ID: 1159954648

View in Genome Browser
Species Human (GRCh38)
Location 18:74510635-74510657
Sequence GGCCTGGAGCCACAGCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 379}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159954641_1159954648 6 Left 1159954641 18:74510606-74510628 CCACCTTGCGAGACTGGACCAGT 0: 1
1: 0
2: 1
3: 15
4: 178
Right 1159954648 18:74510635-74510657 GGCCTGGAGCCACAGCGGCCTGG 0: 1
1: 0
2: 3
3: 42
4: 379
1159954640_1159954648 7 Left 1159954640 18:74510605-74510627 CCCACCTTGCGAGACTGGACCAG 0: 1
1: 0
2: 1
3: 8
4: 165
Right 1159954648 18:74510635-74510657 GGCCTGGAGCCACAGCGGCCTGG 0: 1
1: 0
2: 3
3: 42
4: 379
1159954639_1159954648 8 Left 1159954639 18:74510604-74510626 CCCCACCTTGCGAGACTGGACCA 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1159954648 18:74510635-74510657 GGCCTGGAGCCACAGCGGCCTGG 0: 1
1: 0
2: 3
3: 42
4: 379
1159954642_1159954648 3 Left 1159954642 18:74510609-74510631 CCTTGCGAGACTGGACCAGTCCA 0: 1
1: 0
2: 1
3: 2
4: 59
Right 1159954648 18:74510635-74510657 GGCCTGGAGCCACAGCGGCCTGG 0: 1
1: 0
2: 3
3: 42
4: 379
1159954637_1159954648 16 Left 1159954637 18:74510596-74510618 CCAGAGAGCCCCACCTTGCGAGA 0: 1
1: 0
2: 1
3: 4
4: 88
Right 1159954648 18:74510635-74510657 GGCCTGGAGCCACAGCGGCCTGG 0: 1
1: 0
2: 3
3: 42
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159954648 Original CRISPR GGCCTGGAGCCACAGCGGCC TGG Intronic
900313264 1:2044872-2044894 GCCCCGGAGCCAGAGCGGGCAGG + Intergenic
900547776 1:3238042-3238064 GCCCTGGAAGCAGAGCGGCCTGG + Intronic
900581824 1:3413264-3413286 CCCCTGGAGCCACAGCGGCAGGG + Intronic
900589730 1:3454354-3454376 GGCGTGGGGCCAGAGCGGCTCGG - Intergenic
900618052 1:3574136-3574158 TGCCTGGAGCCTCAGCACCCAGG - Intronic
900644448 1:3702649-3702671 GGCCTGGTGCGTCCGCGGCCTGG + Intronic
900671323 1:3856859-3856881 GGGCCGGCGCCGCAGCGGCCCGG + Intronic
901007725 1:6179904-6179926 CGCCTGGGGCCAGAGCGGCGGGG - Intronic
901088748 1:6627829-6627851 TGCCTGGTCCCACAGCAGCCAGG + Intronic
901129494 1:6953449-6953471 GGCCTGAAGCCACAGCCTCCGGG - Intronic
901326839 1:8371740-8371762 GGGCTGGAGCAACAGGGGCCGGG + Intronic
901332876 1:8424060-8424082 GGGCTGGAGACCCAGCAGCCTGG - Intronic
902199865 1:14825288-14825310 GGCCTGGAGAGACAGCTTCCAGG - Intronic
902404577 1:16175667-16175689 GGCCTGGGGCAGCAGGGGCCGGG + Intergenic
903295480 1:22340716-22340738 GCTCTGGAGCCACAGCGCCTGGG - Intergenic
903464888 1:23545216-23545238 CTCCTGGAGCCACAGCTGCAAGG + Intergenic
904001586 1:27341948-27341970 GGCCTGGACTCCCAGCGCCCGGG - Intergenic
904264979 1:29312968-29312990 TGCCTGGCGCCTCAGCGGCCCGG - Intronic
904600705 1:31671217-31671239 GGACTGGAGTCACAGGGGCATGG + Intronic
905267064 1:36761515-36761537 GCCCTGGTGCCAAAGCTGCCAGG - Intergenic
905670655 1:39788450-39788472 GCCCAGGAGCCAGAGCGGGCCGG + Exonic
906145576 1:43558343-43558365 GCCCTGGAGCCACAGCAGTTGGG - Intronic
906491656 1:46273444-46273466 GCCCTGGAGCCCCAGCTGTCAGG + Exonic
906746023 1:48222762-48222784 GGCCTGGAGCTTCAGGGGACGGG + Exonic
908076844 1:60529125-60529147 GGCCTGTAGTCCCAGCTGCCAGG + Intergenic
908331337 1:63074017-63074039 GACCCGGAGCGCCAGCGGCCCGG - Intergenic
908531706 1:65040344-65040366 GGCCTCGAGCCACAGAAGGCAGG - Intergenic
908851008 1:68375754-68375776 GCCCTGCAGCCACTGCAGCCTGG + Intergenic
911434887 1:97844756-97844778 GGTCTGGAGCCACAGCTGGGTGG - Intronic
912417094 1:109516769-109516791 GGCCTGGAGCCCCAGAAGGCAGG - Intergenic
913444112 1:118931734-118931756 GGCCTGCAGCACCAGAGGCCAGG + Exonic
914386262 1:147172603-147172625 GGCCTGCAGCCTCGGCGCCCGGG + Intergenic
915328992 1:155097637-155097659 TGCCTGGAATCACAGCTGCCTGG + Intergenic
915543196 1:156581775-156581797 GGCCTGGTACCACAGGGCCCTGG + Exonic
916517968 1:165537775-165537797 GGACTGGAAACACAGAGGCCAGG + Intergenic
919055997 1:192570190-192570212 AGTCTGGAGCCAGAGCTGCCAGG + Intergenic
