ID: 1159953361

View in Genome Browser
Species Human (GRCh38)
Location 18:74501847-74501869
Sequence CACTGTGTGTGAGGGGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 681
Summary {0: 1, 1: 1, 2: 2, 3: 71, 4: 606}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159953361 Original CRISPR CACTGTGTGTGAGGGGGAGC CGG (reversed) Intronic
900129187 1:1080421-1080443 CACTGGGTGGGAGGAGGAGGAGG + Intergenic
900244028 1:1629553-1629575 CACCGTGTGTGAGGGTGAGTGGG + Exonic
900378824 1:2373665-2373687 CACTGTGTGCGTGCGGGTGCTGG + Intronic
900395307 1:2450928-2450950 CAGTGGTTGTGAGGGTGAGCAGG + Intronic
901013998 1:6217395-6217417 CACTGTGCTGGAGCGGGAGCTGG - Intronic
901748652 1:11392026-11392048 CACTGGGTGGGAGGGGCATCTGG + Intergenic
902520338 1:17012022-17012044 CCCGGTGTGTGCGGAGGAGCAGG - Intergenic
902673709 1:17993830-17993852 CACAGGGTGGGAGGGGGTGCTGG - Intergenic
903043896 1:20552216-20552238 TGCTGTGGGTGAGGGGCAGCAGG + Intergenic
903261558 1:22134250-22134272 AAGTGGGTGGGAGGGGGAGCCGG + Intronic
903351284 1:22718123-22718145 CACAGTGGGTGGGGGAGAGCTGG - Intronic
904118367 1:28178633-28178655 GCCTGTGTGTGATGGGGGGCTGG - Intronic
904496295 1:30888696-30888718 CACTGTGTGTGAGTTTGGGCTGG - Intronic
904878127 1:33672142-33672164 CACCGTGTGTGAGCCGAAGCAGG + Intronic
904908270 1:33914265-33914287 AACTGTGTGTAAGGGGGGACAGG + Intronic
904913150 1:33950324-33950346 CATTGGGTGTGAGGAGGAGACGG - Intronic
905179094 1:36155826-36155848 GACTGGGGGAGAGGGGGAGCAGG - Intronic
905285933 1:36880460-36880482 CACAGGGTGTGAGTGGGTGCAGG + Intronic
906127601 1:43437152-43437174 TAATCTGGGTGAGGGGGAGCAGG - Exonic
906143937 1:43549100-43549122 CACTGTGTGTGTCAGGGAGGGGG + Intronic
906330102 1:44877282-44877304 CTGTCTGAGTGAGGGGGAGCAGG + Intronic
906737876 1:48150283-48150305 CACCGTGCGCGAGGGGAAGCAGG + Intergenic
907069216 1:51519051-51519073 CGGTGTGTGTGAGGGAAAGCGGG - Intronic
907223029 1:52921284-52921306 GACTGTGTGGAAGGGGGAGCGGG - Intronic
907250992 1:53139418-53139440 CCCTGTGTGTGTTGGGGAGAGGG - Intronic
907267368 1:53271148-53271170 CAATGTCTGTGGGGAGGAGCAGG + Exonic
907745573 1:57209824-57209846 GTGTGTGTGTGAGGGGGAGAGGG - Intronic
908295075 1:62705364-62705386 CACTGTGTGTGAGCCAAAGCAGG - Intergenic
908389929 1:63675244-63675266 CGCAGTGTGGGAGGGGGAGAGGG - Intergenic
908956576 1:69637106-69637128 AACTCTGTGTGCGGGGGAGCGGG - Intronic
909687070 1:78361771-78361793 CATTGTGTGTGGGGGGGAAGTGG + Intronic
910243661 1:85115689-85115711 CACTGGGTGGCAGGGGGAGGTGG + Intronic
910279214 1:85480172-85480194 AACAGTGTGTGGGGTGGAGCAGG - Intronic
910295582 1:85642019-85642041 CACTGTGCGTGAGCGGAAGCAGG + Intergenic
910381771 1:86633900-86633922 CACTGAGTGTGAGCTGAAGCAGG - Intergenic
911054983 1:93701608-93701630 CACCGTGTGTGATGAGGGGCTGG + Intronic
911307328 1:96246946-96246968 CACTGTGCGTGAGCCGAAGCAGG - Intergenic
911492589 1:98588808-98588830 CACCGTGTGTGAGCCGAAGCAGG + Intergenic
912237802 1:107870851-107870873 CACTGTGTGTCATGGGAAGCAGG + Intronic
912645350 1:111386930-111386952 CCCTGTGTCTGAGGGAGTGCAGG - Intergenic
912797747 1:112703110-112703132 CCCTGTGTGTCAGGTGGAGCTGG - Exonic
912942700 1:114059151-114059173 TAGTGTGTGTGAGGGGGTGCTGG + Intergenic
913097679 1:115534859-115534881 CTCTCAGTGAGAGGGGGAGCTGG - Intergenic
914374865 1:147064066-147064088 CACTGTGAACGAGGTGGAGCAGG + Intergenic
915341588 1:155179507-155179529 GAGTGTGGGTGAGAGGGAGCTGG - Intronic
915752183 1:158221767-158221789 CACTGTGTGTGAGCCAAAGCAGG - Intergenic
917710306 1:177677767-177677789 CACCGTGTGTGAGCCGAAGCAGG - Intergenic
917973558 1:180224318-180224340 GGCTGTGTGTATGGGGGAGCTGG - Intergenic
919937718 1:202265513-202265535 CACTGTATGTGGGGGTGGGCAGG + Intronic
920051448 1:203167170-203167192 CCCTGTGTGGGAGGGCGAGGCGG + Exonic
920051462 1:203167206-203167228 CCCTGTGTGGGAGGGCGAGGCGG + Exonic
920195758 1:204226076-204226098 CACTGTGTGTGTGGCAGTGCTGG - Intronic
920312795 1:205058380-205058402 CACTTTGGGGGAGGGGGAGAGGG + Intronic
920921195 1:210298606-210298628 CACTCAGTGGGATGGGGAGCTGG + Intergenic
921127794 1:212193440-212193462 AAATGTGTGTGGGGGGGGGCAGG - Intergenic
921581904 1:216905166-216905188 TTCTGTGTGTGATGGGCAGCCGG - Intronic
922447635 1:225711079-225711101 CACTGGGTGGGAGGGTGAACTGG + Intergenic
922505578 1:226123655-226123677 GACTGTGTGTGAGGGACAGCGGG - Intergenic
923156104 1:231280770-231280792 TACTGTGTTTGATGGGGAGATGG - Intergenic
924055177 1:240118090-240118112 CAGTGTGTTTGAGGAGGAGAAGG + Intronic
924596204 1:245447109-245447131 CACTGTGTGGTGGGTGGAGCTGG + Intronic
1064194365 10:13233459-13233481 GACTGTGGGAGAGGAGGAGCCGG + Intronic
1066596006 10:37050472-37050494 CACTGAGTGTGAGCTGAAGCAGG - Intergenic
1066646589 10:37616909-37616931 CACTGTGTCTGCGGAAGAGCAGG + Intergenic
1067045773 10:42984446-42984468 CACAGCTGGTGAGGGGGAGCTGG + Intergenic
1067195298 10:44112718-44112740 CACCGTGTGTGAGCTGAAGCAGG - Intergenic
1068085263 10:52366159-52366181 CACTGTGCGTGAGCTGAAGCAGG - Intergenic
1068179264 10:53499851-53499873 CACCGTGTGTGAGCCGAAGCAGG - Intergenic
1068340043 10:55688914-55688936 CACTGTGTGCGAGCCGAAGCAGG - Intergenic
1068376315 10:56186395-56186417 CACCGTGTGTGAGCCGAAGCAGG + Intergenic
1068848073 10:61703758-61703780 AACTGTGTGTAGGGGGCAGCAGG - Intronic
1068891953 10:62157081-62157103 CAGTGCGGGGGAGGGGGAGCAGG + Intergenic
1068985641 10:63105295-63105317 TACTGGGTGGGAGAGGGAGCTGG + Intergenic
1070112004 10:73495740-73495762 AGCTGTGTGTGAGGGCGGGCGGG - Intronic
1070765150 10:79052138-79052160 CCTGGTGTGTGATGGGGAGCGGG - Intergenic
1070934688 10:80284031-80284053 CACTGTCTCTGAAAGGGAGCGGG + Exonic
1071050435 10:81441808-81441830 CACCGTGTGTGAGCCGAAGCAGG - Intergenic
1071323810 10:84491708-84491730 CACAGAGTGTGAGTGGAAGCAGG - Intronic
1071386427 10:85125897-85125919 CACTGTGCATGAGCGGAAGCAGG + Intergenic
1072014004 10:91327825-91327847 CACTGTGCGTGAGCCGAAGCAGG - Intergenic
1072153872 10:92706194-92706216 CACTGTGTGGGAGGTGAAGTGGG - Intergenic
