ID: 1159952605

View in Genome Browser
Species Human (GRCh38)
Location 18:74496274-74496296
Sequence GCGTGGCGATGCCTGCCCTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159952595_1159952605 13 Left 1159952595 18:74496238-74496260 CCTCTGCCTGTGGCTGGATTGGT 0: 1
1: 0
2: 1
3: 19
4: 275
Right 1159952605 18:74496274-74496296 GCGTGGCGATGCCTGCCCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 85
1159952591_1159952605 18 Left 1159952591 18:74496233-74496255 CCACCCCTCTGCCTGTGGCTGGA 0: 1
1: 0
2: 3
3: 62
4: 424
Right 1159952605 18:74496274-74496296 GCGTGGCGATGCCTGCCCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 85
1159952592_1159952605 15 Left 1159952592 18:74496236-74496258 CCCCTCTGCCTGTGGCTGGATTG 0: 1
1: 0
2: 0
3: 31
4: 282
Right 1159952605 18:74496274-74496296 GCGTGGCGATGCCTGCCCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 85
1159952593_1159952605 14 Left 1159952593 18:74496237-74496259 CCCTCTGCCTGTGGCTGGATTGG 0: 1
1: 0
2: 0
3: 22
4: 252
Right 1159952605 18:74496274-74496296 GCGTGGCGATGCCTGCCCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 85
1159952598_1159952605 7 Left 1159952598 18:74496244-74496266 CCTGTGGCTGGATTGGTGGGCGT 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1159952605 18:74496274-74496296 GCGTGGCGATGCCTGCCCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159952605 Original CRISPR GCGTGGCGATGCCTGCCCTC CGG Exonic
900228900 1:1546052-1546074 CAGTGGCCATGCCTGGCCTCAGG + Intronic
900772980 1:4560695-4560717 GCATGGGGATGCCTCCCCTCAGG - Intergenic
901233408 1:7653832-7653854 GCTTGGCAAGGCCTGCCCTCAGG + Intronic
910200105 1:84690432-84690454 GCGAGGCGCTGCTGGCCCTCGGG - Exonic
910803772 1:91170602-91170624 GGATGGAGATACCTGCCCTCAGG + Intergenic
920030598 1:203035301-203035323 CCGTGGCCAGGCCTGCCATCTGG + Intronic
922962049 1:229655974-229655996 AGGTGGCGATGCCTGTCCTGTGG + Intronic
1067717897 10:48703929-48703951 GAGTGGCCATGCATGCCCCCAGG - Intronic
1068648214 10:59492933-59492955 GAGTGGGGGTGCCTGCCCGCAGG - Intergenic
1069792228 10:71030071-71030093 GCCTGGCCCTGCCTGCCTTCAGG + Intergenic
1070617785 10:77982198-77982220 GTGTGGCCATGACTGCCCGCAGG + Exonic
1070721442 10:78760030-78760052 CTGTGGCCAGGCCTGCCCTCAGG + Intergenic
1072979245 10:100085933-100085955 GAGAGGCGATGTATGCCCTCTGG - Intergenic
1075213931 10:120515558-120515580 GCCTGTCGATGCCCTCCCTCAGG + Intronic
1077057872 11:604336-604358 GAGGGGCGACGCCTGCCTTCAGG + Intronic
1077443700 11:2580511-2580533 GCGTGGGGATCCCCGTCCTCTGG - Intronic
1077468326 11:2744450-2744472 TCTTGGCTATGCCTGCTCTCAGG - Intronic
1077531016 11:3094756-3094778 GCGAGAAGATGCCTGCCCTCAGG - Intronic
