ID: 1159948122

View in Genome Browser
Species Human (GRCh38)
Location 18:74458372-74458394
Sequence TTTCTATTATCTCTAAACTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159948122_1159948126 15 Left 1159948122 18:74458372-74458394 CCCGAGTTTAGAGATAATAGAAA No data
Right 1159948126 18:74458410-74458432 GCGTGCTGTGATTGTCCCACAGG No data
1159948122_1159948127 21 Left 1159948122 18:74458372-74458394 CCCGAGTTTAGAGATAATAGAAA No data
Right 1159948127 18:74458416-74458438 TGTGATTGTCCCACAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159948122 Original CRISPR TTTCTATTATCTCTAAACTC GGG (reversed) Intergenic
No off target data available for this crispr