ID: 1159946622

View in Genome Browser
Species Human (GRCh38)
Location 18:74448612-74448634
Sequence GTGCACACACACTTCCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159946622_1159946628 21 Left 1159946622 18:74448612-74448634 CCAAGAGGGAAGTGTGTGTGCAC 0: 1
1: 0
2: 3
3: 28
4: 227
Right 1159946628 18:74448656-74448678 CCAGGCATCAGGAGAAGCCTGGG 0: 1
1: 0
2: 4
3: 23
4: 333
1159946622_1159946625 10 Left 1159946622 18:74448612-74448634 CCAAGAGGGAAGTGTGTGTGCAC 0: 1
1: 0
2: 3
3: 28
4: 227
Right 1159946625 18:74448645-74448667 ATGCACGAGCACCAGGCATCAGG 0: 1
1: 0
2: 0
3: 5
4: 84
1159946622_1159946624 3 Left 1159946622 18:74448612-74448634 CCAAGAGGGAAGTGTGTGTGCAC 0: 1
1: 0
2: 3
3: 28
4: 227
Right 1159946624 18:74448638-74448660 ACAGTGTATGCACGAGCACCAGG 0: 1
1: 0
2: 1
3: 1
4: 55
1159946622_1159946626 20 Left 1159946622 18:74448612-74448634 CCAAGAGGGAAGTGTGTGTGCAC 0: 1
1: 0
2: 3
3: 28
4: 227
Right 1159946626 18:74448655-74448677 ACCAGGCATCAGGAGAAGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159946622 Original CRISPR GTGCACACACACTTCCCTCT TGG (reversed) Intronic
900177612 1:1297768-1297790 GTGCACACACACGTGCCACCGGG - Intronic
900409186 1:2505120-2505142 GTGCATCCACACTGCCCTCGTGG - Exonic
903012032 1:20338048-20338070 CTGCACACACACTGCCCAGTTGG + Intronic
903678794 1:25083319-25083341 GAGCCCACCCACTACCCTCTGGG - Intergenic
904747650 1:32720824-32720846 GTGCACAGCCATGTCCCTCTAGG - Intergenic
906214873 1:44032860-44032882 GTGCACACACACCTGGATCTAGG + Intergenic
907936895 1:59049501-59049523 ATGCACACACATTCCCTTCTCGG - Intergenic
908462867 1:64363175-64363197 GGGCACACACACTTTTCTCGTGG + Intergenic
909884618 1:80925351-80925373 CTCCACACCAACTTCCCTCTTGG - Intergenic
911220277 1:95238006-95238028 ATGCACAAACACTCCCCTTTGGG - Intronic
915489447 1:156243065-156243087 GAGCTCACACACCTCCCTCCTGG - Exonic
918393300 1:184088873-184088895 GGGCAGACACACTTCACTTTAGG - Intergenic
1063374990 10:5548963-5548985 GTGCACACACACACGCCTCCTGG + Intergenic
1064397014 10:14990361-14990383 GTGTACACACACTTCGATATTGG - Intergenic
1064399928 10:15012828-15012850 GTGCACACACACTTCGATATTGG - Intergenic
1067549391 10:47223216-47223238 GTGCAAACACCCTTCCCACCAGG - Intergenic
1067565769 10:47335750-47335772 GTGCTCACACACTGCCCACCTGG - Intergenic
1069795867 10:71051353-71051375 TTACTCACACAGTTCCCTCTTGG - Intergenic
1069839096 10:71328019-71328041 GTGCAGACACTCTTCTCTCCGGG - Intronic
1070166855 10:73905470-73905492 CTGCACACACACCTGCCTCCAGG + Intergenic
1070504116 10:77098065-77098087 GTGTAGACACAGATCCCTCTAGG - Intronic
1070952297 10:80441109-80441131 TTGCACACACTCCTCCCACTTGG - Intergenic
1072448350 10:95518922-95518944 GTGCAGCCCCACCTCCCTCTGGG + Intronic
1072551249 10:96479402-96479424 ATGCCCACACATTTCCCTCCAGG + Intronic
1073152930 10:101323949-101323971 GTGCACACGCCTTTCCTTCTTGG + Intergenic
1075319975 10:121483614-121483636 TTACACACACACTCCCCTGTTGG - Intronic
1076115089 10:127889898-127889920 GTGGACACCCACCTCCTTCTCGG - Intronic
1077532847 11:3105378-3105400 GTCCACACACACTGTCCACTGGG - Intronic
1079569571 11:21925758-21925780 GTGCACACACACACTTCTCTGGG - Intergenic