920891036 1:209985888-209985910 AGGCTGGAGCCAGAGTGGCCGGG + Intronic
922677112 1:227559881-227559903 GGCCTGGAGCTTCAGCGGAAGGG + Intergenic
922915375 1:229253021-229253043 GGCCTGCAGGGACAGCAGCCGGG - Intergenic
924956220 1:248929994-248930016 GGCCTGCAGCCACATCTCCCAGG - Intergenic
1065999286 10:31089145-31089167 TGCCTGGAGCAACTGCTGCCTGG - Intergenic
1066369384 10:34807136-34807158 GACCTGGAGGCTCAGCAGCCAGG + Intronic
1066658046 10:37712989-37713011 GGCCTGGACCCACCCCTGCCAGG + Intergenic
1067850205 10:49749814-49749836 CCCCTGGAGCCAGAGGGGCCGGG + Exonic
1068788471 10:61001775-61001797 GCACTGGGGCCACAGGGGCCAGG - Intergenic
1070381876 10:75888183-75888205 GCCCTGTAGCCACAGAGGCCTGG + Intronic
1070752783 10:78973875-78973897 GGCCTGGAAACACCGCGCCCCGG - Intergenic
1071491356 10:86138784-86138806 GGCCTGAGGCCTCAGGGGCCTGG - Intronic
1071524163 10:86348534-86348556 GGCCAGCAGCCACAGGGGCCTGG + Intronic
1071736116 10:88303064-88303086 CCCCTGGAGCCACTGTGGCCAGG - Intronic
1073121509 10:101125003-101125025 GGCCTGGTCCCACAGCAGGCTGG + Intronic
1073412107 10:103350885-103350907 GGCCGGGAGCCGGAGCAGCCGGG + Exonic
1075062649 10:119267557-119267579 GGGCTGGAGGCTCAGCGGACGGG + Intronic
1075545628 10:123352299-123352321 GGCGTGGGGCCACACTGGCCAGG + Intergenic
1075712602 10:124538552-124538574 GGTATGGGGCCACAGCGGGCAGG - Intronic
1075917931 10:126185739-126185761 TGGCTGGAGCTACACCGGCCTGG + Intronic
1076356759 10:129858757-129858779 GCCCTGGAGCCTCTGAGGCCTGG - Intronic
1076833305 10:133007616-133007638 GGCCTGGACCCAGATCGGCCGGG + Intergenic
1076872041 10:133199029-133199051 GGCCAGGAGCCAGAGGGCCCCGG + Exonic
1077158344 11:1101497-1101519 TGCCTGGGGCCTCAGCTGCCCGG - Intergenic
1077162253 11:1119181-1119203 GGTCAGGAGCCACAGTGACCTGG - Intergenic
1077561354 11:3263664-3263686 GTCCTGGAGCCACTGGGTCCTGG + Intergenic
1077567250 11:3309493-3309515 GTCCTGGAGCCACTGGGTCCTGG + Intergenic
1078720709 11:13880962-13880984 GGCCTGGAGCCACAGAACCTGGG + Intergenic
1078771919 11:14359089-14359111 GGCCAGGGGCGGCAGCGGCCGGG + Exonic
1078987059 11:16607065-16607087 GGCCGGGAGCCGCGGCTGCCGGG - Intronic
1081676059 11:44970243-44970265 GCTTTGGAGCCACAGGGGCCTGG - Intergenic
1082687809 11:56260857-56260879 GGTCTGGAGCCACAGCTGGGTGG + Intergenic
1083213570 11:61204354-61204376 TGCCTGGAGCCACAGAGCCCAGG - Intronic
1083216453 11:61223190-61223212 TGCCTGGAGCCACAGAGCCCAGG - Intronic
1083219335 11:61242016-61242038 TGCCTGGAGCCACAGAGCCCAGG - Intronic
1083442887 11:62688473-62688495 GGCCAGGAGCCACAGAAGGCAGG + Exonic
1083677157 11:64332523-64332545 CGCCTGGCACCCCAGCGGCCTGG - Intergenic
1083744684 11:64728868-64728890 GGCCTGGAGCCTCGCCTGCCAGG + Exonic
1084300993 11:68252341-68252363 GGCCTGTAGCCCCAGCTGCTAGG - Intergenic
1084694980 11:70747435-70747457 GGCCAGGAGCCATGGGGGCCGGG + Intronic
1085444002 11:76588844-76588866 GGCCTGGAGACCCACCCGCCTGG + Intergenic
1085882052 11:80479150-80479172 AGCATGGAGCCACACCGACCTGG + Intergenic
1086850028 11:91798492-91798514 GGTCTGGAGCCACAGCTGGGTGG - Intergenic
1087672991 11:101128474-101128496 GGCCGGGAGCAGCAGCTGCCGGG + Exonic
1089335235 11:117718308-117718330 TGCCTGGAGTCACTGAGGCCAGG - Intronic
1089360781 11:117885076-117885098 GAGCTTGAGCCACAGCAGCCTGG + Intergenic
1089486283 11:118848782-118848804 TGCCTGGAGTCACAGCTGCTTGG - Intergenic
1090185010 11:124732421-124732443 GGCCTTGGGCCAGAGAGGCCAGG - Intergenic
1090360355 11:126168020-126168042 GGTGTGGAGCCACAGGGACCTGG - Intergenic
1090457211 11:126860558-126860580 GGCGTGGAGGCAGAGGGGCCAGG + Intronic
1091227237 11:133964936-133964958 GCCCTGGAGCCACAGCTGGAGGG + Intergenic
1091454046 12:591993-592015 GGCCTGGAGCCCCAGCCGCCAGG + Intronic
1091882460 12:3990730-3990752 AGCCTGGCCCCACAGCAGCCTGG - Intergenic
1096182321 12:49557661-49557683 GGCCTCGAGCCACAGCTTTCTGG + Exonic
1097070010 12:56347867-56347889 GGCTTGGAGTCACATAGGCCTGG + Intronic