1078495799 11:11815097-11815119 GCTTGCCGATGGCTGCCTTCTGG - Intergenic
1080628499 11:34052115-34052137 GCGCGGCGATGCCCCGCCTCCGG + Intronic
1081703384 11:45165651-45165673 GCGTGGTGTTGCCAGCCCTTCGG + Intronic
1084941885 11:72617393-72617415 GCCCGGTGATGCCTGCCCTGGGG + Intronic
1090387673 11:126366090-126366112 GAGTGGCTGTGCCAGCCCTCAGG - Intronic
1090390238 11:126383288-126383310 GAGTGGCTGTGCCAGCCCTCAGG - Intronic
1094169517 12:27478308-27478330 GGGTGGGAATGCCTGTCCTCAGG + Intronic
1103704092 12:122862128-122862150 GCGTGGGGCTCCCTGCCTTCTGG + Exonic
1104920914 12:132290289-132290311 GCATGGCGAGGCCTGTCCTAGGG - Intronic
1113914696 13:113863457-113863479 GCGCGGCGAGGCCTGGCCTCAGG - Intronic
1114259319 14:21025693-21025715 GCGTCCCGACGCCTGCTCTCCGG + Intronic
1117954477 14:61111913-61111935 GAGTGGCGAGGCCGGGCCTCCGG + Intergenic
1119165957 14:72492969-72492991 GCTTGCCAATGCCTGCCCTAGGG + Intronic
1121708876 14:96021971-96021993 GCATGGCCATGCCTGCTCCCAGG - Intergenic
1122802537 14:104238900-104238922 GCCAGGCTACGCCTGCCCTCAGG + Intergenic
1123701669 15:22918675-22918697 GCGTGGGGAAGGCTGACCTCTGG + Exonic
1126203342 15:46014738-46014760 GGCTGGGGAGGCCTGCCCTCAGG + Intergenic
1127837726 15:62804311-62804333 GCGCTGCCATGCCTGGCCTCTGG - Intronic
1129296516 15:74603120-74603142 GCGATGTGAGGCCTGCCCTCAGG - Intronic
1132712558 16:1276090-1276112 GCAGGGCGATGTCTGCCCCCAGG + Intergenic
1138337582 16:56265364-56265386 GCATGGCCAGGCCTGCCTTCTGG - Intronic
1141525119 16:84606215-84606237 AGGTGGCGATGCCTGGGCTCTGG + Intronic
1151718834 17:75844576-75844598 GCGGGGCCAGGCCTGCCCACGGG - Exonic
1152424078 17:80209547-80209569 GGGTGGCGATGCCCGTCCTCTGG - Exonic
1152424100 17:80209661-80209683 GGGTGGTGATGCCCGTCCTCTGG - Exonic
1152424111 17:80209718-80209740 GCATGGCGATGCCCGTCCTCTGG - Exonic
1152586835 17:81193007-81193029 TCGTGGCCTTGCCTGCCCCCGGG - Intronic
1152640886 17:81448762-81448784 GCTGGGAGCTGCCTGCCCTCGGG + Intronic
1157421413 18:47550677-47550699 GCCTGGAGCTGCCTGGCCTCAGG - Intergenic
1159952605 18:74496274-74496296 GCGTGGCGATGCCTGCCCTCCGG + Exonic
1160566093 18:79787576-79787598 CCGTGGAGATGTCTGGCCTCAGG - Intergenic
1160873947 19:1288713-1288735 GAGAGGCGATGCCTGCACCCAGG + Intronic
1160980912 19:1816200-1816222 GAGTGCCGGTGCCTGCCCTGGGG - Intronic
1163446397 19:17348983-17349005 GCGTGGCGCTGCCAGCTCCCAGG + Intergenic
1164537745 19:29098999-29099021 GCGTGGCCTTGGCTGCCCACTGG - Intergenic
925390354 2:3490123-3490145 GCCTGGGGGTGCCTGCCCTGGGG - Intergenic
935191944 2:100785083-100785105 AAGTTGCAATGCCTGCCCTCAGG + Intergenic
938464826 2:131518716-131518738 GATTGGCGGTGCCTGTCCTCAGG + Intergenic