1080601126 11:33821224-33821246 ATGCACCCACACTGCCCTTTAGG - Intergenic
1083283958 11:61645859-61645881 TTTCACACAAACTTCCCTCATGG + Intergenic
1083841563 11:65307842-65307864 GTGCTTACCCACTACCCTCTTGG + Intergenic
1083892210 11:65601215-65601237 GCGCACACACTATTCACTCTGGG + Intronic
1084227497 11:67726341-67726363 GTGTACACACACTTCGATATTGG - Intergenic
1084260917 11:67978038-67978060 GTGTACACACACTTCGATATTGG - Intergenic
1084807706 11:71590524-71590546 GTGTACACACACTTCGATATTGG + Intronic
1084811728 11:71616080-71616102 GTGTACACACACTTCGATATTGG + Intergenic
1086603530 11:88665179-88665201 ACACACACACACATCCCTCTTGG + Intronic
1086779473 11:90884102-90884124 GAGCAGATACACTTCCCTATTGG - Intergenic
1089192326 11:116662023-116662045 GTGCAGACACTCTTCCTTCCTGG + Intergenic
1089474608 11:118748696-118748718 GTGCAGACACCCTCCCTTCTGGG + Exonic
1089696632 11:120219899-120219921 GTGCAGACACTCTTTCTTCTCGG - Intronic
1091612146 12:2020087-2020109 GTGCACACACACACTTCTCTTGG + Intronic
1091912487 12:4243349-4243371 CAGCAACCACACTTCCCTCTGGG + Intergenic
1092148238 12:6229434-6229456 TTACACACCCACTCCCCTCTGGG + Intronic
1092432174 12:8418588-8418610 GTGTACACACACTTCGATATTGG - Intergenic
1092435137 12:8441453-8441475 GTGTACACACCCTTCCATATTGG - Intergenic
1093417650 12:18938510-18938532 GCACACACACACTGCCCTTTAGG + Intergenic
1096506704 12:52098291-52098313 GTGTACACACACTTCGATATTGG + Intergenic
1096508816 12:52115544-52115566 GTGTACACACACTTCGATATTGG - Intergenic
1096721232 12:53524234-53524256 GGGCAAACACATTTCCCTTTTGG + Intronic
1098657317 12:73049074-73049096 GTGAACATACACTTCCCTGTAGG - Intergenic
1099641623 12:85295661-85295683 ATGCTCACACACTTTCCTGTGGG - Intronic
1102692250 12:114770519-114770541 GTGCATACCCACTGCCATCTGGG + Intergenic
1104535046 12:129610942-129610964 GTGAATGCACGCTTCCCTCTGGG - Intronic
1106008684 13:25796628-25796650 GTGGAGAAATACTTCCCTCTGGG - Intronic
1109326120 13:60869933-60869955 GTGCACTCACACTTGCCTACTGG + Intergenic
1109354001 13:61217624-61217646 GAGCACACACACTTCGATATTGG - Intergenic
1110074653 13:71224437-71224459 GTGCACACGCAGTCTCCTCTAGG + Intergenic
1110534137 13:76631295-76631317 TTACACACACATTTACCTCTGGG - Intergenic
1112299911 13:98220347-98220369 GGGCACACACACCTCCCTGCAGG - Intronic
1112773210 13:102814453-102814475 CTGTACTCACACTTTCCTCTAGG - Intronic
1113223267 13:108129635-108129657 ATGCACTCACACTAACCTCTGGG + Intergenic
1115430204 14:33308608-33308630 GTGCACACACACACCCCTTCAGG + Intronic
1116944229 14:50821338-50821360 GTGCACACACACATCCCTGCTGG + Intronic
1117038996 14:51753003-51753025 GTGCACTCACACTTCGATATTGG + Intergenic
1118111345 14:62723680-62723702 GTACCCAAACACTTGCCTCTTGG - Intronic
1119191934 14:72688876-72688898 GAGCTCAAACACTCCCCTCTGGG - Intronic
1119209986 14:72824292-72824314 GTCCAAACCCACATCCCTCTTGG - Intronic
1119687430 14:76643861-76643883 GTGCAGAAACATTTCCCTCTGGG - Intergenic
1121513386 14:94531454-94531476 GTCCACATAATCTTCCCTCTGGG + Intergenic
1121715570 14:96071571-96071593 GTGAACACACACTGCCCCCTGGG + Intronic
1122133523 14:99619823-99619845 GTGCACAAACACGTCCCCATAGG - Intergenic