1098232958 12:68391377-68391399 GGCCTGCAGCCTCAGAGACCGGG + Intergenic
1099984645 12:89648860-89648882 AGGCTGGAGCCAGAGCAGCCAGG - Intronic
1101244972 12:102876695-102876717 GGCCCTGAGCCACCGCAGCCTGG + Intronic
1101998000 12:109538867-109538889 GCCCTGAGGCCACAGGGGCCTGG - Intergenic
1103341859 12:120225053-120225075 GGCCTGGAGCCTCTGGGGCCGGG - Intronic
1104658508 12:130591970-130591992 GGCCTGGAGTCAGAGAGGCGTGG + Intronic
1104711940 12:130993555-130993577 GTCCTGGAGTCACAGAGACCTGG + Intronic
1104751947 12:131245487-131245509 GGACTGGAGGCACAGAGGGCAGG - Intergenic
1105007682 12:132731741-132731763 GGCCTGCAATCCCAGCGGCCGGG - Intronic
1108870363 13:54976931-54976953 GGCTTGGATGCACAGTGGCCTGG + Intergenic
1113416546 13:110132778-110132800 TGCCTGGAGCCAGGGAGGCCAGG + Intergenic
1113524538 13:110964465-110964487 GACCTGTAGCCTCAGCTGCCTGG + Intergenic
1113693226 13:112326629-112326651 GGCCTGGAGTCAGCGGGGCCTGG + Intergenic
1113901636 13:113801270-113801292 TGCCTGGGGCCTCAGAGGCCAGG - Intronic
1113950633 13:114069511-114069533 GGCCAGGAGACACAGGGGCCAGG + Intronic
1113950773 13:114069867-114069889 GGCCAGGAGACTCAGGGGCCGGG + Intronic
1114287913 14:21262656-21262678 AGCCTGGAGCAGCAGCAGCCAGG - Intronic
1114630275 14:24155106-24155128 GGTCAGAAGCCACAGCTGCCAGG - Intronic
1117147174 14:52846994-52847016 GGCCATGGGCCACAGCGACCCGG - Intergenic
1120167851 14:81220239-81220261 GGCCTGGGGCCGCCGCGGGCCGG - Intronic
1121180674 14:91926259-91926281 AGCATGGAGGCACAGAGGCCAGG - Intronic
1121326784 14:93024815-93024837 GTCCCGGAGCCACAGGGACCTGG - Intronic
1122694176 14:103544862-103544884 GGCCTGGGGCCCCTGGGGCCTGG - Intergenic
1122897927 14:104769526-104769548 GGCCTGGGGCGACAGCGGAAAGG + Exonic
1122967257 14:105137188-105137210 TGCCTGGACCCACAGCGTGCAGG - Intergenic
1123037824 14:105478586-105478608 GGCGGGGATCCACGGCGGCCGGG - Intronic
1123083877 14:105708527-105708549 GACCTGGAGCGAAAGCGGACAGG - Intergenic
1123085008 14:105713279-105713301 GGGTTGGAGCCACTCCGGCCTGG + Intergenic
1124341110 15:28889542-28889564 TGCCTGGAGCCAGGGCAGCCTGG - Intronic
1124370804 15:29103728-29103750 GCCCTGGAGCCCCGGAGGCCCGG - Intronic
1124705420 15:31960050-31960072 GTGCTGGAGCCAAAGCAGCCAGG - Intergenic
1126109522 15:45167366-45167388 GGCCCGGAGCCGGGGCGGCCTGG + Exonic
1127436694 15:58964934-58964956 GGCCTGTAGCCCCAGCTACCTGG + Intronic
1129035601 15:72646818-72646840 TGCGTGGAGCCACAGGTGCCTGG - Intergenic
1129214283 15:74090398-74090420 TGCGTGGAGCCACAGGTGCCTGG + Intergenic
1129391132 15:75221539-75221561 TGCCTGGAGCCACAGGTTCCTGG - Intergenic
1129399726 15:75274971-75274993 TGCCTGGAGCCACAGGTGCCTGG - Intronic
1129465484 15:75722180-75722202 GGCCTCGAGCCACGGCTGCTAGG + Intergenic
1129473178 15:75766340-75766362 TGCCTGGAGCCACAGGTGCCTGG + Intergenic
1129731423 15:77934746-77934768 TGCCTGGAGCCACAGGTGCCTGG + Intergenic
1129738798 15:77979938-77979960 GGGCTGGGGCCACAGAGGGCTGG + Intergenic
1129777294 15:78245096-78245118 AGCTTGGAGCCACAGGAGCCTGG + Intronic
1129845503 15:78766107-78766129 GGACAGGAGGCACAGTGGCCTGG - Exonic
1129847161 15:78773243-78773265 GGGCTGGGGCCACAGAGGGCTGG - Intronic
1130223735 15:82043419-82043441 GGGCTGGGGGCACAGCTGCCTGG - Exonic
1130254739 15:82320646-82320668 GGGCTGGGGCCACAGAGGGCTGG + Intergenic
1130600234 15:85269360-85269382 GGGCTGGGGCCACAGAGGGCTGG - Intergenic
1131220110 15:90576678-90576700 GGCATGGAGCCCCAGGAGCCAGG + Intronic
1131515491 15:93073728-93073750 GGCCTGGGGCCACGACGGGCGGG - Exonic
1132409549 15:101566447-101566469 GTCCTGAAGACACAGAGGCCTGG + Intergenic
1132869647 16:2110144-2110166 TGCCTGGAGGGACAGGGGCCCGG - Exonic
1132883160 16:2171175-2171197 GGCCTGGAGCAAGAGCGCCTGGG + Intronic
1133026213 16:2989985-2990007 GGCGTGAAGCCACAGAAGCCAGG + Intergenic
1133157130 16:3883093-3883115 GGCCTGGAGCCACCTCAGGCTGG - Intergenic
1133837742 16:9381708-9381730 GGCTTGGAGTCACAGAGGCCTGG - Intergenic