1072384289 10:94908653-94908675 CACTGAGTGTGAGCTGAAGCAGG + Intergenic
1073102654 10:101014874-101014896 CACTGTGTGTGAGGGCGAGCTGG - Intronic
1073338661 10:102729159-102729181 CACTGTGAGTGAGGGGGAGAGGG + Intronic
1074083085 10:110183220-110183242 CAGTGTGTGTGTTGGGGAGAAGG + Intergenic
1075242683 10:120792901-120792923 CAGTGTGTGTGTGGGGGGGGGGG - Intergenic
1075242778 10:120793266-120793288 CAGTGTGTGTGTGGGGGGGAGGG - Intergenic
1075531830 10:123236370-123236392 CACAGTGGGTGAGTGGGAGGTGG + Intergenic
1075733421 10:124649724-124649746 CCCAGTGTGTGAGGGAGACCAGG - Intronic
1075778756 10:125003836-125003858 CATAGTGTGTGAGGGGCAGCTGG - Intronic
1075921621 10:126218170-126218192 GAGTGTGTGTGTGGGGGGGCAGG + Intronic
1076140034 10:128071271-128071293 CCCTCTGTGTAAGGGGGAGGCGG - Intronic
1076340987 10:129744682-129744704 CACTGAGAGTGAGCGGGAGGAGG - Intronic
1076729282 10:132430145-132430167 CTGTGTGTGTGAGGGAGAGCAGG + Intergenic
1076732321 10:132444940-132444962 CCCTGTGGCTGAGGAGGAGCTGG - Intronic
1077036852 11:499497-499519 CTCAGTGTGTGTGGGGGACCCGG - Intronic
1077462622 11:2718220-2718242 CAAGGTGTGTGAGGGGGATGTGG - Intronic
1077635180 11:3837277-3837299 CACTGTCAGTGAGGCAGAGCTGG + Intronic
1078062441 11:8056657-8056679 GGCTGTGTGTGAGGTAGAGCTGG + Intronic
1078142498 11:8702395-8702417 CCCTGTGTGGGTGAGGGAGCAGG - Intronic
1079161557 11:17999652-17999674 GTCTGTGTGTGAGGGGGACAGGG - Intronic
1079378680 11:19917519-19917541 CACTGTCTGTGAGGGTAAGAGGG - Intronic
1079459540 11:20668339-20668361 TACTGCTGGTGAGGGGGAGCGGG + Intergenic
1079701394 11:23553010-23553032 CTGTGTGTGTGAGGGGGTGGGGG + Intergenic
1080245872 11:30178585-30178607 CACTGTGTGCGAGCGAAAGCAGG + Intergenic
1081039346 11:38191899-38191921 CACCGTGTGCGAGCGGAAGCAGG + Intergenic
1081500250 11:43659361-43659383 CACTGTGCGTGAGCTGAAGCAGG - Intronic
1081697793 11:45128318-45128340 CACTGTGTGCGAGCCGAAGCAGG - Intronic
1081734176 11:45391831-45391853 TACTGTGTGTGTGGGGGGGTGGG + Intergenic
1081800892 11:45858680-45858702 CACTGTGTTTGGGGAGGAGGGGG - Intronic
1084011078 11:66348666-66348688 GATTGTGTGTGTTGGGGAGCAGG - Intronic
1084045158 11:66564006-66564028 CCCTGGGGGAGAGGGGGAGCTGG + Exonic
1084271673 11:68032548-68032570 CCCTGGGTGTGATGGGGAGGGGG + Intronic
1084513019 11:69617843-69617865 CACTGTGTGCCAGGGGGCTCGGG - Intergenic
1084796732 11:71511198-71511220 CACCGTGTGTGAGCCGAAGCAGG + Intronic
1086850707 11:91804243-91804265 CACTAAGTCAGAGGGGGAGCGGG - Intergenic
1087042443 11:93815098-93815120 CTATGTGTGTGAGATGGAGCCGG + Intergenic
1087688012 11:101287062-101287084 TGCTGTGTGTGAGGGGGTGGGGG - Intergenic
1087722695 11:101684376-101684398 CACTGTGCGTGAGCTGAAGCAGG - Intronic
1089661784 11:119990821-119990843 CAGGGTGTGTGAGGTGGAGGTGG - Intergenic
1089697383 11:120224605-120224627 GACTGTGTGGTGGGGGGAGCTGG + Intronic
1090308956 11:125717472-125717494 CACTGTGTGTGAGCCGAAGCAGG - Intergenic
1090644817 11:128758796-128758818 CACTGTGTCTGGGAGGGGGCAGG + Intronic
1090706768 11:129344763-129344785 CACTGTGCGTGAGCCGAAGCAGG - Intergenic
1090951517 11:131477475-131477497 CACTGAGTGGGAGGGAGAGGAGG + Intronic
1091211776 11:133866765-133866787 CACTGGGTCTTAGTGGGAGCGGG + Intergenic
1091238635 11:134037759-134037781 CACTGTGGATTAGAGGGAGCCGG - Intergenic
1091814743 12:3429132-3429154 CACTGTGGGTGGGGCGGAGGGGG + Intronic
1092126724 12:6079897-6079919 CAGTGTGTGAGGTGGGGAGCAGG - Intronic
1092263400 12:6963936-6963958 CACTGGGTGGGAGGAGGGGCTGG - Intergenic
1092570906 12:9720247-9720269 TACTGTGTGTGCTGGGGAGAAGG - Intronic
1092706445 12:11290389-11290411 CACCGTGTGTGAGCTGAAGCAGG + Intergenic
1094347111 12:29482819-29482841 CACTGTGTTTGAGGGTAAGTAGG + Intronic
1095905097 12:47369349-47369371 GACTATGAGGGAGGGGGAGCAGG + Intergenic
1096198508 12:49664525-49664547 CCCTGTGTGTGAGGGCAAGAAGG - Intronic
1096792028 12:54051473-54051495 GACTGTGAGTGAGGGGGCGGAGG - Intronic
1096926193 12:55150001-55150023 ATGTGTGTGTGAGGGGGTGCGGG + Intergenic
1097780884 12:63703150-63703172 CACTGTGGGTCAGTGGGAGCAGG + Intergenic
1099114558 12:78608641-78608663 CACTGAGTGTGAGCCGAAGCAGG + Intergenic
1099631514 12:85152317-85152339 CAGTGTTTGTGAAGGGAAGCGGG - Exonic
1100238396 12:92684175-92684197 CACCGTGTGTGAGCTGAAGCAGG - Intergenic
1100984999 12:100195291-100195313 CTCTGTGTGTGTAGGGGGGCTGG - Intergenic
1101460303 12:104884317-104884339 CACAGTGTGTGAGCCGAAGCAGG - Intronic
1104557741 12:129817236-129817258 CACTGTGTCTGACGCTGAGCAGG - Intronic
1105598407 13:21861729-21861751 CACCGTGTGTGAGCCGAAGCAGG - Intergenic
1106207328 13:27612327-27612349 CACTTTGAGGGAGGGGGAGGAGG - Intronic
1106292340 13:28375781-28375803 CAGTGCCTGTGAGGGTGAGCTGG - Intronic
1106730922 13:32540639-32540661 AACTGTGTGTGTGGGGGGGTGGG - Intergenic
1106756669 13:32828908-32828930 GACTGTGTGTCAGGGAGAGGAGG + Intergenic
1107385065 13:39899214-39899236 CACTGAGTGAATGGGGGAGCTGG + Intergenic
1107649513 13:42530076-42530098 TAATGTGTGTGAGGGGGATTGGG - Intergenic
1108491041 13:50982211-50982233 CACCGTGTGTGAGCCGAAGCAGG + Intergenic
1109468240 13:62767677-62767699 CAATGGGTGTGTGGGCGAGCTGG + Intergenic
1109557413 13:63997851-63997873 CACTGAGTGGGAGGGGAAGGAGG - Intergenic
1110126057 13:71943373-71943395 CATTGGGTGTCAGGGGGAGGAGG + Intergenic
1110152478 13:72271445-72271467 CACTGTGCGTGAGCTGAAGCAGG - Intergenic
1111764960 13:92516851-92516873 CACTGAGTGTGAGCCGAAGCAGG + Intronic
1113405608 13:110036738-110036760 CACTGTGTGACACAGGGAGCGGG - Intergenic
1113591143 13:111502092-111502114 CACTGAGTGTGAGCCGAAGCAGG - Intergenic
1113625748 13:111845242-111845264 CAGTGTCTGTGGGGCGGAGCTGG + Intergenic
1114401644 14:22415785-22415807 CACTGTGTGTGTGTGTGAGATGG - Intergenic
1114807816 14:25857820-25857842 CACTGTGCGTGAGCCGAAGCAGG - Intergenic
1115573398 14:34688050-34688072 AAGTGTGTGTGTGGGGGCGCTGG + Intergenic
1116479777 14:45383914-45383936 CCCTTTATGGGAGGGGGAGCAGG - Intergenic
1117017881 14:51536938-51536960 GACTGTGTGTGGGGGGCAGGGGG - Intronic
1117069282 14:52042171-52042193 CAATTGGTGTGAGGGGGAGGAGG + Exonic