1122278348 14:100606927-100606949 ATGCCCAGACACTCCCCTCTTGG + Intergenic
1122752057 14:103943846-103943868 GTGGCCACACACGTCACTCTGGG - Intronic
1123543346 15:21317473-21317495 GTGCACACACACACACCTCCAGG + Intergenic
1124952232 15:34334367-34334389 GTTAATATACACTTCCCTCTAGG - Intronic
1128690811 15:69723575-69723597 GTGCAGACAGACCTCCCCCTAGG - Intergenic
1129698986 15:77756900-77756922 GTTCACACACTCATCCCTCAGGG + Intronic
1129702140 15:77774173-77774195 GTGCACACTCACCACCCTCTAGG - Intronic
1129900663 15:79145945-79145967 GTGCACACACACTGCTTTCCTGG - Intergenic
1131159787 15:90098166-90098188 TTGCACAAACACTGTCCTCTTGG + Intronic
1131467831 15:92669615-92669637 CTGCCCACACACATTCCTCTAGG + Intronic
1133617893 16:7496097-7496119 GTGCACACATCCTACCTTCTGGG + Intronic
1136383635 16:29909359-29909381 CTGCACACACTGTTGCCTCTTGG - Intronic
1137767093 16:50986158-50986180 GTGCACACACATTGTACTCTTGG + Intergenic
1138151092 16:54657755-54657777 TTGCACCCCCATTTCCCTCTAGG - Intergenic
1139473411 16:67190235-67190257 GTGCAGACACTCTTTCCTGTTGG - Intergenic
1139786180 16:69394246-69394268 GGGCACAGACATCTCCCTCTGGG - Intronic
1141673147 16:85503312-85503334 CTGCCCACACCCTTCCCTCCTGG - Intergenic
1142204598 16:88776856-88776878 GAGCACACACATTCCCCTCTTGG - Intronic
1142244930 16:88966028-88966050 GTGCATACAGAGTTCCCCCTGGG + Intronic
1203141782 16_KI270728v1_random:1771679-1771701 GTGCCCACACTCTCCCCTCTGGG - Intergenic
1143205892 17:5139082-5139104 CAGCACACACCCCTCCCTCTGGG + Intronic
1144843167 17:18201261-18201283 GTGCATACACCCTGCCCTTTTGG + Intronic
1147028259 17:37608815-37608837 GTCCACACACACACCCCCCTTGG + Intronic
1149336561 17:55642014-55642036 GTGAACCTACAGTTCCCTCTGGG + Intergenic
1151206717 17:72513265-72513287 GTGAACACAGACATCCCTCTCGG - Intergenic
1151558486 17:74859073-74859095 GTGCACACACACCTGCCGCAGGG - Intronic
1152165913 17:78705692-78705714 GTGCAGAATCACTTCCGTCTTGG + Intronic
1152467376 17:80473952-80473974 GTGCCCACACACTTCCCTCCAGG + Intronic
1152878093 17:82799771-82799793 GTGAACACAGACCTCCCTCTTGG + Intronic
1153648088 18:7213159-7213181 GTGCACAGACACCTTTCTCTGGG + Intergenic
1159946622 18:74448612-74448634 GTGCACACACACTTCCCTCTTGG - Intronic
1161194365 19:2977919-2977941 GTGCACATACACTCCCTGCTGGG - Intronic
1161778573 19:6277283-6277305 GTCCAAACACACTTCCCTCCAGG + Intronic
1165768999 19:38367643-38367665 GTGCACACAGACTGGCCTCCGGG - Intronic
1165946428 19:39445631-39445653 CTGCACACGCACTTACCTCTCGG - Exonic
1167747773 19:51362919-51362941 GTCCACACCAGCTTCCCTCTGGG + Intronic
1167748274 19:51365599-51365621 GTCCACACCAGCTTCCCTCTGGG + Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
925598421 2:5583269-5583291 GTTCAGAAGCACTTCCCTCTGGG + Intergenic
926836697 2:17031384-17031406 CTCCACACACACTCCCCACTGGG - Intergenic
927443073 2:23133428-23133450 GAGCCCACTCACTTCCTTCTGGG - Intergenic
929449101 2:42024874-42024896 GATCAAACACACTTCCCTTTAGG - Intergenic
931317351 2:61145029-61145051 GCGCACACAAACTTTCCGCTAGG + Intergenic
931390441 2:61838369-61838391 GTGCACACACACTCACCTCATGG - Intronic
