GCTGACGTGGCCTGTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159944168_1159944171 2 Left 1159944168 18:74431336-74431358 CCAGCACCACAGGCCACGTCAGC No data
Right 1159944171 18:74431361-74431383 CTCAGACGAGACACTCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159944168 Original CRISPR GCTGACGTGGCCTGTGGTGC TGG (reversed) Intergenic