ID: 1159948916

View in Genome Browser
Species Human (GRCh38)
Location 18:74464969-74464991
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159948910_1159948916 20 Left 1159948910 18:74464926-74464948 CCAGTTACAGTTACAGTTACAGA No data
Right 1159948916 18:74464969-74464991 GTGTGTGTGTGGCAAGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159948916 Original CRISPR GTGTGTGTGTGGCAAGTGGG GGG Intergenic
No off target data available for this crispr