1134717770 16:16365455-16365477 TGCCTGGAGGGACAGGGGCCCGG + Intergenic
1134956981 16:18386704-18386726 TGCCTGGAGGGACAGGGGCCCGG - Intergenic
1136483139 16:30555295-30555317 GGCCGGGGGCCACAGGGGCCGGG - Exonic
1136517175 16:30775182-30775204 GGCCTGCAGCCAGAGTAGCCAGG + Exonic
1138654718 16:58484518-58484540 GGCCTGGAGCCACTGCAACCAGG - Intronic
1139851448 16:69953187-69953209 GCCCTGGAGCCCTAGAGGCCCGG - Intronic
1139880425 16:70176099-70176121 GCCCTGGAGCCCTAGAGGCCCGG - Intronic
1140372085 16:74419418-74419440 GCCCTGGAGCCCTAGAGGCCCGG + Intronic
1140440642 16:74985026-74985048 GTCCTGGGGCCGCGGCGGCCGGG - Exonic
1140517686 16:75556038-75556060 AGCCTCGTGGCACAGCGGCCGGG + Intronic
1141461316 16:84180155-84180177 GGCCTGGACCCTCACCTGCCAGG + Exonic
1141557093 16:84843360-84843382 GGCTTGAAGCCACAGCAGGCAGG - Intronic
1141664426 16:85458541-85458563 GGCATGGAGGCCCAGGGGCCAGG + Intergenic
1141994116 16:87626124-87626146 TGCCAAGAGCAACAGCGGCCGGG + Intronic
1142609013 17:1097726-1097748 AGCCTGGAGCCAGTACGGCCAGG + Intronic
1142619970 17:1159020-1159042 GCCTTGGACCCACAGCAGCCTGG + Intronic
1142676628 17:1517249-1517271 GGCATTGAGCCACCGCGCCCCGG - Intergenic
1142849407 17:2697012-2697034 GGTGTGGAGCCCCAGCTGCCGGG - Intronic
1143268080 17:5655478-5655500 GCCCTGGAGGCAGAGAGGCCTGG + Intergenic
1143579760 17:7818643-7818665 GGCCTGGAGGCCCAGCTGCTGGG + Exonic
1144622481 17:16826562-16826584 GGCCTGTAGCCCCAGCTGCTAGG - Intergenic
1144875504 17:18395023-18395045 GGCCTGGAGCCACCCAAGCCTGG - Intergenic
1145156722 17:20549398-20549420 GGCCTGGAGCCACCCAAGCCTGG + Intergenic
1145874541 17:28307082-28307104 GGCCAGGAGATCCAGCGGCCGGG - Intergenic
1146957275 17:36942886-36942908 GGCCTGGAGCACCCGCTGCCGGG + Exonic
1147311299 17:39597428-39597450 GGGCGGGACCCACAGCGGGCAGG + Intergenic
1147894234 17:43740094-43740116 GGACAGGAGCCACAGCAGGCTGG - Intergenic
1148225299 17:45894839-45894861 GGGCTGGGGCCAGGGCGGCCTGG + Intronic
1148789200 17:50163999-50164021 GGCCTGGTGACACTGGGGCCAGG + Intergenic
1148865680 17:50626933-50626955 TGCCTGGAGCCAGAGTTGCCGGG - Exonic
1149057897 17:52387520-52387542 AGGCTGGAGCCAGAGCAGCCAGG - Intergenic
1149994420 17:61399398-61399420 GGGCTCGGGCCAGAGCGGCCGGG + Intergenic
1151210184 17:72538659-72538681 GCTCTGCAGCCACAGCTGCCAGG - Intergenic
1152285191 17:79408455-79408477 GGCCGTGAGCCACAGAGCCCTGG - Intronic
1152755418 17:82085109-82085131 GGCCTTCAGCCACACAGGCCGGG + Exonic
1153565519 18:6414439-6414461 GCCCTGGAGCCAGCGCAGCCTGG - Intronic
1156410660 18:36825304-36825326 CGCCTGGAGTCCCAGCTGCCCGG + Intronic
1156501345 18:37561155-37561177 GCCCAGGAGCCACAGCTGCAGGG - Intronic
1157563287 18:48663507-48663529 GGCCTGGGGCAGCAGGGGCCTGG + Intronic
1158393042 18:57059083-57059105 GATTTGGAGCCACAGCAGCCGGG + Intergenic
1158976690 18:62716435-62716457 GGCCCGGAGCCGCCGCCGCCCGG + Exonic
1159954648 18:74510635-74510657 GGCCTGGAGCCACAGCGGCCTGG + Intronic
1160226151 18:77012674-77012696 GGCCTGGTGACACAGCTGGCAGG - Intronic
1160515325 18:79476309-79476331 AGCCTGGCTCCACAGCTGCCTGG + Intronic
1160777625 19:863211-863233 GGCCTGGATCGACAGCGTCCTGG + Exonic
1160988092 19:1848714-1848736 GCCCTGGCGCCGCAGGGGCCTGG - Intergenic
1161064479 19:2230971-2230993 GGCCTAGGGCCAGAGAGGCCAGG - Exonic
1161280877 19:3445259-3445281 GGCCTGGAGCCGGGGAGGCCAGG - Intronic
1161311324 19:3595718-3595740 GGGCTGGAGGGACAGCGACCTGG + Exonic
1161389414 19:4013462-4013484 GGCGGGGAGCCACAGTGGCCAGG + Intronic
1161495050 19:4581846-4581868 GGCCCGGAGCAACCGCGGCGCGG + Intergenic
1161604398 19:5206680-5206702 GGCCTGGACCCCCAGTGGGCAGG - Exonic
1161607528 19:5223052-5223074 GGCCCGGAGCCGCGGCGGCCTGG - Exonic
1161800661 19:6415436-6415458 GGCCAGCAGCCCCAGCAGCCCGG - Exonic
1162479652 19:10921003-10921025 GGGCTGGAGGCAGAGGGGCCAGG - Intronic
1163125963 19:15244371-15244393 GTCCTGGAGCCCCAGCTCCCAGG - Exonic