1118546310 14:66893343-66893365 CACTGAGTGTGAGCTGAAGCAGG + Intronic
1120403417 14:84063203-84063225 AAGTGTGACTGAGGGGGAGCTGG + Intergenic
1121405014 14:93714432-93714454 CACTGGGTGTGAGGGGGGAGAGG - Intergenic
1121414640 14:93770717-93770739 CTCTGTGTGTGCGCGGGAGGGGG - Intronic
1121637028 14:95460954-95460976 AAGTCTGTGTGATGGGGAGCAGG + Intronic
1121657159 14:95605470-95605492 CTCTGTGTGTGTGGAGGGGCAGG + Intergenic
1121693177 14:95892416-95892438 CATTGTGTGTTCCGGGGAGCCGG + Intergenic
1121784860 14:96649761-96649783 CACTATGTGTGCTAGGGAGCTGG + Intergenic
1122048925 14:99042127-99042149 CACCCTGTGGGAGGTGGAGCAGG - Intergenic
1122643330 14:103175364-103175386 CACTCAGTGGGAAGGGGAGCTGG - Intergenic
1122690099 14:103528219-103528241 GAGTGTGTGTGCAGGGGAGCGGG - Intergenic
1122925231 14:104896317-104896339 GTGTGTGTGTGAGGGGGGGCGGG + Exonic
1123877647 15:24639852-24639874 CACTGAGTGTGAGGCAAAGCAGG - Intergenic
1124361442 15:29039393-29039415 CACAGTTTCTGATGGGGAGCTGG - Intronic
1125412599 15:39420721-39420743 CACTGTGTGCGAGCCGAAGCAGG + Intergenic
1125460170 15:39898848-39898870 CACTGTGTGGGTGGGGGAGAAGG + Intronic
1125463163 15:39925285-39925307 GAGGGTGTGTGATGGGGAGCAGG - Intergenic
1125501026 15:40240382-40240404 CAGTGTGTGTCAGGAGGAGGGGG + Intronic
1125502579 15:40248654-40248676 CACTGGGTGTGAGGGGCAGAGGG - Intronic
1125720881 15:41844635-41844657 CCCTGTGTGGCAGGGGGTGCTGG + Intronic
1126105015 15:45141788-45141810 TTCTGTGTGTGAGGGAGAGATGG + Intronic
1127878682 15:63135849-63135871 CTCTGTGTATAAGGGGGAGAAGG + Intronic
1127900747 15:63339118-63339140 CACAGTGGGTGAGTGGGAGCTGG + Intronic
1128258771 15:66217321-66217343 TAGTCTGTGTGAGAGGGAGCTGG - Intronic
1128509784 15:68306338-68306360 CAGGGTATGTGTGGGGGAGCGGG + Intronic
1129354233 15:74978665-74978687 CACGGTGGGGGAGGGGGGGCAGG - Intronic
1129675663 15:77631568-77631590 AAAAGGGTGTGAGGGGGAGCAGG + Intronic
1129975325 15:79816761-79816783 CACTGTGTCTGAGGGCGAAGGGG + Intergenic
1130106562 15:80932887-80932909 GACTGTGTGTGAGAGGGAGGTGG - Intronic
1130891273 15:88135851-88135873 GGCTGTGTGTGAGGGGCAACTGG - Intronic
1131270202 15:90942598-90942620 CATTGTGGGTGAGTGGAAGCAGG + Exonic
1131406143 15:92166546-92166568 TAGTGTGAGTGAGGGGAAGCTGG - Intronic
1132323138 15:100941978-100942000 CACTGTGCGTGAGGTGGAGAAGG - Intronic
1132389797 15:101429906-101429928 GAATGTGTGTGCGAGGGAGCTGG - Intronic
1132659951 16:1056844-1056866 CTCTCAGTGGGAGGGGGAGCTGG + Intergenic
1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG + Intergenic
1134897915 16:17906574-17906596 CACTGAGTGTGAGCCGAAGCAGG + Intergenic
1135964537 16:27024868-27024890 CACTGTGTGTGTGGGGGGGGGGG - Intergenic
1137966483 16:52938890-52938912 GGCTGTGTGTGTGTGGGAGCAGG + Intergenic
1138533161 16:57646037-57646059 CACTGTGTGTAAAGGGAAGAAGG + Intronic
1139202195 16:64989215-64989237 GATTGTGTGTGAGGGTGAGGGGG + Intronic
1141094831 16:81155832-81155854 CCCTGCGTGGGAGGGGGATCTGG - Intergenic
1142286862 16:89175040-89175062 CAATGTGGGTGTGGGTGAGCAGG - Intronic
1142809523 17:2388756-2388778 GACTGAGTGTGGAGGGGAGCTGG - Intronic
1143387807 17:6542448-6542470 CTTTGTGTGTGAGGGAGAGAGGG - Intronic
1143712893 17:8746006-8746028 CTCTGTCTGGGAGGGGGAGCGGG + Intergenic
1144426263 17:15145106-15145128 CTCTGTGTGTGTGGGGGAGGGGG - Intergenic
1144840205 17:18181391-18181413 TGGTGTGTGTGAGGGGGAGGGGG + Intergenic
1145091283 17:19988105-19988127 CACTGTGTGTGGGAGGAACCAGG - Intergenic
1145869944 17:28265796-28265818 CACTGTGTTGGAGGTGCAGCAGG - Intergenic
1145932836 17:28698269-28698291 CACTCTGTGGGAGGGAGAGGAGG - Intronic
1146185719 17:30722796-30722818 CACTGTGTGTTCAGGGGACCAGG + Intergenic
1146462494 17:33057239-33057261 CAGTGTGTGTTAGAGGCAGCCGG - Intronic
1146534975 17:33642209-33642231 CATTGTGTGTGGGGGGGGGGGGG - Intronic
1146586700 17:34089009-34089031 CACTGTGTGCGAGCCGAAGCAGG - Intronic
1147327038 17:39674582-39674604 CCCTGTGCAGGAGGGGGAGCTGG + Intronic
1148506499 17:48131430-48131452 CACTCTGTGTGAAGGGTAGGGGG + Intergenic
1148558473 17:48592512-48592534 CACTGGGTGGGAGGGGGCGGGGG + Intronic
1149544581 17:57493863-57493885 CACTGTGAGGTAGGCGGAGCAGG + Intronic
1149856565 17:60088101-60088123 CAGTGTGTGTGGGGAGGAGAGGG - Intergenic
1151320896 17:73351848-73351870 CAATGTGTGGCAGGGGGAGGAGG + Intronic
1151876908 17:76872055-76872077 CACTGGGTGGGAGGGAGGGCTGG - Intronic
1152331819 17:79677874-79677896 CACTGGGTGAGAGGAGGAGAGGG - Intergenic
1152750737 17:82061350-82061372 CCCTCTGTGGGAGGAGGAGCGGG + Exonic
1152790563 17:82276595-82276617 GACCGTGTGCGAGAGGGAGCTGG + Intergenic
1203162929 17_GL000205v2_random:68339-68361 GGCTGTGTGTGAGGAGGTGCAGG + Intergenic
1203170148 17_GL000205v2_random:140882-140904 CACTAAGTCTGAGGGGGAGTGGG - Intergenic
1153541793 18:6163853-6163875 CACTGTGTGTGAGCTGAAGCAGG + Intronic
1154181196 18:12141322-12141344 CACCGTGTGTGAGCTGAAGCAGG - Intergenic
1154445312 18:14431131-14431153 CTCTGGGGGTGAGGAGGAGCTGG - Intergenic
1155578780 18:27279706-27279728 CACCGTGTGTGAGCCGAAGCAGG + Intergenic
1156034512 18:32751598-32751620 CTCTGTGTGTGAGGAAGAGGAGG - Intronic
1156039877 18:32808833-32808855 TACTGTGTTTGAGTGAGAGCAGG - Intergenic
1156061056 18:33076682-33076704 TGGTGTGTGTGAGGGGGAGGAGG + Intronic
1156586791 18:38439895-38439917 CATTGTGAGAGAGGAGGAGCTGG + Intergenic
1157039788 18:44024647-44024669 CACTGTGCGTGAGCTGAAGCAGG - Intergenic
1159311385 18:66715231-66715253 CACCGTGTGTGAGCCGAAGCAGG + Intergenic
1159457096 18:68673026-68673048 CACTGTGTGTGTGGAGGCTCCGG - Intergenic
1159953361 18:74501847-74501869 CACTGTGTGTGAGGGGGAGCCGG - Intronic
1160479618 18:79226734-79226756 CACAGTTTGTGTGGGGGAGGTGG + Intronic
1160508488 18:79440520-79440542 CACGGTGTCTGCGGGGAAGCAGG - Intronic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1160620017 18:80164122-80164144 CTCTGTGTGTGGGGTGCAGCAGG - Intronic
1160720961 19:596739-596761 CACAGAGTGTGAGGGGGAGTGGG + Intronic
1160929789 19:1565065-1565087 CACTGTGTGTGACCTGGAGCTGG + Intronic
