ID: 1159954413

View in Genome Browser
Species Human (GRCh38)
Location 18:74509239-74509261
Sequence ACAGAGCCTGCACTATGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159954413_1159954415 11 Left 1159954413 18:74509239-74509261 CCAGAACATAGTGCAGGCTCTGT 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1159954415 18:74509273-74509295 GGCCCCTCACTGTCTCTGTGTGG 0: 1
1: 0
2: 0
3: 31
4: 246
1159954413_1159954414 -10 Left 1159954413 18:74509239-74509261 CCAGAACATAGTGCAGGCTCTGT 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1159954414 18:74509252-74509274 CAGGCTCTGTCACATCACACAGG 0: 1
1: 0
2: 2
3: 15
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159954413 Original CRISPR ACAGAGCCTGCACTATGTTC TGG (reversed) Intronic
903116462 1:21182518-21182540 ACAGAGGCTGCACTGGGCTCTGG - Intergenic
903570647 1:24302279-24302301 GCAGAGCATGTACTATGTACTGG + Intergenic
904048078 1:27621361-27621383 ATAGAGCATGTACTATGTTCTGG - Intronic
905451627 1:38060618-38060640 ACAGAGCCTCCACCAAGGTCGGG - Intergenic
906521795 1:46471176-46471198 ACTGAGCCTGGCCTATGCTCAGG + Intergenic
907078922 1:51603585-51603607 GCAGAGCCTATTCTATGTTCTGG + Intronic
907869197 1:58427571-58427593 ACAGAGCCAGCAGTATCTGCTGG + Intronic
911355389 1:96811920-96811942 TCACACACTGCACTATGTTCTGG + Intronic
911806053 1:102210096-102210118 ACAAAGCCTGCACTAAGCTTGGG - Intergenic
912922772 1:113885356-113885378 AGTGTGCCTACACTATGTTCAGG - Intronic
914926747 1:151895418-151895440 ACAGAGCCAGGATTATGCTCAGG + Intronic
919040678 1:192383941-192383963 ACATAGCCTTTACTATGTTGAGG - Intergenic
919343666 1:196347074-196347096 AAAAAGCCAGCACTTTGTTCAGG + Intronic
919349052 1:196425401-196425423 AAAGAGCTTGCACTATGTATTGG - Intronic
919594655 1:199546827-199546849 CCAGAGCCGGCACTATCTTGGGG + Intergenic
920614458 1:207476166-207476188 ACATAGCCTGCACTATCTCTGGG - Intronic
922818157 1:228465839-228465861 GCAGAGCCTGCTCTATGCCCCGG + Intergenic
924803912 1:247347809-247347831 CCAGAGCCTTCTCGATGTTCGGG + Intergenic
1063708534 10:8454536-8454558 ACAGAGCCAGCACCAGGTGCTGG - Intergenic
1067733462 10:48830713-48830735 AGAGAGTCTGCACTGTCTTCTGG - Exonic
1072450028 10:95532365-95532387 ACAGAGCCTCCACTCTGTTCAGG + Intronic
1077797435 11:5507402-5507424 ACAGCACCTCCACTATGTTTTGG + Exonic
1078079334 11:8192702-8192724 CCAGAGGCTGCACTAAGTTCAGG - Intergenic
1081695582 11:45106956-45106978 ACAAAGCCTGGACTTTGTTCTGG - Intronic
1083313674 11:61800655-61800677 ACAGAGCCTCCACTTAGTTTTGG - Exonic
1083924718 11:65798873-65798895 ACAGAGCCTGGAGAATATTCTGG - Intergenic
1085887130 11:80534129-80534151 ACAGAACTTTCACAATGTTCTGG + Intergenic
1089109484 11:116043888-116043910 ATAGAGCCTGCCCTCTGGTCTGG - Intergenic
1092057169 12:5517006-5517028 ACAGAGCCTGCACCAGGGGCAGG - Intronic
1093259904 12:16923078-16923100 ACAGAGCCCACAGTATGTTTGGG + Intergenic
1099781119 12:87196683-87196705 AAATAGCATGAACTATGTTCAGG - Intergenic
1101530134 12:105566364-105566386 GCAGAGCTTGGACTCTGTTCAGG + Intergenic
1104544712 12:129700333-129700355 ACAGAACCTGCACTTTGGGCCGG + Exonic
1105603023 13:21903766-21903788 CCTGAGCATTCACTATGTTCAGG + Intergenic
1109673705 13:65643890-65643912 ACAGAGTCTTCACTATGTTAAGG + Intergenic
1113207057 13:107929350-107929372 ACATAGCCTGCACAGTGATCTGG + Intergenic
1115003596 14:28452671-28452693 ACAGAACCTTCATTATGTTGAGG + Intergenic
1115070762 14:29319407-29319429 AAAGAGCCTTCACTTTGTTTGGG - Intergenic