938792182 2:134686321-134686343 GGGTTGCGAAGCCTGCCCCCGGG + Intronic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
1169196949 20:3688536-3688558 CAGTGGTGTTGCCTGCCCTCCGG - Exonic
1177654092 21:23994698-23994720 GCCTGCAGATGGCTGCCCTCTGG + Intergenic
1181314456 22:21962519-21962541 GCGGGGTGATGCCTTCCCTGTGG - Exonic
961041738 3:123682955-123682977 GCTGGGCGGTGCCTGCCCTCAGG + Intronic
961379334 3:126487071-126487093 TCTTGGGGAGGCCTGCCCTCAGG + Intronic
961445127 3:126976891-126976913 GTGTGGAGATGCCTGCGCTCAGG - Intergenic
961468799 3:127098342-127098364 GCGAGCCGCTGCCTGCCCCCAGG - Intergenic
961935115 3:130574764-130574786 GAGTGGGAATGCCTGCCTTCAGG + Intronic
968611957 4:1561255-1561277 CTGTGGCTGTGCCTGCCCTCTGG - Intergenic
969147800 4:5139322-5139344 ATGTGTCAATGCCTGCCCTCAGG - Intronic
972075181 4:35078901-35078923 GCTTGGAAATGCCTGCCCCCTGG + Intergenic
980088506 4:128416773-128416795 GCATGGAGGTACCTGCCCTCTGG + Intergenic
981162608 4:141516852-141516874 GCCTGGAGATGACTGCACTCCGG - Intergenic
982814603 4:159869323-159869345 GCTTGGCGGGCCCTGCCCTCGGG - Intergenic
986329370 5:6706199-6706221 GGGTGGCGGTGCCTGCAGTCTGG + Intergenic
987044542 5:14094825-14094847 GCGTGGCAATGGTTGCTCTCTGG - Intergenic
997526790 5:134558952-134558974 GCTTGGAGAGGCCTGCCCGCAGG - Intronic
997844896 5:137277519-137277541 GCATGGGGCTGCCTGCCCTGTGG + Intronic
1000244480 5:159438007-159438029 GCTGGAGGATGCCTGCCCTCTGG - Intergenic
1001489147 5:172143414-172143436 GCGTGTTGATGCCTCACCTCTGG - Intronic
1006472943 6:34238190-34238212 GCGTGGCGGTGCATGCGGTCGGG + Intronic
1006916880 6:37600422-37600444 ACGTGACACTGCCTGCCCTCTGG - Intergenic
1013086364 6:106861301-106861323 GCCTGGCCATGGCTGCCCACGGG - Intergenic
1018710739 6:166496775-166496797 GCGTGGCCAGCCCTGCTCTCTGG + Intronic
1019730345 7:2626346-2626368 GAGTCGCCATGCCTGGCCTCAGG + Intergenic
1025089773 7:56052203-56052225 GCGCGGCGTTCCCCGCCCTCTGG + Intronic
1035708398 8:1695054-1695076 GGAAGGCGATGCCTGCTCTCAGG + Intronic
1036803266 8:11808601-11808623 GCGGGGCGGTGCCTGCGCCCGGG - Intronic
1039453716 8:37695273-37695295 CCGAGGCGAGGCCTGCCCCCAGG + Intergenic
1049114568 8:140674817-140674839 GCGGGCGGATGCCTGACCTCAGG + Intronic
1049181632 8:141225964-141225986 GCGTGGGGAGGCCTGACCTAGGG - Intronic
1053104290 9:35397022-35397044 GGATGGCTATGCCTGCCCTGTGG + Intronic
1057035772 9:91810861-91810883 GAGTGCCGATGTCTCCCCTCTGG - Intronic
1062173452 9:135148101-135148123 GCGTGGCCGTGCCAGCCCGCAGG + Intergenic
1062463944 9:136673033-136673055 GGGTGGCGGTGCCTGCACCCTGG + Intergenic
1200145101 X:153922311-153922333 GGCTGGGGAAGCCTGCCCTCAGG + Intronic