932820339 2:74894458-74894480 GTGCCAACACACTTCCTGCTAGG - Intergenic
932989514 2:76769408-76769430 GTGAACACAAACTTCTCTATTGG + Intronic
936937395 2:117851520-117851542 GCACACACACACACCCCTCTGGG - Intergenic
939909352 2:147962087-147962109 GTGCCTACACACTACCCTCCTGG - Intronic
940874602 2:158886686-158886708 GTGTACACACACTTCGATATTGG + Intergenic
944905526 2:204257965-204257987 ATGCACACACACTTCCCTTTTGG + Intergenic
945568867 2:211439028-211439050 GTGCATACACACTTGCATGTAGG + Intronic
946322886 2:218963703-218963725 CTGCACACACACACCCCTCCAGG + Intergenic
947319017 2:228896277-228896299 TGGCACACACTATTCCCTCTTGG + Intronic
948583959 2:239006924-239006946 GGGCACAGCCACTTCCCTTTAGG + Intergenic
1168740374 20:185196-185218 GAGCAAACAGACCTCCCTCTTGG + Intergenic
1170702785 20:18718699-18718721 ATGCACACACACACCCCTCTAGG + Intronic
1172854404 20:37990824-37990846 GTGCACACACACCCCACGCTTGG + Intronic
1172890247 20:38259240-38259262 GTGTACACACACATGGCTCTTGG - Intronic
1173720160 20:45251333-45251355 GTTCACAAACATTTGCCTCTGGG + Intergenic
1173726040 20:45298397-45298419 GTGCGCACCGAGTTCCCTCTGGG - Exonic
1176002645 20:62839866-62839888 ACGCACACACACTGCTCTCTGGG + Intronic
1176346333 21:5751660-5751682 GGGCACAAAAACTTTCCTCTGGG + Intergenic
1176353147 21:5872244-5872266 GGGCACAAAAACTTTCCTCTGGG + Intergenic
1176498494 21:7572795-7572817 GGGCACAAAAACTTTCCTCTGGG - Intergenic
1176540654 21:8149730-8149752 GGGCACAAAAACTTTCCTCTGGG + Intergenic
1176559605 21:8332775-8332797 GGGCACAAAAACTTTCCTCTGGG + Intergenic
1178632327 21:34273413-34273435 TTGGACATACACTTCCCTTTGGG + Intergenic
1179444844 21:41424057-41424079 GTGAACAGAGACTTCACTCTGGG - Intronic
1179671866 21:42954953-42954975 GTGTACACACACTTCGATATTGG - Intergenic
1179677988 21:42997780-42997802 GCCCAGACACACTTCCCTCTGGG - Intronic
1179935259 21:44599975-44599997 GTGCACCCCCTCTTCCATCTGGG - Intronic
1180934988 22:19619589-19619611 TTGCACACACACTCACCTCAGGG + Intergenic
1181324604 22:22034907-22034929 GTGCCCACACACTTCCAAGTGGG + Intergenic
1182202030 22:28582956-28582978 GTGAACACACTCTTTCCTCTGGG - Intronic
1182741333 22:32570153-32570175 CTCCACACACACTGCCTTCTAGG + Intronic
1183507038 22:38214992-38215014 GTGCACACACATTCCCTTCGTGG + Exonic
1183741970 22:39673902-39673924 GTGCACACACACGTCCCCACCGG + Intronic
1185040029 22:48499098-48499120 GTGCAGAGACACCTCCCTCCCGG - Intronic
1203245595 22_KI270733v1_random:66148-66170 GGGCACAAAAACTTTCCTCTGGG + Intergenic
950073969 3:10174077-10174099 ATCCACACACACTCCCATCTTGG - Intronic
950155582 3:10719184-10719206 GCTCACACACACTGTCCTCTAGG - Intergenic
950267789 3:11588120-11588142 GTGGAAACACTCTTCCCTTTGGG - Intronic
950380789 3:12613150-12613172 GGGCACTCACACTTCCCAGTAGG - Intronic
952924910 3:38313694-38313716 GTGCACGCGCACTTGCCTCCTGG + Intronic
953693977 3:45143711-45143733 GTGCACACACACACTCTTCTGGG - Intronic
957044188 3:75361409-75361431 GTGTACACACACTTCGATATTGG - Intergenic
958932867 3:100226078-100226100 GTCCACAAACCCTTCCCTATAGG - Intergenic
961275314 3:125721594-125721616 GTGTACACACACTTCGATATTGG + Intergenic