1160962443 19:1729539-1729561 CAGTGTGTGTGAGTGGCAGAAGG + Intergenic
1161062048 19:2220071-2220093 CCCTGTGTGTCAGGGGCAGCAGG - Intronic
1161272459 19:3397637-3397659 CACTGGGTGGGATGGGGGGCTGG - Intronic
1161410405 19:4113805-4113827 CACTGAGTGTCAGCGAGAGCAGG + Intronic
1161604017 19:5204543-5204565 CAATGAGTTTGAGGTGGAGCTGG - Intronic
1162922326 19:13910596-13910618 TATTGTGTGTGAGGGGGCCCTGG - Intronic
1163690825 19:18737269-18737291 GACTTTGTGTGAGGGGGTCCCGG + Intronic
1163847526 19:19646019-19646041 CAGTGTGTGTGAGCCGGAGCAGG - Intronic
1164440026 19:28269864-28269886 CACCGTGTGTGAGCCGAAGCAGG + Intergenic
1164524212 19:29001449-29001471 CACTGTGAGAGAGAGAGAGCTGG + Intergenic
1164855035 19:31514075-31514097 CACGGTGCGTGGGGGGGAGAGGG - Intergenic
1165540455 19:36489250-36489272 GTGTGTGTGTGAGAGGGAGCAGG - Intronic
1165607293 19:37116626-37116648 CACTGTGTGCGAGCCGAAGCAGG + Intronic
1165992330 19:39823799-39823821 GGCTGTGTGGGAGGGGGAGGCGG - Intergenic
1166257244 19:41615297-41615319 CTGTGTCTGGGAGGGGGAGCTGG + Intronic
1166711729 19:44942084-44942106 CACTGTGTGGGAGGGTGAGAAGG + Intergenic
1166924824 19:46260387-46260409 CATTGTGGGTGCAGGGGAGCGGG - Intergenic
1167685297 19:50952389-50952411 CACGGTGTGTGTCGGGGAGGGGG - Intronic
1168232454 19:55041836-55041858 CACTGTGTGTGCTGCGGGGCTGG + Intronic
1168316070 19:55485299-55485321 GACTGTGGGGGAGGGGGCGCTGG + Intronic
925326974 2:3030701-3030723 CACTGTGCGTGAGCCGAAGCAGG + Intergenic
925531906 2:4873427-4873449 TACTGTGTGCCAGGGTGAGCAGG - Intergenic
926140630 2:10365763-10365785 GAGGGTGTGTGAGGGGGTGCGGG + Intronic
926196879 2:10769266-10769288 CACTGTGTGGGAGAGGGAGCAGG + Intronic
926238878 2:11069750-11069772 CTCTGTGTGGGTGGGGGTGCAGG + Intergenic
927463543 2:23320445-23320467 CTGTGTGTGTGTGGGGGGGCGGG - Intergenic
927587253 2:24318963-24318985 AACTGTGTGTGTGAGGGATCTGG + Intronic
927702117 2:25275416-25275438 GAGTGTGTGTGAGGGGGCGGAGG - Intronic
928390286 2:30904354-30904376 CACTGTGTGCGAGCCGAAGCAGG + Intergenic
929259682 2:39851760-39851782 CACTGTGGGTGCAGGGGAGAGGG - Intergenic
929307265 2:40377701-40377723 CACCGAGTATGAGTGGGAGCTGG + Intronic
929878129 2:45814044-45814066 CTCTGTGCGGGAGGGGGAGGGGG - Intronic
929948622 2:46389320-46389342 CACTGTGTATTAGGTGGGGCTGG - Intergenic
930022260 2:47008586-47008608 CACTGTGTGTTCGGTGCAGCAGG + Intronic
930335922 2:50045529-50045551 CATTGTCTGTGAGGGGAAGGAGG - Intronic
930434168 2:51318693-51318715 CACCGTGTGTGAGCCGAAGCAGG - Intergenic
931109302 2:59092709-59092731 CACTGTGCGTGAGCCGAAGCAGG - Intergenic
931253812 2:60553976-60553998 CCGCGTGTGTGGGGGGGAGCAGG - Intergenic
932183754 2:69673786-69673808 CACTGAGTGAGAGAGGGAGTTGG - Intronic
932199209 2:69810897-69810919 CACTGAGTGACAGGGGGACCTGG - Intronic
932558512 2:72846734-72846756 GACAGTGGGTGAGGGGGAGCAGG + Intergenic
932935452 2:76096606-76096628 CACTGTGTGCGAGCCGAAGCAGG - Intergenic
933645827 2:84811969-84811991 CACAGAGTGTGAGGAGGAGGGGG - Intronic
933659861 2:84918662-84918684 CCCTGGGTGGGAGTGGGAGCTGG - Intergenic
933801513 2:85963951-85963973 CACTGTGCGTGAGCTGAAGCAGG + Intergenic
933880098 2:86661090-86661112 CACTGTGCGTGAGCCGAAGCAGG - Intronic
934661779 2:96146882-96146904 CACTATGTGTGAGAAGGAGCTGG + Intergenic
934975919 2:98802172-98802194 CACAGTGTGTGAGAGCCAGCGGG + Intronic
935083213 2:99819796-99819818 CACTGTGTGGTCAGGGGAGCCGG + Intronic
935377266 2:102412030-102412052 CAGTGTGGGTGAGGAGGGGCTGG - Intergenic
935758600 2:106297796-106297818 CATGGGGTGTGAGAGGGAGCTGG + Intergenic
935789953 2:106581917-106581939 CGTTGTGTGTGTGGGGGGGCGGG - Intergenic
935858373 2:107299790-107299812 CACCGTGTGTGAGCCGAAGCAGG - Intergenic
936735963 2:115444015-115444037 CAATGTGGGGGAGGGGAAGCAGG - Intronic
936981470 2:118269157-118269179 CACTGTGTCAGAAGGGGAGGTGG + Intergenic
937087773 2:119182600-119182622 AAGTGTGTGTTGGGGGGAGCTGG - Intergenic
937362555 2:121239169-121239191 CACTGAGTGTGGGGGTGAGAGGG - Intronic
938248899 2:129798710-129798732 CACTGTGGGTGAAGGCGTGCAGG - Intergenic
938409750 2:131054353-131054375 CACTGTGTTGGAGGTGGTGCTGG - Intronic
938567120 2:132529040-132529062 CACTGTGCGTGAGCTGAAGCAGG + Intronic
939422362 2:141989603-141989625 CCCTGTGTGAGAGTGGGACCAGG + Intronic
940055337 2:149507226-149507248 CACTGTGTGCGAGCGGAAGCAGG - Intergenic
940253461 2:151704707-151704729 CACTGTGCGTGAGCCGAAGCAGG - Intronic
940722715 2:157299140-157299162 CACTGGATGTGAGGGCGATCTGG - Intronic
941200159 2:162498480-162498502 CTCTGTGTGTGTGGGGGGGAGGG + Intronic
941377363 2:164748023-164748045 AGCTGTGTGTGGTGGGGAGCAGG + Intronic
941468163 2:165854755-165854777 CACTGTGTGTGCTGGAGTGCTGG + Intergenic
941611992 2:167672978-167673000 GACTGTGTGTGTGTGGGAGGGGG + Intergenic
941624015 2:167810248-167810270 CACTGAGTGTGAGCCGAAGCAGG - Intergenic
941831612 2:169967262-169967284 AACTGTGTGTGGGGGGGGGCGGG - Intronic
942313246 2:174675813-174675835 CTCTGTGTGTGGGGTGGAGGCGG + Intronic
942643666 2:178087854-178087876 CACTGTGATTGAGGAGGAGTGGG - Intronic
945351320 2:208784414-208784436 CACTGTGTGTGAGCCGAAGCAGG + Intronic
946239414 2:218344787-218344809 CACTGTGGGTGAGAGGAACCAGG - Exonic
946725444 2:222657039-222657061 CACTGGGGGTGAGGGGGTGGAGG + Intergenic
947593846 2:231399055-231399077 CACTGGGTGTGGTGGGGTGCAGG + Exonic
947736299 2:232457201-232457223 CACTGTGTGTGCGTAGGTGCCGG - Exonic
1168958570 20:1852158-1852180 CCCTGTGTGAGAGGGGCACCAGG + Intergenic
1168988881 20:2077435-2077457 AACTGTGTGTATGTGGGAGCAGG + Intergenic
1169266953 20:4172631-4172653 CGCTGTCTGGGAAGGGGAGCGGG + Intronic
1169969186 20:11250284-11250306 GACAGTGTGTAAGGGAGAGCAGG - Intergenic
1170098879 20:12676697-12676719 CTCTGTGTGTGCTGGGGTGCGGG + Intergenic
1171075069 20:22114789-22114811 CACTGAGTGTGAGCTGAAGCAGG + Intergenic
1171426028 20:25049275-25049297 CTCTGTGTGTGTTGGGGAGCTGG + Intronic
1171569366 20:26233835-26233857 CACCGTGTGTGAGCCGAAGCAGG + Intergenic
1171791060 20:29526050-29526072 CACCGTGCGTGAGCGGAAGCAGG + Intergenic