1163617920 19:18340732-18340754 GGGCTGTAGCGGCAGCGGCCGGG + Intronic
1164109133 19:22138090-22138112 GGCCGGGAGCCGGAGCAGCCGGG - Intergenic
1164137399 19:22427467-22427489 AGCCTGGAGCCCCAGAGGTCCGG + Intronic
1164394535 19:27851458-27851480 GGCCTGGAGCCATACCAGCATGG - Intergenic
1166026892 19:40095110-40095132 AGACTGGAGCCACAGGGGCTGGG - Intergenic
1166747532 19:45148493-45148515 GGGCTGGATCCACAGTGGCCAGG - Intronic
1167350433 19:48970765-48970787 GTCCTGGTGCCACAGAGTCCTGG - Intronic
1167539108 19:50074172-50074194 TGCCTGGAGTCCCAGCAGCCAGG - Intergenic
1168332731 19:55579400-55579422 GGCCTTGGGGCACAGCGGGCAGG + Exonic
1168682907 19:58328905-58328927 GTCCTGGAGCCACAGCACACAGG - Intronic
925607452 2:5673433-5673455 GGCCAGGAGCCACCTCCGCCAGG + Intergenic
925836017 2:7947708-7947730 GCCCTGGAGTCACACAGGCCAGG + Intergenic
925924322 2:8659492-8659514 GGCCTGGAGCCACACATGACTGG - Intergenic
926087314 2:10028579-10028601 GGCCTGGAGCATGAGGGGCCTGG - Intergenic
926099230 2:10103436-10103458 GGCCCGGAGACACAGAGGCTGGG - Intergenic
926252299 2:11161989-11162011 GGCCTGGAGCCAGACAGGACAGG + Intronic
927754397 2:25697322-25697344 GGCCTGGAGCCCAAGCTGGCAGG + Intergenic
928195769 2:29215580-29215602 AGCGTGGAGCCAAAGCTGCCCGG + Intronic
932588009 2:73044373-73044395 GGCCTGGAGCCTCAGCCCCTCGG - Intronic
934261340 2:91478612-91478634 GGCAAAAAGCCACAGCGGCCGGG - Intergenic
934646602 2:96062735-96062757 GGCCCAGATCCACAGTGGCCTGG - Intergenic
934769279 2:96897670-96897692 GGCCTGGAGAAACAGCAGCGTGG - Intronic
934840003 2:97618817-97618839 GGCCCAGATCCACAGTGGCCTGG - Intergenic
934933284 2:98445373-98445395 GCCCTGGAGCCGCATCGGGCAGG - Intronic
935305649 2:101733762-101733784 GCCCTGGAGCCAGAGAGCCCTGG - Intronic
936005654 2:108884793-108884815 AGCCTGGACTCACAGCTGCCCGG - Intronic
936061623 2:109298676-109298698 GACCTGGACCCACAGGAGCCAGG - Intronic
936935638 2:117836333-117836355 GGTCCGGAGCCTCAGCAGCCTGG - Intergenic
937104198 2:119294856-119294878 GGCCTGGGGCCAGAGGGGTCCGG + Intergenic
937342607 2:121100879-121100901 GGGCTGGGGCCACAGCAGGCAGG + Intergenic
937915646 2:127097539-127097561 GGGCTGGGGACACAGGGGCCAGG - Intronic
940517469 2:154698842-154698864 GGCTTGCAGCCCCAGGGGCCAGG + Exonic
942650536 2:178162561-178162583 TGCCTGTAGCCACAGCTACCTGG + Intergenic
945977973 2:216285383-216285405 GGCCTGGAGCCACAGCAAAGAGG - Intronic
946196152 2:218033978-218034000 GGCCTGGCGCCCCGGCGGGCAGG + Intergenic
947197472 2:227583316-227583338 AGGCTGGAGCCAGAGCTGCCAGG - Intergenic
947593820 2:231398984-231399006 GGGCTGGAGCCACAGTGCCCAGG + Exonic
948560134 2:238846961-238846983 GGCCCAGAGCCAGAGCGGCCTGG + Intergenic
948600160 2:239103332-239103354 CGCCCGGGGCCACAGCTGCCAGG + Intronic
948736869 2:240014537-240014559 GGCCTGGTGCCACAGCCTGCGGG - Intronic
948855563 2:240728763-240728785 GGGCTGGAGCCACTGCAGCCTGG + Intronic
948864687 2:240769293-240769315 GGCCTGTGGCCACCGTGGCCTGG + Intronic
949017224 2:241720308-241720330 TGCCTTGAGGCAGAGCGGCCTGG - Intronic
1168904604 20:1393039-1393061 GGCGTGGACCAACAGCGACCTGG + Exonic
1169738930 20:8868755-8868777 TGCCTGTAGCCCCAGCTGCCTGG - Intronic
1171237233 20:23536825-23536847 GGCCTGAAGCAGCAGCAGCCTGG - Intergenic
1171391360 20:24803528-24803550 GGTCTGGAGGCATAGCTGCCTGG + Intergenic
1172164623 20:32891637-32891659 GGGCTGGGGCCACAAAGGCCGGG - Intronic
1172890610 20:38261020-38261042 GGCCTCGAGCCGCAGCAGCCGGG + Intronic
1174045461 20:47729746-47729768 GGCCAGGAGGCAGAGGGGCCAGG + Intronic
1174209505 20:48866350-48866372 GGCCTTGAGCCACAGGACCCAGG - Intergenic
1175129487 20:56778829-56778851 AGCCCGGAGCCACAGTGGGCTGG - Intergenic
1175142647 20:56872386-56872408 GGCCTGGTGTCTCAGCGGCCAGG - Intergenic
1175304065 20:57964043-57964065 GGCCCACAGCCACAGCGGCCCGG + Intergenic
1175310989 20:58011488-58011510 GGCCTGCTCCCACAGCGTCCTGG + Intergenic
1175801154 20:61801687-61801709 GGCCAGGAGCCACAGAGGTGGGG - Intronic