961278227 3:125744215-125744237 GTGTACACACACTTCGATATTGG + Intergenic
961876179 3:130025440-130025462 GTGTACACACACTTCGATATTGG - Intergenic
962622491 3:137193582-137193604 GTGCTCACATACTTCCTACTGGG - Intergenic
966988655 3:185206001-185206023 GTGCACAGTCACTTTGCTCTGGG - Intronic
968067889 3:195768936-195768958 CTGCACACACACTCCCATCCTGG - Intronic
968489867 4:884208-884230 GTGCACACACACGTTCCTCCTGG - Intronic
969024142 4:4160285-4160307 GTGTACACACACTTCGATATTGG - Intergenic
969729678 4:8946854-8946876 GTGTACACACACTTCGATATTGG + Intergenic
969734420 4:8977532-8977554 GTGAACACACACTTCGATATTGG + Intergenic
969785842 4:9456405-9456427 GTGTACACACACTTCGATATTGG + Intergenic
969789264 4:9480810-9480832 GTGTACACACACTTCAATATTGG + Intergenic
973660349 4:53098723-53098745 GTGCACACACACATGCATGTAGG - Intronic
973739839 4:53909221-53909243 GGGAAGACAGACTTCCCTCTTGG + Intronic
974208409 4:58737724-58737746 GTGAAAACAAACTTCCGTCTAGG - Intergenic
983529051 4:168791119-168791141 CTGCAAACACACTTCCTCCTGGG - Intronic
984223510 4:177006359-177006381 TTGCACACTCTCTTACCTCTGGG - Intergenic
986347839 5:6850987-6851009 GTCCACACACCCTTCTCTCCTGG - Intergenic
986883037 5:12198879-12198901 GAGCACACACACCCCTCTCTGGG + Intergenic
986923790 5:12720703-12720725 GTGCACACACACTCATCTCTAGG + Intergenic
994392010 5:99200784-99200806 GTGCACACACCCTGCGCTATTGG + Intergenic
994595383 5:101826294-101826316 GTGCACACAAAATTACCTATAGG - Intergenic
994889543 5:105613492-105613514 GTGCACACACACATTGCTCATGG - Intergenic
994972684 5:106761759-106761781 TTGCACACACAGTTCCCAATTGG + Intergenic
995234632 5:109813636-109813658 GAGCACACAGGCTTCCTTCTAGG - Intronic
996646688 5:125826280-125826302 GTTCACATCCCCTTCCCTCTGGG - Intergenic
998653698 5:144150805-144150827 GTACACACACACTTGCCACCTGG - Intergenic
1001115467 5:168935648-168935670 ATGCACTCAAACTTCCCTTTTGG - Intronic
1001904534 5:175460894-175460916 GTTCACAAAGACTTCACTCTGGG - Intergenic
1002635900 5:180608653-180608675 GGGCACACACACTCTCCTCCAGG - Intronic
1005813284 6:29531907-29531929 CTGCACACACACCTCGCTCTGGG + Intergenic
1007463160 6:42032688-42032710 CAGCACAGCCACTTCCCTCTGGG + Intronic
1007697736 6:43744396-43744418 GTGCACACACACAGCCAACTGGG - Intergenic
1009047192 6:58246565-58246587 GTGTACACACCCTTCCATATTGG - Intergenic
1009223001 6:61000862-61000884 GTGTACACACCCTTCCATATTGG - Intergenic
1009817646 6:68756407-68756429 GTGCACACACAGTTCCCCCTTGG - Intronic
1013477070 6:110518448-110518470 GTGCACAAAATCTTTCCTCTGGG + Intergenic
1013786768 6:113789961-113789983 CTGCCCACACACTTCCCACACGG + Intergenic
1014380347 6:120733168-120733190 GTGCCCTCACACTACCCTATAGG - Intergenic
1014878959 6:126697692-126697714 GTGCACAAACACTTTTCTTTAGG - Intergenic
1020543115 7:9487509-9487531 GTGCACACACATTTTACTCAAGG + Intergenic
1022415747 7:30175554-30175576 GTGCCCACACACTTGGCTCTGGG - Intergenic
1023171239 7:37391894-37391916 GGGTACACACACTTCCCTACAGG - Intronic
1027485826 7:78760731-78760753 TTGCACACACACTTACATATCGG - Intronic
1027976021 7:85156967-85156989 ATGCAAACACACTTCCATTTGGG - Intronic
1029077981 7:97950850-97950872 GTGTACACACACTTCGATATTGG - Intergenic