1172547206 20:35771454-35771476 CACTGAGAATGTGGGGGAGCTGG + Intergenic
1172787875 20:37481107-37481129 CACAGTGGATGAGGGGAAGCAGG - Intergenic
1173197298 20:40926323-40926345 CACTGCCTGTGACGGGGGGCAGG + Intergenic
1173247584 20:41347314-41347336 CAGTGTGAGTGAGGGAGAGATGG + Intronic
1174588838 20:51629134-51629156 CACTGTCTGTCATGGGAAGCGGG - Intronic
1174597129 20:51693115-51693137 CAGTGTGTATGATGGGGCGCAGG - Intronic
1174677556 20:52373055-52373077 CAGAGTGTGTGAGGGGAAGAGGG - Intergenic
1175001764 20:55636796-55636818 CTTTGTGTGTGGGAGGGAGCAGG - Intergenic
1175256662 20:57652118-57652140 CGATGTGTGTGTGGTGGAGCCGG + Exonic
1175514023 20:59557329-59557351 CACTGTGTGTTGGGGGCAGGGGG + Intergenic
1176223885 20:63983353-63983375 TACTGAGAGTGAGAGGGAGCAGG + Intronic
1176257824 20:64161596-64161618 CTTTGTGTGAGTGGGGGAGCAGG - Intronic
1176305960 21:5123293-5123315 CACCGTGTGTGGCGGGGCGCAGG - Intronic
1176326138 21:5502678-5502700 CACTAAGTCTGAGGGGGAGTGGG - Intergenic
1176401619 21:6318273-6318295 CACTAAGTCTGAGGGGGAGTGGG + Intergenic
1176435538 21:6670831-6670853 CACTAAGTCTGAGGGGGAGTGGG - Intergenic
1176459800 21:6997901-6997923 CACTAAGTCTGAGGGGGAGTGGG - Intergenic
1176483361 21:7379679-7379701 CACTAAGTCTGAGGGGGAGTGGG - Intergenic
1176915519 21:14621317-14621339 CACTGAGTGTGAGCCGAAGCAGG + Intronic
1177138004 21:17327640-17327662 CACTGTGTGTGAGCCAAAGCAGG + Intergenic
1178526570 21:33334741-33334763 CCAGGTGTGTGAGGGGCAGCTGG + Intronic
1178667963 21:34565417-34565439 CACAGAGTGTGAGCTGGAGCAGG - Intronic
1179047623 21:37860619-37860641 CAGTGTGAGTGATGGGGAGAAGG - Intronic
1179851097 21:44138738-44138760 CACCGTGTGTGGCGGGGCGCAGG + Intronic
1180979708 22:19872787-19872809 CCCAGTGTGTGAGGGGTAGGTGG + Intergenic
1181164616 22:20976688-20976710 CTCTGTGTCTGTGGTGGAGCTGG + Exonic
1181341907 22:22188003-22188025 CACTGAGTGTGAGCCGAAGCAGG + Intergenic
1181554852 22:23663149-23663171 CACTGTGCGTGAGCTGAAGCAGG + Intergenic
1181603664 22:23967086-23967108 CACTGTCGGGGAGGCGGAGCAGG - Intronic
1181604849 22:23974221-23974243 CACTGTCGGGGAGGCGGAGCAGG + Intronic
1181976578 22:26735166-26735188 CACTGTGGGTGGCCGGGAGCTGG + Intergenic
1182026057 22:27120218-27120240 AACTGAGTGAGAGAGGGAGCTGG - Intergenic
1183019596 22:35016569-35016591 CACTGTGTGTGTGGGGGGTGGGG - Intergenic
1183348224 22:37319524-37319546 CACTGCGTCAGAGGGGCAGCAGG + Intergenic
1183376968 22:37471094-37471116 CACTGTGTGTGTAGGGGATGAGG - Intronic
1183519009 22:38285495-38285517 CTGTGTGTGTATGGGGGAGCGGG + Intergenic
1183624400 22:38992919-38992941 CTCTGTGAGTGAGGGTGGGCGGG - Intergenic
1184196428 22:42932274-42932296 CAAATGGTGTGAGGGGGAGCCGG - Intronic
1184208794 22:43023258-43023280 GAGTGTGGGTGAGAGGGAGCTGG - Intergenic
1184565849 22:45291607-45291629 GACTGTGTGTGTGTGGGAGTTGG + Intronic
1184789852 22:46693374-46693396 CACTGTGTGTGCTGGAGTGCGGG - Intronic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185322028 22:50205877-50205899 CACTGTGGGTGTGGGGGCCCCGG + Intronic
949333709 3:2950469-2950491 CACTGTCTGTGATGAGTAGCAGG + Intronic
949717595 3:6951024-6951046 CACTGTGCGTGAGCCGAAGCAGG - Intronic
950176230 3:10876748-10876770 CTCTGTGTGGGAGGTGGGGCGGG - Intronic
950214071 3:11145448-11145470 CACTGTGTGTGGGGTGCAGTAGG - Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
950642754 3:14359130-14359152 GACTGTGGGTGACCGGGAGCGGG + Intergenic
950708217 3:14796960-14796982 CACTGTGGGGGAGGGGGTGGGGG - Intergenic
950980963 3:17303987-17304009 CACTGTGAGTGAGGCAGAGTAGG - Intronic
951584716 3:24203679-24203701 CACTGAGTGTGAGCCGAAGCAGG + Intronic
952049698 3:29369531-29369553 CACTTTGAGTGAGGGTGAGGAGG + Intronic
952455341 3:33467031-33467053 TCCTGTGTGGGAGGGGGAGGGGG + Intergenic
952700327 3:36321122-36321144 CACTGTGCGTGAGCTGAAGCAGG + Intergenic
952723783 3:36560696-36560718 CACTGTGTTTGTGGTGGAGGTGG - Intergenic
953039655 3:39244260-39244282 CACTGTGTGTGTGATGGAGTAGG - Intergenic
953548137 3:43879448-43879470 CACAGTGTGTGGGTGGGAGAAGG - Intergenic
954443558 3:50534672-50534694 GATTGTGTGAGAGGGGGAGTGGG - Intergenic
954761161 3:52875450-52875472 CACTGTGTGAGGGGGCCAGCAGG - Intronic
954993765 3:54863609-54863631 CACTGTGTGTGGGGAGGAGGCGG - Intronic
955099343 3:55831773-55831795 CACCGTGTGTGAGTCGAAGCAGG + Intronic
955652590 3:61210774-61210796 CACTGTGTGTGAGCCGAAGCAGG - Intronic
956125333 3:66005638-66005660 CAGTGTGTGTGAGTGGAAGGGGG + Intronic
956330011 3:68096063-68096085 AAGTGTGTGTGAGTGGGAGGGGG - Intronic
956641901 3:71423520-71423542 CTCTTTGTGTGAGGAGAAGCTGG - Intronic
957079380 3:75623536-75623558 CACTGGGGGGGGGGGGGAGCGGG - Intergenic
957101870 3:75837733-75837755 CACTGTGTGTGAGCCGAAGCAGG - Intergenic
958210609 3:90468846-90468868 CACCGTGTGTGATGCGAAGCAGG - Intergenic
959018680 3:101164933-101164955 CCCAGTGTGTGAGGGGCAGTCGG + Intergenic
959024837 3:101229317-101229339 TGGTGTGTGTGTGGGGGAGCAGG - Intronic
959041213 3:101424706-101424728 CAATGTGGCTGATGGGGAGCAGG - Intronic
959377252 3:105602206-105602228 CACTGTGGGTGATGGTGAGTGGG + Intergenic
959504644 3:107144245-107144267 CACTGTGTGCGAGCCGAAGCAGG + Intergenic
959522242 3:107333903-107333925 CACTGTGTGCGAGCTGAAGCAGG + Intergenic
961382508 3:126505055-126505077 CACGGTGAGAGAGGGAGAGCAGG - Intronic
961389960 3:126546565-126546587 CCCTGTGTGAGAGGGAGAGGCGG - Intronic
961700007 3:128736215-128736237 CACTGTGTGTTAGTGGGACTGGG + Intronic
961787685 3:129357466-129357488 CAATGTGTGTTGGGGGGATCCGG + Intergenic
963453689 3:145516792-145516814 CACATTTTGTGAGAGGGAGCTGG + Intergenic
964214319 3:154262739-154262761 CACAGAGTGTGAGGGGAAGCAGG + Intergenic
964532678 3:157685364-157685386 CACTGTGTGTGAGCTGAAGCAGG + Intergenic
964584465 3:158281444-158281466 TGCTGTGTGTGAGGGTGAGATGG + Intronic
964686141 3:159398173-159398195 CACCGTGTGTGAGCTGAAGCAGG - Intronic
965223208 3:165954080-165954102 CATTGTTTGTGAGGGAGACCTGG + Intergenic
965450950 3:168837043-168837065 GAGTGTGTGTGAGGGAGAGGTGG - Intergenic
965886448 3:173452027-173452049 CACTGTGCGTGAGCCGAAGCAGG - Intronic
