ID: 1159945889

View in Genome Browser
Species Human (GRCh38)
Location 18:74444703-74444725
Sequence GTCGAGAACCGGACTGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159945883_1159945889 4 Left 1159945883 18:74444676-74444698 CCTTGAACCTCAGGGTCTGCAAG 0: 1
1: 0
2: 0
3: 21
4: 227
Right 1159945889 18:74444703-74444725 GTCGAGAACCGGACTGGTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 47
1159945886_1159945889 -3 Left 1159945886 18:74444683-74444705 CCTCAGGGTCTGCAAGAAGGGTC 0: 1
1: 0
2: 2
3: 23
4: 130
Right 1159945889 18:74444703-74444725 GTCGAGAACCGGACTGGTGAAGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159945889 Original CRISPR GTCGAGAACCGGACTGGTGA AGG Intronic
907270903 1:53290609-53290631 GTAAAGAACCGGGCTGGGGATGG - Intronic
911301465 1:96179584-96179606 GTGGAGAGCCAGACTAGTGATGG - Intergenic
918774784 1:188613124-188613146 GACAAGAAGCGGACTTGTGACGG + Intergenic
1066317016 10:34258260-34258282 GTGGAGAACAAGACTGGAGATGG + Intronic
1075247827 10:120839802-120839824 GTCGAGACCAGGACTGGAAAGGG + Intergenic
1083672229 11:64305879-64305901 GTCGAGGGTCGGACTGGTCAGGG + Intronic
1090840489 11:130483391-130483413 GTGTAGAACCAGACTGGTGGGGG + Intergenic
1096095939 12:48935756-48935778 GTCCAGAACTAGACTAGTGAGGG + Exonic
1096796057 12:54078270-54078292 GGCGAGAACCGGTTTTGTGAGGG - Intergenic
1105344782 13:19561824-19561846 GTCGAGGTCCGGACTGGTCAGGG - Intergenic
1105535258 13:21259743-21259765 GTGGAGGGCCGGACTGGTCAGGG + Intergenic
1126560689 15:50040482-50040504 GCCAAGACCCTGACTGGTGAAGG + Intronic
1131367770 15:91854120-91854142 CTCGAGAGCCGGGCTGGGGAAGG - Intronic
1134802854 16:17101322-17101344 GTAGAGAGCCAGACAGGTGAAGG - Intergenic
1140451088 16:75071414-75071436 GTGGAGAACCAGACACGTGAGGG - Intronic
1145240898 17:21240687-21240709 GGCGAGAACCTGACTGGGGCAGG - Exonic
1152164235 17:78691695-78691717 GTGGCTCACCGGACTGGTGATGG - Intronic
1159943420 18:74426139-74426161 GTCGAGAACAGGCCTGGGGGAGG - Intergenic
1159945889 18:74444703-74444725 GTCGAGAACCGGACTGGTGAAGG + Intronic
1164762543 19:30738676-30738698 TTGGAGAACTGGCCTGGTGAGGG + Intergenic
1165767828 19:38361959-38361981 TTGGAGAACAGGACTGGTGGTGG + Intronic
1166674026 19:44728327-44728349 GGTGAGAACAGGACTGGGGAGGG - Intergenic
927208479 2:20624660-20624682 GTCCAGACCCTGCCTGGTGATGG + Intronic
932432437 2:71684017-71684039 GTCTAGAACCAGGGTGGTGAAGG + Intronic
933509624 2:83223495-83223517 GTCGAGAAAAGGATTGGTTAAGG - Intergenic
1175964907 20:62655559-62655581 GTGGGGAACAGGGCTGGTGAGGG + Intronic
1176553369 21:8240760-8240782 TTCGAGCACCGAAGTGGTGATGG - Intergenic
1176572291 21:8423784-8423806 TTCGAGCACCGAAGTGGTGATGG - Intergenic
1176580200 21:8468344-8468366 TTCGAGCACCGAAGTGGTGATGG - Intergenic
1178606287 21:34038841-34038863 GTCAGGAAGCTGACTGGTGATGG + Intergenic
1184804818 22:46787769-46787791 GTAGAGAACCAGAATGGGGAGGG + Intronic
1203258367 22_KI270733v1_random:157788-157810 TTCGAGCACCGAAGTGGTGATGG - Intergenic
949570332 3:5285958-5285980 GTTGAGAACCTCAGTGGTGAAGG + Intergenic
961664825 3:128488630-128488652 GTGGAGACCCGGACTGGCGCCGG + Intronic
963071716 3:141310259-141310281 ATCAAGGACTGGACTGGTGAAGG - Intergenic
969728569 4:8940002-8940024 GGAGAGAACCGGAGTGGGGAGGG + Intergenic
980551016 4:134335350-134335372 GTAGAGAAATGGAATGGTGATGG + Intergenic
1001993360 5:176134851-176134873 GTCCAGAGCCGGCCTGCTGAGGG + Intergenic
1002000989 5:176196180-176196202 GTCCAGAGCCGGCCTGCTGAGGG + Intergenic
1002253346 5:177942792-177942814 GTCCAGAGCCGGCCTGCTGAGGG - Intergenic
1005652936 6:27901368-27901390 GTCGATAACAGGTCTGGGGATGG + Intergenic
1011839400 6:91477871-91477893 GTCGTGAAAGGGACTGGTGTAGG - Intergenic
1020353656 7:7252914-7252936 ATTGAGAACAGGACTGGTGGTGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1036981651 8:13475793-13475815 GTCAAGAACTGAACTTGTGATGG + Intronic
1049812240 8:144580733-144580755 GGTGAGAGCGGGACTGGTGAAGG - Intronic
1060891170 9:127189469-127189491 GTCCAGAACCTGGCTGGCGACGG - Intronic
1061308108 9:129744189-129744211 GTCCAGGACAGGGCTGGTGATGG - Intronic
1203474561 Un_GL000220v1:139804-139826 TTCGAGCACCGAAGTGGTGATGG - Intergenic