1117054916 14:51901827-51901849 GCAGAGCCTGCAGTATGCCCAGG + Intronic
1117319071 14:54603345-54603367 ACAGAGTCTACAGTATTTTCGGG - Intronic
1128794369 15:70454151-70454173 ACAGGGCCTGGGCTATGTTTGGG - Intergenic
1132655427 16:1040050-1040072 ACAGAGGCTTCACCACGTTCAGG - Intergenic
1133861797 16:9602429-9602451 ACAGAGCCTGGCCTATGTTTGGG + Intergenic
1134094459 16:11410563-11410585 ACAGAGCATGCGCTATGTGCTGG - Intronic
1137473802 16:48789157-48789179 AGAGGGCATGCACTATTTTCTGG - Intergenic
1146480843 17:33203706-33203728 AGTGAGCCTGTACTATGTGCAGG - Intronic
1147027483 17:37600622-37600644 ACAGAGCCAGGACTAATTTCAGG - Intronic
1151322350 17:73359531-73359553 ACAGAGCCTGCACCTTCTCCGGG + Intronic
1151652326 17:75477691-75477713 ACAGCTCCTGCACGACGTTCTGG - Intronic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1156566018 18:38191884-38191906 AAAGATCCTACAATATGTTCAGG + Intergenic
1159954413 18:74509239-74509261 ACAGAGCCTGCACTATGTTCTGG - Intronic
1166110468 19:40619708-40619730 ACAGGGTGTGCACTGTGTTCAGG + Intronic
1166955171 19:46459314-46459336 ACAGAGCCTACACTATATAAAGG - Intergenic
926170472 2:10550010-10550032 ACAGAGCAGGCACTCAGTTCAGG - Intergenic
927711245 2:25327787-25327809 TCAGAGCCGGCTCTATTTTCTGG + Intronic
927778127 2:25917952-25917974 ACAGAGCATGCACTGTGAACAGG + Intergenic
928399369 2:30966718-30966740 GCAGAGGCTTCACTGTGTTCTGG + Intronic
930883620 2:56299466-56299488 CCTGAGGCTGCACTCTGTTCTGG + Intronic
933779884 2:85794345-85794367 ACAGTGCCCAAACTATGTTCTGG - Intergenic
934559154 2:95303393-95303415 GCAGAGACTGGACTGTGTTCAGG + Intronic
935846734 2:107174025-107174047 ACAGAGCCTGCACTTTCCTTAGG + Intergenic
938672009 2:133595584-133595606 ACAGAGCCTGGACTTTCCTCTGG + Intergenic
939333782 2:140798965-140798987 ACAGAGCATCTACTTTGTTCCGG - Intronic
943927658 2:193806601-193806623 ACAGAGCATACAATATGTCCAGG + Intergenic
944800429 2:203233050-203233072 ACCGTGCCTGGACTATTTTCAGG + Intergenic
946984362 2:225255730-225255752 ACAGAGCCTGGACTAGGGTGAGG - Intergenic
947945775 2:234101011-234101033 ATTGAGCCTGCACTATATGCCGG + Intergenic
948292633 2:236837468-236837490 ACAGAGTCTGCACTCTGGACTGG + Intergenic
948679228 2:239621310-239621332 TCAGAGCCAGCATTATGTCCAGG + Intergenic
1168907265 20:1416414-1416436 CCAGATTCTGCACCATGTTCAGG + Intergenic
1169514909 20:6305303-6305325 ACAGCACGTGCAGTATGTTCTGG - Intergenic
1172947530 20:38700862-38700884 AGAGAGCCTGGGCTTTGTTCAGG + Intergenic
1173154208 20:40594163-40594185 ACAAATCCTGAACTATGTGCTGG - Intergenic
1173550531 20:43930222-43930244 ACACAGCCTGGGCTATGTTACGG - Intronic
1173869975 20:46335310-46335332 AGAGAGCCTACAGTGTGTTCAGG + Intergenic
1175667758 20:60874563-60874585 GCAGAGCCTCCACAATGTTTGGG + Intergenic
1177699852 21:24624133-24624155 ACAGAACCGGCAATATCTTCTGG + Intergenic
1181643907 22:24220038-24220060 ACACAGCCTGGACCACGTTCAGG + Exonic
1184019126 22:41808769-41808791 ACAGAGGCTGCACTATGTCGGGG + Intronic
950880293 3:16317695-16317717 ACAGTGTCTGCCCCATGTTCTGG - Intronic
952505978 3:34007202-34007224 ACAGAGCCTCTACCATGTCCTGG - Intergenic
953493891 3:43370441-43370463 CCAGAGCCTGCAGTATGGCCTGG - Intronic
957187879 3:76966316-76966338 ACAGTGCCTGGAATATGTTAGGG - Intronic
962964715 3:140342814-140342836 GCAGAGGCTGCAAGATGTTCTGG - Intronic
966567504 3:181399286-181399308 ACAGTGCCTGCCCTATTTACAGG - Intergenic
974911110 4:68121043-68121065 ATAGAACCTGCAATATCTTCAGG + Intronic
979004773 4:115279504-115279526 ATACAGCCTTCACTATGTTGAGG - Intergenic