966711961 3:182980578-182980600 CACTGCGCATGAGCGGGAGCCGG - Exonic
968226466 3:196975507-196975529 CTCTGTGTCTGAGGGCCAGCAGG + Intergenic
968737311 4:2304125-2304147 GTCTGTGTGTGAGGAGGGGCAGG - Intronic
969587883 4:8104956-8104978 TCCTGGGTGTGAGTGGGAGCAGG - Intronic
969950341 4:10829155-10829177 CACTGTGCGTGAGCCGAAGCAGG - Intergenic
970020014 4:11557602-11557624 CACTGTGTGTGAGCTGAAGCAGG + Intergenic
970095759 4:12461456-12461478 CACTGTGCGTGAGCCGAAGCAGG + Intergenic
970348161 4:15174162-15174184 CACCGTGTGTGAGCGGAAGCAGG + Intergenic
971053988 4:22892119-22892141 CACCGTGTGTGAGCCGAAGCAGG - Intergenic
972439645 4:39074937-39074959 AACTGGGTGTGAGGGTGAGGAGG + Intronic
972677715 4:41276388-41276410 CACTGTGTGTGAGCCGAAGCAGG - Intergenic
972802131 4:42487867-42487889 CACTGTGTGTAATGGGGAACAGG - Intronic
973347034 4:49067999-49068021 CACTGTGTGTGAGCTGAAGCAGG + Intergenic
973626120 4:52774132-52774154 CACTGAGTGTGAGCTGAAGCAGG - Intergenic
973797241 4:54440070-54440092 CAATGTGTGTGGGGGGGGGGGGG + Intergenic
973874696 4:55206062-55206084 CACAGAGTGTGAGTGGAAGCAGG + Intergenic
974142023 4:57899764-57899786 CACTGTGTGCGAGCTGAAGCAGG + Intergenic
974470162 4:62309419-62309441 CACTGAGTGTGAGCTGAAGCAGG + Intergenic
974723561 4:65772103-65772125 CACTGGGTGTGAGGTGAAGCAGG - Intergenic
974956399 4:68646206-68646228 CACTGTGTGTAAGCTGAAGCAGG - Intronic
975287502 4:72637311-72637333 CACCGTGTGTGAGCCGAAGCAGG - Intergenic
975443647 4:74439065-74439087 CTCTGAGTGTGAGGGGGACTTGG + Intergenic
975668320 4:76755139-76755161 CACTGTATGTGAGGCGCAGCTGG + Exonic
975813714 4:78195742-78195764 CACTGAGTGTGAGCCGAAGCAGG - Intronic
975821688 4:78277283-78277305 CACTGAGTGTGAGCCGAAGCAGG - Intronic
976682131 4:87769240-87769262 CACCGTGTGTGAGCCGAAGCAGG + Intergenic
977721491 4:100244667-100244689 CACTCAGTGGGAAGGGGAGCTGG + Intergenic
978548618 4:109900258-109900280 CACTGTGCGTGAGCTGAAGCAGG - Intergenic
979100907 4:116613004-116613026 AAGTGTGTGTGGGGGGGAGGGGG - Intergenic
979215779 4:118161845-118161867 CACCGTGTGTGAGCAGAAGCAGG - Intronic
979778302 4:124617908-124617930 CACCGTGTGTGAGCTGAAGCAGG - Intergenic
980149011 4:129023706-129023728 CACTGTGTGCGAGCTGAAGCAGG + Intronic
980753900 4:137130863-137130885 TACTGTGTGCCAGGGGGAGGTGG + Intergenic
981048081 4:140284052-140284074 CTGTGTGTGTGAGAGAGAGCAGG + Intronic
981247527 4:142557438-142557460 GTCTGTGTGTGAGTGGGAGGTGG - Intronic
981249698 4:142585051-142585073 CACTGTGTGTGTGGTGGTGGGGG + Intronic
981338584 4:143594196-143594218 CACCGTGTGTGAGATGGAGCAGG - Intronic
981957995 4:150502725-150502747 CACCGTGCGTGAGGCGAAGCAGG + Intronic
982671045 4:158320404-158320426 CTCTGAGTGGGAAGGGGAGCTGG + Intronic
983892028 4:173039475-173039497 CATTGTGTGTGCGTGTGAGCAGG + Intronic
983897789 4:173100088-173100110 CACTGTGTGTTGGGGGCAGGGGG - Intergenic
984067946 4:175072913-175072935 CACAGTGTGTGAGGGGGTGTGGG + Intergenic
984199379 4:176698580-176698602 TACTGTGTGTGTGGGGGAGTTGG + Intronic
984330882 4:178316349-178316371 CACTGTGTGTGAGGAGACACAGG - Intergenic
985217482 4:187669690-187669712 TTCTGTGTGGGAGGGGGAGGGGG - Intergenic
985307974 4:188564109-188564131 CACCGTGTGCGAGCGGAAGCAGG - Intergenic
985393113 4:189513013-189513035 TTCTCTGTGTGAGGGGAAGCTGG - Intergenic
985504979 5:273683-273705 CGCTGTGGGTGGGGGGGTGCTGG + Intronic
985519427 5:366068-366090 CAGTGTGTGTGTGGGGCAGGGGG - Intronic
985754027 5:1702482-1702504 CTCTGTGTGGGGGTGGGAGCAGG + Intergenic
986472517 5:8090077-8090099 CACTGTGTGCGAGCCGAAGCAGG - Intergenic
986571276 5:9168519-9168541 CCATGTGGGTGAGGGGGAGGAGG + Intronic
987066816 5:14297854-14297876 CACTGTGGCTGAGGAGGAGCTGG - Intronic
987387683 5:17345612-17345634 AACTGGGTGTGAGGGCGATCTGG + Intergenic
989861997 5:46389362-46389384 CACTGTGTGTGAGCTGAAGCAGG + Intergenic
989977350 5:50602100-50602122 CACTGTGTGTGAGCCGAAGCAGG - Intergenic
990188171 5:53230101-53230123 CACCGTGTGTGAGCTGAAGCAGG - Intergenic
990360355 5:55013008-55013030 CACTGAGTGTGAGCTGAAGCAGG + Intronic
990842885 5:60104028-60104050 CACTGTGTGCGAGCCGAAGCAGG + Intronic
991352772 5:65735782-65735804 CACTGAGTGAGAGGAGAAGCTGG - Intronic
991545750 5:67780179-67780201 CACCGTGTGTGAGCCGAAGCAGG + Intergenic
992181990 5:74206572-74206594 GACTGTGTGTGCGGTGGAGTGGG - Intergenic
992620249 5:78585455-78585477 CACTGTGCGTGAGCCGAAGCAGG - Intronic
992891272 5:81206556-81206578 CAGTGAGTCTGAGGGTGAGCTGG - Intronic
994639517 5:102389447-102389469 CTCTGTGTGTGTGGGGGTGGGGG - Intronic
995309257 5:110692473-110692495 CACCGTGTGTGAGCTGAAGCAGG + Intronic
995338446 5:111029891-111029913 CACTGTGTGTGAGCCGAAGCAGG + Intergenic
996360163 5:122636754-122636776 CACTGAGTGTGAGCTGAAGCAGG - Intergenic
997137090 5:131337937-131337959 CACTGTGCGTGAGCGGAAGCAGG - Intronic
997969221 5:138386521-138386543 CACTGTGTTTGGGGTGGAGCTGG - Exonic
998005101 5:138651529-138651551 CTCTGTGTGTGTGGGGGTGGGGG - Intronic
998298700 5:140997106-140997128 CATTGTGTATGTGGGAGAGCAGG - Intronic
998417405 5:141955832-141955854 CATTGGGAGTGAGTGGGAGCTGG - Exonic
998693027 5:144608617-144608639 CAATGTGTGTGAAGGCGAGAAGG - Intergenic
998779282 5:145638386-145638408 GACTGTGTGTGTGGGGGAAGGGG - Intronic
998791434 5:145769751-145769773 CACTGTGTGTAAGGAAGGGCAGG + Intronic
999652093 5:153777681-153777703 CAGTGTGTGTGAGGGGGATGAGG - Intronic
999669678 5:153947901-153947923 CACCGTGTGTGAGCTGAAGCAGG + Intergenic
1000320934 5:160133788-160133810 CACTGTGTGTCAGGGAGGGTGGG + Intergenic
1000995345 5:167952837-167952859 CACTGAGTGTGACTGTGAGCTGG - Intronic
1001359209 5:171064135-171064157 CACCGTGTGTGAGCCGAAGCAGG - Intronic
1001530100 5:172455285-172455307 GACTATGTGTGAGGGGCAGCTGG + Intergenic
1001577690 5:172774819-172774841 CACTGTCTGGCAGGGGGAGGGGG - Intergenic
1001602029 5:172935133-172935155 AACTGTGTCTCAGGGGGGGCGGG - Intronic
1001773218 5:174311293-174311315 CTCTGTGTGTGAGGAGGCCCGGG + Intergenic
1001983307 5:176051915-176051937 CACTGAGTGTGAGCTGAAGCAGG + Intronic