1176952604 21:15064746-15064768 GGCTGGGAGCCGCGGCGGCCTGG - Exonic
1177793520 21:25747147-25747169 GTTCTGGAGCCACAGAGGTCTGG - Intronic
1179582504 21:42352334-42352356 GGTCTGGAGGAACAGGGGCCTGG - Intergenic
1180037407 21:45256841-45256863 GACCTGGAGCCACAAGGACCTGG - Intergenic
1180041894 21:45284330-45284352 GGCCTGAGGCCACAGCTGCGGGG + Intronic
1180064479 21:45405565-45405587 GGGCTGAACCCAGAGCGGCCGGG - Intronic
1180231606 21:46429778-46429800 GGCCGGGAGACACAGAGTCCAGG - Intronic
1181261181 22:21598963-21598985 TGCCTGTAGCCCCAGCTGCCAGG - Intronic
1181591640 22:23889194-23889216 GGTCTGCAGCCAGGGCGGCCAGG - Intronic
1181696406 22:24594919-24594941 GGGCTGGAGCCACAGCTGGGAGG + Intronic
1181952123 22:26562107-26562129 GACCAGGAGGCCCAGCGGCCCGG + Intronic
1182296075 22:29311750-29311772 GGCCCGGAGCCAGAGCCGCGAGG + Intronic
1182414241 22:30210663-30210685 TGGCTGGGGCCACAGGGGCCAGG + Intergenic
1182856254 22:33520128-33520150 GGCCTGTAGCCCCAGCTGCTTGG - Intronic
1183403189 22:37616833-37616855 GGGCTGCAGTCCCAGCGGCCTGG + Intronic
1183490973 22:38115484-38115506 GGCCTGGACCCACTGCTCCCTGG - Intronic
1184142340 22:42585216-42585238 GGCCTGGAGCCACTGGGGAGAGG + Exonic
1184234714 22:43176870-43176892 GGCCTGGAGCCCCAGAATCCTGG - Intronic
1184531899 22:45061568-45061590 GGGCTGGAACCACACCTGCCTGG - Intergenic
1184716908 22:46287687-46287709 ACCCTGGAACCACAGAGGCCTGG + Intronic
953194617 3:40720817-40720839 GGCCTGGAACCAGACCTGCCTGG + Intergenic
953668488 3:44943246-44943268 GACCTGGAGCCAGAACTGCCGGG + Intronic
953705120 3:45225452-45225474 GCCCTGCAGCCACAGCGGCCCGG + Exonic
953878167 3:46678229-46678251 GGCCCAGAGCCAGAGGGGCCAGG + Intronic
955205954 3:56895977-56895999 GGCCTGCAGGCACAGGGGGCTGG + Intronic
959896979 3:111616857-111616879 GGTCTGGAGCCACAGCTGGGTGG - Intronic
961028824 3:123584830-123584852 GGCGGGGAGCCAGCGCGGCCGGG - Intronic
961378204 3:126481091-126481113 GGCCTGGAAACACAGCAACCAGG - Intergenic
961545314 3:127629183-127629205 CGCCTGCAGCCGCAGCGGCGCGG - Exonic
961780244 3:129316675-129316697 GGCCTGGAGCCCCCCGGGCCGGG - Intergenic
961943092 3:130657103-130657125 GGTCTGGAGCCACAGCTGGATGG + Intronic
961946153 3:130691027-130691049 CGCCTGTAGTCACAGCTGCCAGG - Intronic
962254273 3:133859834-133859856 GGCCTGCAGACACAATGGCCAGG + Intronic
963083544 3:141416383-141416405 GCCCTGGACTCACAGTGGCCTGG + Intronic
963778527 3:149464155-149464177 GGCGTGGACTCACAGCGACCTGG + Intergenic
965061434 3:163789056-163789078 GGTCTGGAGCCACAGCTGGGAGG + Intergenic
965990393 3:174810942-174810964 GGGCTGGAGCTACAGCAGCCAGG - Intronic
967919243 3:194602252-194602274 CCCCAGGAGCCACAGCGGCCTGG - Intronic
968485503 4:859110-859132 GACTTGAAGCCACAGCGCCCGGG + Intronic
968530486 4:1088756-1088778 TGGCTGGAGCCAGAGCAGCCAGG - Intronic
968565715 4:1311586-1311608 CGCCTGCAGCCGCAGCAGCCTGG + Intronic
968600258 4:1505305-1505327 GGACTGGAGCCACAGCCTCTCGG + Intergenic
968619692 4:1598277-1598299 GGCCTGCAGCCGCAGCTGCATGG + Intergenic
968645352 4:1737870-1737892 AGCCTGGACCCTCAGCGACCTGG - Intronic
968887095 4:3340945-3340967 GGCCTAGAAGCACAGCGGCCAGG - Intronic
968902472 4:3438153-3438175 GGCCTGGGCCCACAGCAGACAGG - Intronic
968907753 4:3462539-3462561 GGACTGGAGCCACAGGGTCAAGG + Intergenic
968959132 4:3734148-3734170 GGCCCAGAGTCCCAGCGGCCTGG + Intergenic
969418134 4:7074393-7074415 GGCCATGAGCCACAGCAGACAGG - Intergenic
969485103 4:7467779-7467801 CTCCGGGAGCCACAGCAGCCAGG - Intronic
969826298 4:9761235-9761257 GGCCTGGAGAAACACCGACCTGG + Intergenic
970411922 4:15817237-15817259 GACCTGGAGCCACAGAGGCCTGG + Intronic
970534546 4:17016740-17016762 GCCCTTGAGCCACATGGGCCTGG + Intergenic
973140764 4:46765679-46765701 TGCCTGGGGCCACATCGGCTGGG - Intronic
974013369 4:56627112-56627134 GGGCTGGAGCCCCAGGGCCCAGG + Intergenic
977594406 4:98863007-98863029 GGCCTGTAGCCCCAGCTACCTGG + Intergenic
