ID: 1159948706

View in Genome Browser
Species Human (GRCh38)
Location 18:74463066-74463088
Sequence GGAGCTGCAGCCCAAGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159948701_1159948706 24 Left 1159948701 18:74463019-74463041 CCTGCACAAGAGGTGAGGAAAAT No data
Right 1159948706 18:74463066-74463088 GGAGCTGCAGCCCAAGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159948706 Original CRISPR GGAGCTGCAGCCCAAGAACG TGG Intergenic
No off target data available for this crispr