1001987147 5:176084138-176084160 CACTGAGTGTGAGCCGAAGCAGG - Intronic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002376159 5:178790519-178790541 CACTGGCAGTGAGAGGGAGCCGG - Intergenic
1002394977 5:178945685-178945707 CTCTGTGTGTGGGGGGGTGTGGG + Intronic
1002521189 5:179794035-179794057 GGCTGTGTGTGAAGGCGAGCTGG - Exonic
1202773512 5_GL000208v1_random:35735-35757 CACCGTGTGTGAGCCGAAGCAGG - Intergenic
1003225818 6:4204479-4204501 CACTGTGTATGAGCCGAAGCAGG - Intergenic
1003260392 6:4511133-4511155 GACTGTGTGGGAGGGGCGGCCGG + Intergenic
1004368110 6:15029081-15029103 CACTGTGTGGGAAGGAGGGCAGG - Intergenic
1004942637 6:20576797-20576819 CTCTGTGTGTGGCGTGGAGCAGG + Intronic
1005227130 6:23655975-23655997 CAATGTGTGTGTGGGGGGGGGGG + Intergenic
1007285780 6:40746547-40746569 CAATGTGTGGGTGGGGGAGGAGG - Intergenic
1007751299 6:44073520-44073542 CGCTGGGTGGGAGGGGGAGGAGG + Intergenic
1008075365 6:47139877-47139899 TATTGAGTGTGATGGGGAGCAGG - Intergenic
1009024062 6:57976545-57976567 GCCTGTGTGGGATGGGGAGCTGG + Intergenic
1009199639 6:60728078-60728100 GCCTGTGTGGGATGGGGAGCTGG + Intergenic
1009875053 6:69495520-69495542 CACCGTGTGTGAGCCGAAGCAGG + Intergenic
1010840066 6:80638579-80638601 CACTTTGTGTGTGTGGGGGCGGG + Intergenic
1010856544 6:80847897-80847919 CACCGTGTGTGAGCGGAAGCAGG + Intergenic
1011260348 6:85464182-85464204 CACAATTTGTAAGGGGGAGCTGG - Intronic
1011338446 6:86285444-86285466 CACTGTGCGTGAGCTGAAGCAGG - Intergenic
1013301210 6:108806286-108806308 CACTGTGTCTGAGGCAGAGGAGG - Intergenic
1014185188 6:118426964-118426986 CACTGTGTGCGAGCTGAAGCAGG + Intergenic
1014679749 6:124413142-124413164 CACCGTGTGTGAGCCGAAGCAGG - Intronic
1014710827 6:124804661-124804683 CACTGTGCGTGAGCCGAAGCAGG + Intronic
1015261355 6:131241172-131241194 CACGATGGTTGAGGGGGAGCAGG + Intronic
1018015005 6:159704298-159704320 CACTGAGTGTGAGCCGAAGCAGG + Intronic
1018696963 6:166397858-166397880 GACGGTGTGAGAGGGGCAGCTGG + Intergenic
1018812578 6:167308464-167308486 CCCTGTGGATGTGGGGGAGCAGG + Intronic
1019711765 7:2521176-2521198 CACTGTGGGTGGGTGGGAGCAGG + Intronic
1019779151 7:2929538-2929560 CACTTGGTGGGAGGAGGAGCTGG - Intronic
1020097721 7:5377853-5377875 CCCTGGGGGTGAGGGGCAGCTGG - Intronic
1021041966 7:15873144-15873166 CCCTTTATGGGAGGGGGAGCAGG - Intergenic
1021069229 7:16216585-16216607 CACCGTGCGTGAGCGGAAGCAGG + Intronic
1021661562 7:22924355-22924377 CACTGTGTGTGAGCCGAAGCAGG + Intergenic
1022193653 7:28042367-28042389 TTCTGAGTCTGAGGGGGAGCTGG + Intronic
1022256385 7:28662628-28662650 GGCTGTGTGTTGGGGGGAGCTGG - Intronic
1022654694 7:32307901-32307923 CACTGTGCGTGAGCCGAAGCAGG + Intergenic
1022660011 7:32358129-32358151 CACTGCGTGGGAAGGGGAGGAGG - Intergenic
1022939468 7:35219207-35219229 CACTGTGGGTCAGTGGGAGCAGG + Intronic
1023487345 7:40701187-40701209 GAGTGTGTGGGAGGGGGAGTGGG - Intronic
1024022315 7:45383349-45383371 CACTGTGTGCGAGCTGAAGCAGG - Intergenic
1024552695 7:50576802-50576824 CACTGAGTGTGAGCTGAAGCAGG - Intergenic
1024671531 7:51599968-51599990 CACCGTGTGTGAGCCGAAGCAGG - Intergenic
1024872778 7:53984937-53984959 AAGTGCGTGTGAGGGGGAGGAGG + Intergenic
1024891047 7:54203906-54203928 TAATGTGTGTGGGGGGGGGCAGG + Intergenic
1025595194 7:62914807-62914829 CACTGTGTGTGAGCTGAAGCAGG - Intergenic
1026977529 7:74507634-74507656 CATGGAGTGTGAGGGGGAACTGG + Intronic
1028458310 7:91062368-91062390 CACTGAGTGTGAGCCGAAGCAGG - Intronic
1028886679 7:95941775-95941797 CACTGTGTGTGAGCCGAAGCAGG - Intronic
1029036972 7:97532721-97532743 CACTGTGCGTGAGCCGAAGCAGG + Intergenic
1030353732 7:108520428-108520450 AACAGTGTGTGAGGGAGAGTTGG + Intronic
1031366683 7:120908948-120908970 AACTGTGTGTTGGGGGGAGTGGG - Intergenic
1031617094 7:123894655-123894677 CACCGTGTGTGAGCCGAAGCAGG + Intergenic
1031706405 7:124985311-124985333 CACTGTGTGCGAGCCGAAGCAGG - Intergenic
1033420596 7:141201376-141201398 GACTGTGTGGTTGGGGGAGCCGG + Intronic
1033504440 7:141985935-141985957 CACCGTGTGTGAGCCGAAGCAGG - Intronic
1033631862 7:143166175-143166197 CACTGAGTGTGAGGTGAAGCAGG - Intergenic
1034221684 7:149451267-149451289 CACTGTGGGTGTGGGGGTGTGGG + Intronic
1034256494 7:149727509-149727531 CCCTCTGTGTGAGGAGGAGGAGG - Intronic
1034423594 7:151001635-151001657 CAGGGTGTGTGTGGGAGAGCGGG - Intronic
1035061534 7:156073127-156073149 GAGGGTGTGTGAGGGAGAGCAGG - Intergenic
1035336761 7:158134293-158134315 GCATGTGTGTGAGAGGGAGCGGG - Intronic
1035650026 8:1257197-1257219 CTCTGTGGGTGAGCGGGAGAGGG - Intergenic
1036050100 8:5187180-5187202 CACTGTGTGTGAGCAGAAGTAGG + Intergenic
1036086533 8:5618645-5618667 GGGTGTGTGTGTGGGGGAGCGGG + Intergenic
1036086548 8:5618699-5618721 GGGTGTGTGTGTGGGGGAGCGGG + Intergenic
1037271095 8:17131445-17131467 CCCTGAGTGTCAGAGGGAGCTGG + Intergenic
1037946598 8:22993451-22993473 TTATGTCTGTGAGGGGGAGCAGG + Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038051807 8:23820962-23820984 TACTGTGTGTGAGGGAATGCGGG + Intergenic
1038406600 8:27326711-27326733 CACTCTGGGGGAGGGGGAGGAGG + Intronic
1040390084 8:46942317-46942339 CACTGTGTGTGAGCCGAAGCAGG + Intergenic
1040989807 8:53337812-53337834 CACCGTGTGTGAGCTGAAGCAGG + Intergenic
1041055906 8:53985705-53985727 TACTGTGTGTGAGTAGGGGCAGG - Intronic
1041161524 8:55050052-55050074 CACTGTGCGTGAGCTGAAGCAGG + Intergenic
1041515301 8:58692690-58692712 CACTGTGTGTTGGGGGCAGGGGG - Intergenic
1041970788 8:63740050-63740072 CAATATGTGTGTGGGGGGGCGGG - Intergenic
1043303468 8:78763781-78763803 CAGTGTGTGTAAGCAGGAGCAGG + Intronic
1044857616 8:96493051-96493073 AACTGTGTGTGAGGGAGAAATGG + Intergenic
1046081624 8:109376468-109376490 CACTGTGAGTGAGCCGAAGCAGG - Intronic
1046670047 8:117047062-117047084 CACTGTGGATGAGTGGGAGACGG + Intronic
1047373374 8:124274434-124274456 AACTGTGTGTTAGGGAGACCTGG + Intergenic
1047885296 8:129243674-129243696 CAATGTGTGTGTGGGGGCGGGGG + Intergenic
1048466362 8:134667782-134667804 CACTGAGTGTGAGCCGAAGCAGG + Intronic
1048496399 8:134939573-134939595 AAGCGTGTGTGAGTGGGAGCAGG + Intergenic