1029327627 7:99823467-99823489 GTGCACACTTCCTCCCCTCTAGG + Intergenic
1029585656 7:101469177-101469199 GTGCAGACACACAGCCCTCCTGG + Intronic
1030086058 7:105816667-105816689 CAGCACACACATTTCCCACTGGG - Intronic
1032902628 7:136327317-136327339 GGGCACATACACTTCTCCCTTGG - Intergenic
1036156737 8:6348979-6349001 GTCCACACTCAATTCCCTTTTGG - Intergenic
1036240023 8:7073659-7073681 GTGTACACACACTTCGATATTGG + Intergenic
1036425685 8:8643389-8643411 GTGTACACACCCTTCCCTTTTGG + Intergenic
1036819977 8:11932578-11932600 GTGTACACACACTTCGATATTGG - Intergenic
1036903299 8:12687922-12687944 GTGTACACACACTTCGATATTGG - Intergenic
1036905799 8:12707588-12707610 GTGTACACACACTTCGATGTTGG - Intergenic
1039583574 8:38686418-38686440 TTGAACACACCCTTCCCTCTGGG + Intergenic
1041519633 8:58740982-58741004 CTGCAAACACACTTCCATTTTGG + Intergenic
1042200185 8:66274073-66274095 GTTCACACACACATCCCTCCTGG - Intergenic
1045049704 8:98311654-98311676 GTGCACACACACACTCCTCCTGG - Intergenic
1045236180 8:100354299-100354321 GTGCTCACACACCTGCCTGTTGG + Intronic
1045337497 8:101221753-101221775 GTACACACACACACCCATCTTGG - Intergenic
1047668036 8:127113912-127113934 GGACCCAAACACTTCCCTCTAGG - Intergenic
1048287449 8:133152901-133152923 CGGCACACACACATCCCTCCCGG - Intergenic
1049213046 8:141395549-141395571 GTGCACCCCCACTTCCCCTTAGG + Intronic
1049522749 8:143102688-143102710 CTGCACACACACACCTCTCTGGG - Intergenic
1050988693 9:12117785-12117807 ATGCACACACACACCTCTCTGGG + Intergenic
1052807309 9:33024902-33024924 GTTCACACACAGCTCCCGCTGGG + Intronic
1053431870 9:38047401-38047423 GTGTACACACACCTCCCCTTCGG + Intronic
1055369146 9:75578199-75578221 GTGCACACACACCTATCTATGGG + Intergenic
1056866047 9:90228152-90228174 GTGTACACACACTTCGATATTGG + Intergenic
1056916978 9:90754754-90754776 GTGTACACACACTTCGATATTGG - Intergenic
1062389125 9:136327218-136327240 GTGCAGCCACACTGGCCTCTGGG - Intergenic
1203461933 Un_GL000220v1:49220-49242 GGGCACAAAAACTTTCCTCTGGG + Intergenic
1185550847 X:981379-981401 GTGTCCACACTCTGCCCTCTGGG + Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619232 X:1443226-1443248 GTGCACACACACCGCCGTCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1186032960 X:5390562-5390584 TTGCTCACACACCTCCCACTGGG - Intergenic
1186063255 X:5733543-5733565 GTGCAGACACATTTACCTGTTGG + Intergenic
1186788973 X:12978534-12978556 GTGCCCACACCCTTCCCTATAGG - Intergenic
1187352423 X:18532698-18532720 GTACACACACACTACTTTCTCGG - Intronic
1188027496 X:25226068-25226090 GTGCACAGACTCCTCTCTCTCGG - Intergenic
1190707631 X:53043841-53043863 CTCCAAACACACTACCCTCTGGG + Intergenic
1190737323 X:53264301-53264323 GTGCACACATATTTCTCTCACGG + Intronic
1190953969 X:55173235-55173257 TTGCACACACTCATCCCTCCTGG + Intronic
1192546798 X:72021020-72021042 GTGTACACACCCTCACCTCTAGG - Intergenic
1194563091 X:95447228-95447250 TTTCACACAGAGTTCCCTCTGGG - Intergenic
1197653489 X:129090415-129090437 GTGCACACACACTTCTTTTCTGG - Intergenic
1198824501 X:140685162-140685184 GTGGCCACACAGGTCCCTCTTGG + Intergenic
1201419669 Y:13784630-13784652 GTTTACATACACTTCACTCTTGG + Intergenic