ID: 1159951133

View in Genome Browser
Species Human (GRCh38)
Location 18:74484784-74484806
Sequence CTTCAAATTCATATGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159951130_1159951133 -1 Left 1159951130 18:74484762-74484784 CCCATTCATTTATTCACTTACTC No data
Right 1159951133 18:74484784-74484806 CTTCAAATTCATATGGAGCCAGG No data
1159951131_1159951133 -2 Left 1159951131 18:74484763-74484785 CCATTCATTTATTCACTTACTCT No data
Right 1159951133 18:74484784-74484806 CTTCAAATTCATATGGAGCCAGG No data
1159951129_1159951133 2 Left 1159951129 18:74484759-74484781 CCACCCATTCATTTATTCACTTA No data
Right 1159951133 18:74484784-74484806 CTTCAAATTCATATGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159951133 Original CRISPR CTTCAAATTCATATGGAGCC AGG Intergenic
No off target data available for this crispr