1048570025 8:135644637-135644659 CACTGTGGGAGTGGGGGAGGAGG - Intronic
1048626991 8:136196043-136196065 CACAGTGTGTGAGCCGAAGCAGG - Intergenic
1049208819 8:141375973-141375995 CTCAGTGTGTGAGCGGGATCAGG + Intergenic
1049290379 8:141798485-141798507 CTCTGAGTGTGTGGGGGAGTGGG + Intergenic
1049302976 8:141881571-141881593 CCCTGTCTTTGAGTGGGAGCTGG - Intergenic
1049497749 8:142944474-142944496 CTCTGTGTGTGACAGGGACCAGG + Intergenic
1049528640 8:143142485-143142507 CCCCCTGTGTGAGGGCGAGCTGG - Intergenic
1049528695 8:143142651-143142673 CCCTCTGTGTGAGGGTGAGCTGG - Intergenic
1049528727 8:143142761-143142783 CCCTCTGTGTGAGGGTGAGCTGG - Intergenic
1049528741 8:143142816-143142838 CCCCCTGTGTGAGGGCGAGCTGG - Intergenic
1050442930 9:5684113-5684135 CACTGTGCGTGAGCTGAAGCAGG - Intronic
1051701890 9:19833249-19833271 CACTGTGTGTGAGCCAAAGCAGG + Intergenic
1052431307 9:28370317-28370339 GAATGTGTGTGAGGAGGAGGTGG - Intronic
1052441252 9:28498625-28498647 CACCGAGTGTGAGCGGAAGCAGG - Intronic
1052788355 9:32850955-32850977 AATTCTGTGTGAGGGGGAGCTGG + Intergenic
1053038854 9:34851574-34851596 CACTGTGTGCGAGCCGAAGCAGG - Intergenic
1056097314 9:83268728-83268750 CACTGTGGCTGAGGTGGGGCAGG + Intronic
1056393183 9:86157244-86157266 CACTGTGCGTGAGCCGAAGCAGG + Intergenic
1056592311 9:87973791-87973813 CAGTGTGTGTGAGTGACAGCGGG + Intronic
1056973719 9:91231402-91231424 CACCGTGTGTGAGCCGAAGCAGG - Intronic
1057319060 9:93995395-93995417 CAGTGTGTGTGGGGGTGGGCAGG - Intergenic
1057322398 9:94026316-94026338 CACTGTGCGTGAGCCGAAGCAGG - Intergenic
1058099732 9:100905684-100905706 CTCTGTGTGTGTGGGGGGGGGGG + Intergenic
1059660334 9:116393834-116393856 CACTGAGAGTGAGGAGGAGAAGG + Intronic
1059870527 9:118568842-118568864 CACTGTGACTGAGTGGGAGGAGG - Intergenic
1060280411 9:122212317-122212339 CACTGTAAGTTAGTGGGAGCCGG - Intronic
1060559796 9:124533563-124533585 AACTGGGTGGGAGGGGGAGATGG + Intronic
1060943277 9:127555670-127555692 CACTGAGTGGGAAAGGGAGCAGG - Intronic
1061068332 9:128293211-128293233 CACAGTGAGTCAGGGGCAGCTGG + Intergenic
1061489831 9:130938779-130938801 CGCTGTGTGCGGGCGGGAGCAGG + Exonic
1062351609 9:136142384-136142406 CAGAGGGTGTGAGGGGCAGCAGG + Intergenic
1062519736 9:136952654-136952676 CTCTGTGCGTGAGGGGAAACAGG + Intronic
1203759114 EBV:2839-2861 CACTATGTTTAACGGGGAGCTGG + Intergenic
1186967979 X:14809348-14809370 CACTGTGTGCGAGCTGAAGCAGG + Intergenic
1187438477 X:19294604-19294626 GACTGTGTGTGAGGTAGAGTGGG - Intergenic
1187668963 X:21649700-21649722 CACTGTGTGTGGGGGAGTGTGGG + Intronic
1188075653 X:25772295-25772317 CACCGTGTGTGAGCTGAAGCAGG - Intergenic
1188940878 X:36235591-36235613 CACCGTGTGTGAGCCGAAGCAGG - Intronic
1190108761 X:47576295-47576317 CTCAGGGTGTGAGGGGAAGCGGG - Intronic
1190942202 X:55052777-55052799 CACCGTGTGTGAGCCGAAGCAGG - Intergenic
1191273427 X:58510521-58510543 CACTGTGTGCGAGCTGAAGCAGG + Intergenic
1191639070 X:63410555-63410577 CACTGTGTGTTGGGGGAAGGGGG - Intergenic
1191907445 X:66108283-66108305 CACTGAGGGTGAGGTGAAGCAGG - Intergenic
1191916050 X:66202303-66202325 CAATGTGTGGGAGGTGGAACTGG + Intronic
1191960261 X:66692957-66692979 CACTGTGTGTGAGCTGAAACAGG - Intergenic
1192042040 X:67632487-67632509 CACCGTGTGTGAGCCGAAGCAGG - Intronic
1192210793 X:69126572-69126594 CACTGTGGGTGGGGGGCAGGGGG - Intergenic
1192412202 X:70943932-70943954 CACTGTGTGCGAGCCGAAGCAGG - Intergenic
1192598871 X:72440701-72440723 CACTGTGCGTGAGCCGAAGCAGG + Intronic
1192605772 X:72515578-72515600 CAGTGTGTGTGGGGGGGGGGTGG + Intronic
1192697674 X:73434575-73434597 CACTGTGTGTGAGCCGAAGCAGG - Intergenic
1192884132 X:75319477-75319499 CACCGTGTGTGAGCCGAAGCAGG - Intergenic
1193064442 X:77244425-77244447 CACCGTGTGTGAGCTGAAGCAGG + Intergenic
1193323990 X:80157279-80157301 CACTGTGTGCGAGCCGAAGCAGG - Intergenic
1193391671 X:80936728-80936750 CACCGTGTGTGAGCTGAAGCAGG + Intergenic
1194803526 X:98300498-98300520 CACTGTGTGCGAGCCGAAGCAGG + Intergenic
1195456873 X:105079000-105079022 CACTGTGTGTGAGCCGAAGCAGG - Intronic
1196155399 X:112423102-112423124 CATTGTGTGTGGGGGGGGGATGG + Intergenic
1196162554 X:112502195-112502217 CACTGTGCGTGAGCCGAAGCAGG + Intergenic
1196423217 X:115544033-115544055 CACTGTGTGTTGGGGGTAGGGGG + Intergenic
1196506405 X:116449386-116449408 GCCTGTGTGACAGGGGGAGCTGG - Intronic
1196856957 X:119993253-119993275 CACTGGGGGTGTGGGGGGGCAGG + Intergenic
1196892482 X:120304849-120304871 AAGTGTGTGTGTGGGGGAGGGGG + Intronic
1197000840 X:121437801-121437823 CACTGTGCGTGAGCCGAAGCGGG + Intergenic
1197574799 X:128199095-128199117 CACTGTGTGTGAGCTGAAGCAGG + Intergenic
1197927663 X:131664110-131664132 CACCGTGTGTGAGCCGAAGCCGG + Intergenic
1198283906 X:135171280-135171302 CACAGTGTCTGAGGAGAAGCAGG - Exonic
1198553564 X:137769282-137769304 CACTGAGCGTGAGGTGAAGCAGG - Intergenic
1198688966 X:139259698-139259720 CACTGAGTGTGAGCCGAAGCAGG + Intergenic
1199098376 X:143768215-143768237 CACTGAGTGTGAGCCGAAGCAGG - Intergenic
1199587905 X:149435972-149435994 CACCGTGTGTGAGCCGAAGCAGG + Intergenic
1199679800 X:150216668-150216690 TACTGTGTGTGGGCAGGAGCTGG - Intergenic
1199695428 X:150340381-150340403 TACTGTGTGTGGGCAGGAGCTGG + Intergenic
1200295057 X:154911285-154911307 CACTGTGGGTGACGAGGGGCAGG + Intronic
1200297678 X:154939188-154939210 CACTGTGCGTGAGCCGAAGCAGG + Intronic
1201346675 Y:12991841-12991863 CACCGTGTGTGAGCCGGAGCAGG - Intergenic
1201415663 Y:13746564-13746586 CACCGTGGGTGAGCGGAAGCAGG - Intergenic
1201690742 Y:16762213-16762235 CACTGAGTGTGAGTTGAAGCAGG + Intergenic
1201739801 Y:17311791-17311813 CACTGTGTGTGAGCTGAAGCAGG + Intergenic
1201771435 Y:17620534-17620556 CACAGTGTGTGGGGGGGCGGGGG - Intergenic
1201830120 Y:18285452-18285474 CACAGTGTGTGGGGGGGCGGGGG + Intergenic
1201920949 Y:19232784-19232806 CACTGAGTGTGAGCTGAAGCAGG - Intergenic
1202020846 Y:20463230-20463252 CACTGAGTGTGAGCTGAAGCAGG - Intergenic
1202383531 Y:24300261-24300283 CACTGTGCGTGAGCTGAAGCAGG - Intergenic
1202487252 Y:25369859-25369881 CACTGTGCGTGAGCTGAAGCAGG + Intergenic