979284441 4:118905813-118905835 GTCCTGGAGCCACGGTGGCAAGG + Intronic
980053649 4:128061023-128061045 AGCCGCGAGCCACAGAGGCCTGG + Intergenic
982244705 4:153340075-153340097 CGCCTGGAGTCACAGCTGCTTGG + Intergenic
982417777 4:155157234-155157256 AGGCTGGAGCCACAGCTGCTGGG - Intergenic
985538991 5:479163-479185 GGCCTGGGGGCACAGCTGCAGGG - Intronic
985688217 5:1293441-1293463 TGCCTGGAGCCCCAGAGGCCTGG + Exonic
985688437 5:1294261-1294283 GGCCTGGAACCATAGCGTCAGGG - Exonic
985871959 5:2564221-2564243 GGACTGGATCCAGAGGGGCCAGG + Intergenic
986928995 5:12795065-12795087 GGGGTGGCCCCACAGCGGCCTGG - Intergenic
987313652 5:16703979-16704001 GTCTTGAAGCCACAGCGGCCTGG - Intronic
989308148 5:39981183-39981205 AGGCTGGAGCCAGAGCAGCCAGG - Intergenic
989617205 5:43349009-43349031 GGGCTGGGGCCACAGCTTCCTGG - Intergenic
990955375 5:61333547-61333569 GGCCAGACGCCACAGCGACCCGG - Intronic
996721920 5:126638548-126638570 GGGCGTGAGCCACCGCGGCCCGG + Intergenic
997284590 5:132669081-132669103 AGCCAGGAGGCACAGCAGCCAGG + Intergenic
997579741 5:135009811-135009833 GGCCTGGGGCCATGGCTGCCTGG - Intronic
998156373 5:139789053-139789075 GGCAGGGAGCCACGGAGGCCTGG - Intergenic
999372370 5:151063836-151063858 GGCCTGGAGCCTCAGAAGCCAGG - Intronic
1001147876 5:169200510-169200532 GGCCTGGAGCAGCAGCTGGCAGG - Intronic
1001647563 5:173293790-173293812 GGCGTGAAGCCACCGCGTCCAGG + Intergenic
1002409143 5:179060498-179060520 GGCCCGGATCCACCCCGGCCCGG - Exonic
1002414545 5:179112817-179112839 GCCCTGGAGCCAAGGTGGCCAGG + Exonic
1003487048 6:6588827-6588849 GGTCTGTAGCGACAGCGGCTTGG + Exonic
1005811089 6:29517215-29517237 GGCATGGGGCCATAGTGGCCTGG - Intergenic
1006123377 6:31821484-31821506 GGCCTGGAGTCCCAGCTACCCGG + Intergenic
1006189784 6:32200866-32200888 GCCCTGGAGCCCCTGCTGCCTGG - Exonic
1006817083 6:36858907-36858929 GGCCAGACGCCACAGAGGCCAGG + Intronic
1007363162 6:41372950-41372972 GCCCCGGTGCCCCAGCGGCCGGG - Intergenic
1009396972 6:63211494-63211516 GGCGTGGACCGACAGCGACCTGG - Exonic
1013375441 6:109509893-109509915 AGCCTGCATCCACAGGGGCCTGG + Intronic
1017163744 6:151390180-151390202 GGCCTGCAGCCTCAGCGAGCAGG + Intronic
1017945782 6:159095243-159095265 GGACTGGAGCCACAACTCCCAGG - Intergenic
1018638591 6:165886326-165886348 GCCCTGGAGCCCCAGAGTCCTGG + Intronic
1019232986 6:170584438-170584460 GGCCTGGGGCCCCGGCAGCCCGG + Exonic
1019487445 7:1295890-1295912 GGCCTGGGGCCCCAGAGGCTGGG - Intergenic
1019506922 7:1396001-1396023 GGCCTGCACCCCCAGTGGCCAGG + Intergenic
1019513033 7:1427706-1427728 GGCCTGGAGGCCCAGAGGACAGG - Intergenic
1020054084 7:5104978-5105000 GTCCTGGAGCCACAGCTACTTGG - Intergenic
1021231062 7:18086747-18086769 GGCCGGGAGCCCCAGCGCCGCGG - Intergenic
1022544461 7:31173261-31173283 GGCCAGGACCCACAGAGGGCAGG + Intergenic
1022907668 7:34872241-34872263 TGCCTGAAGCCAGAGTGGCCAGG + Intronic
1023735616 7:43233731-43233753 GGCCTGGAGCTACTGAGGACAGG - Intronic
1023936645 7:44745254-44745276 GCCCTGTAGCCACAGCTACCTGG - Intergenic
1025139564 7:56450736-56450758 GGGCATGAGCCACAGCGCCCAGG - Intergenic
1025928307 7:65976267-65976289 GCCCTGCAGCCACCGCTGCCAGG + Intronic
1027001635 7:74658161-74658183 GGCCTGCAGGGACAGGGGCCTGG + Intronic
1027586705 7:80066752-80066774 AGGCTGGAGCCAGAGTGGCCAGG + Intergenic
1029597137 7:101543933-101543955 GGCCTGGAGCCACTGGAGGCTGG + Intronic
1034549568 7:151811682-151811704 GTCCTGAAGCCTCAGCAGCCCGG - Intronic
1035171947 7:157021816-157021838 GGCTTCCAGCCACTGCGGCCGGG - Intergenic
1035221714 7:157410178-157410200 GGCCCGGAGCCACCGTGGCGTGG - Intronic
1035234768 7:157489133-157489155 GGCCTGCAGCAGCAGAGGCCGGG + Intergenic
1035264384 7:157683055-157683077 GCCCTGGAGCCACAACGGGAGGG + Intronic
1035265300 7:157686791-157686813 GGCCTGGTAACACAGCGGCAGGG + Intronic
1035300835 7:157896340-157896362 AGGCTGAAGCCACAGCGACCAGG + Intronic
1035320844 7:158028378-158028400 GGCCAGGAGAAGCAGCGGCCAGG + Intronic