979507942 4:121519428-121519450 ACAGAGGCTGAACAATGCTCTGG - Intergenic
979864733 4:125739656-125739678 ACAGAGCCTGCAAAATGTATTGG + Intergenic
981599555 4:146470107-146470129 ACAGAGCTTGCACTATTATTTGG + Intronic
986626630 5:9728970-9728992 ACAAAGCCTGAGCTATCTTCTGG + Intergenic
988901995 5:35743843-35743865 GCTGAGCATGCACTATGTTCTGG + Intronic
993841844 5:92889850-92889872 ACAGAGCATTCACAATGGTCTGG + Intergenic
999051925 5:148532144-148532166 ACAAGGACAGCACTATGTTCTGG + Intronic
1001927883 5:175652204-175652226 ACAGAACCTGGACAATCTTCAGG - Intergenic
1004669247 6:17780200-17780222 ACAGAATCTGCAGCATGTTCAGG + Intronic
1008664401 6:53701861-53701883 CCAGAGCCTGCCATCTGTTCTGG - Intergenic
1011867925 6:91854338-91854360 AGAGAGCCTCCACTATGGGCAGG + Intergenic
1014247437 6:119082782-119082804 TGACAGCCTGCACCATGTTCTGG - Intronic
1019031916 6:169020962-169020984 GCAGAGCCTGTACAATGGTCGGG - Intergenic
1021272465 7:18607401-18607423 AGAAATCCTGCACTATGTGCAGG - Intronic
1023175229 7:37429600-37429622 ACAGTACCATCACTATGTTCAGG + Intronic
1023607207 7:41941727-41941749 ACAGAGCCTGGACTGTGTGAAGG - Intergenic
1028418672 7:90608542-90608564 GCAGAGCCAACACTTTGTTCTGG - Intronic
1028604035 7:92635364-92635386 ACAGAGCCAGCACTAAGAGCTGG - Intronic
1030200363 7:106896747-106896769 ATTGAGCCTTCACTATGTACCGG + Intronic
1031083415 7:117279621-117279643 CCAGATCCTGGACTATTTTCTGG + Intronic
1035915919 8:3622082-3622104 TCACAGTCTGCACTATGTGCTGG + Intronic
1036799898 8:11782879-11782901 ACAGAGTGTGCTCTATGTTGTGG + Intronic
1036799917 8:11783076-11783098 ACAGAGTGTGCTCTATGTTGTGG + Intronic
1036971767 8:13363073-13363095 ACAGAGCCTACACTTTGTGGGGG + Intronic
1040736611 8:50515923-50515945 GCAGAGCTTGCACTCTGTGCTGG - Intronic
1041555214 8:59146447-59146469 ACAGAGCTTGCATTATAGTCAGG + Intergenic
1045394652 8:101748802-101748824 ACAGAGACTGCATAATGTACTGG - Intronic
1045799305 8:106083323-106083345 ACAGAGCCTGCTCTGGGCTCAGG - Intergenic
1046058521 8:109108072-109108094 AGACAGCCTGTACTATGCTCAGG - Intronic
1047644753 8:126858309-126858331 ATTGAGCATGCACTATGTGCTGG - Intergenic
1049838776 8:144756491-144756513 ACAGGGCCTACACTATATTCTGG - Intergenic
1055638300 9:78298376-78298398 ACAGAGCCTCCTCTGTGTTGTGG + Intronic
1056747659 9:89318436-89318458 ACAGAGCCCGCCCTTTCTTCCGG - Intergenic
1056827426 9:89886102-89886124 ATTGAGCATTCACTATGTTCTGG - Intergenic
1057414535 9:94849350-94849372 ATTGAGCCTTCACTATGTGCTGG - Intronic
1057599877 9:96449019-96449041 CCAGAGCCTGTATTTTGTTCAGG - Intergenic
1058142308 9:101370120-101370142 ACAGAGCCTGTACAAGGATCTGG + Intronic
1058904699 9:109473241-109473263 ACAGACCCTGTAATTTGTTCGGG + Intronic
1059774874 9:117464879-117464901 ACTGACCCTTCACTATGTCCTGG + Intergenic
1061376241 9:130226442-130226464 ACAGCGCCTGCACAATGGACGGG - Exonic
1185961515 X:4550086-4550108 GCAGAGCCTGCTCTTTGTCCTGG - Intergenic
1186311973 X:8330096-8330118 TCATAGCATGCACTGTGTTCTGG + Intergenic
1188991539 X:36826799-36826821 ACAGGCCCTGCACTATGATCTGG + Intergenic
1189420206 X:40850627-40850649 CCACAGCCAGCACTATGTGCGGG + Intergenic
1189862444 X:45287692-45287714 ACAGTGCCTGCCATATGTTAGGG - Intergenic
1191184782 X:57598178-57598200 ACAGACCCTTCAATATGTTATGG - Intergenic
1197067422 X:122250398-122250420 ACATAGACTGCCCTATGTTGAGG + Intergenic
1197535373 X:127681158-127681180 ACAGATCCTTCATTATTTTCAGG + Intergenic
1198110709 X:133500447-133500469 ACAGAGCCTTCACTAGGTCATGG - Intergenic