ID: 1159948780

View in Genome Browser
Species Human (GRCh38)
Location 18:74463592-74463614
Sequence ACGTACCCGGCACTGTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159948771_1159948780 -8 Left 1159948771 18:74463577-74463599 CCCGCCCTCACCCCCACGTACCC No data
Right 1159948780 18:74463592-74463614 ACGTACCCGGCACTGTCTTCAGG No data
1159948770_1159948780 -4 Left 1159948770 18:74463573-74463595 CCTTCCCGCCCTCACCCCCACGT No data
Right 1159948780 18:74463592-74463614 ACGTACCCGGCACTGTCTTCAGG No data
1159948772_1159948780 -9 Left 1159948772 18:74463578-74463600 CCGCCCTCACCCCCACGTACCCG No data
Right 1159948780 18:74463592-74463614 ACGTACCCGGCACTGTCTTCAGG No data
1159948769_1159948780 18 Left 1159948769 18:74463551-74463573 CCTACTGATGCTTGATGCTACTC No data
Right 1159948780 18:74463592-74463614 ACGTACCCGGCACTGTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159948780 Original CRISPR ACGTACCCGGCACTGTCTTC AGG Intergenic
No off target data available for this crispr