1035381565 7:158444314-158444336 GGCCGTGAGCCCCAGCGCCCAGG + Intronic
1035464188 7:159064260-159064282 GCCCCGGAGCCACTGGGGCCTGG + Intronic
1036767527 8:11558216-11558238 GGGCAGGAGGCACAGTGGCCAGG - Intronic
1037781067 8:21869424-21869446 GGCCTGGAGTCAGAGAGGCTTGG - Intergenic
1037782616 8:21880784-21880806 GGCCTGGAGTCAGAAGGGCCTGG - Intergenic
1037911093 8:22743989-22744011 GGCCTGCAGCCACAACCCCCAGG - Intronic
1041077183 8:54179263-54179285 GGCCTGGAGACACAATGTCCAGG - Intergenic
1042286923 8:67123880-67123902 GGGCATGAGCCACCGCGGCCAGG + Intronic
1043533657 8:81176611-81176633 AGACTGGAGCCAGAGCAGCCAGG + Intergenic
1043553051 8:81396524-81396546 GGCCTGGAGCCACAAGGGGCAGG + Intergenic
1044409251 8:91867006-91867028 GGCCTGGAGCCTCCACTGCCCGG + Intergenic
1044629164 8:94262315-94262337 CGCCTGCAGCCGCCGCGGCCGGG + Exonic
1045437029 8:102173777-102173799 TGGCTGGAGCCAGAGCAGCCAGG + Intergenic
1048440357 8:134455122-134455144 AGCCTGGAGCTAGAGCGGCATGG + Intergenic
1048440366 8:134455170-134455192 AGCCTGGAGCTAGAGCGGCATGG + Intergenic
1048440375 8:134455218-134455240 AGCCTGGAGCTAGAGCGGCATGG + Intergenic
1048440393 8:134455314-134455336 AGCCTGGAGCTAGAGCGGCATGG + Intergenic
1049393692 8:142385928-142385950 GTCCTGTAGCCACAGGGACCTGG - Intronic
1049658775 8:143810453-143810475 GGCATGGAGCCACGGCAACCTGG - Intronic
1049697269 8:143990376-143990398 GGCGGGGAGCCGCGGCGGCCTGG + Intronic
1049812375 8:144581300-144581322 CGGCTGGAGCCACGGCGGCCTGG + Intronic
1050113728 9:2242092-2242114 GGCCTGGAACCCCGGCGGCTCGG - Intergenic
1050525444 9:6542514-6542536 GGCCGTGAGCCACTGCGCCCAGG + Intronic
1051730250 9:20134414-20134436 GACCTGGAGTCACAGAGGCCAGG + Intergenic
1053241519 9:36499599-36499621 TCCCTGCAGCCACAGCTGCCTGG + Intergenic
1053280983 9:36819678-36819700 GGGCTGGAGCCACCTCGTCCTGG - Intergenic
1055800766 9:80033035-80033057 AGGCTGGAGCCAGAGCAGCCCGG + Intergenic
1056773895 9:89497932-89497954 GGCCGGGAGCCGCCGCGGGCAGG - Intronic
1057881529 9:98796303-98796325 GGCCCGGGGCCGCAGCGGCGGGG - Exonic
1060126863 9:121055739-121055761 GGCCTGCAGCCACTACTGCCTGG - Intergenic
1060205632 9:121681190-121681212 GCCCTGGAGTCACAGAGACCTGG - Intronic
1060608646 9:124940891-124940913 GGTCTGTCCCCACAGCGGCCCGG - Intronic
1060661104 9:125405682-125405704 GGCCTGGGGACAAAGGGGCCAGG + Intergenic
1060933375 9:127502841-127502863 GTCCTGGCGGCACAGCGGGCAGG - Exonic
1061789378 9:133050996-133051018 AGGCTGGAGCCACCGGGGCCAGG - Intronic
1061957184 9:133969815-133969837 GGCCTGGAGCCCCAGAGGCTGGG - Intronic
1061968134 9:134027569-134027591 CGCCTGGAGCCACAGCTACCTGG - Intergenic
1062048149 9:134433878-134433900 AGCCTGGACCCAGAGCAGCCTGG + Intronic
1062178717 9:135179204-135179226 GGTCAGGAGGCACAGTGGCCGGG + Intergenic
1186389759 X:9147280-9147302 GGAATGGAGCCACCGAGGCCAGG - Intronic
1188005255 X:25012426-25012448 CGCCTGGTGCCCCAGGGGCCTGG - Intronic
1190219052 X:48499241-48499263 GGCCTGGAGCAAAAGCGGGCTGG - Intergenic
1191254193 X:58272800-58272822 GGCCTGGGACCAAAGCGGCAAGG - Intergenic
1191257046 X:58284045-58284067 GGCCTGGAACGAAAGCAGCCAGG - Intergenic
1191797482 X:65035671-65035693 GGCATGGAGCGACAGCAGCCCGG - Intergenic
1192705605 X:73526591-73526613 AGGCTGGAGCCAGAGCAGCCAGG - Intergenic
1195966321 X:110433102-110433124 GTCTTGGAGCCACAGCTGACAGG - Intronic
1196141155 X:112265040-112265062 GTCTTGGAGCCACAGCTGACAGG + Intergenic
1196264427 X:113625834-113625856 GGCCTGTGGCCACTGCTGCCTGG + Intergenic
1197112466 X:122792904-122792926 GGCCTGGAACCAAAGCCTCCTGG + Intergenic
1199991234 X:152988751-152988773 GGGATGGGGCCACAGTGGCCAGG - Intergenic
1200234144 X:154460105-154460127 GGCCTCGAGCCACAGAGGGCTGG - Intronic
1201714007 Y:17023548-17023570 TGCCTGAAGCCACAGCTGCTTGG - Intergenic
1202380973 Y:24276470-24276492 GGCCTGGAGACACAGCCGGGAGG - Intergenic
1202489812 Y:25393656-25393678 GGCCTGGAGACACAGCCGGGAGG + Intergenic