ID: 1159954725

View in Genome Browser
Species Human (GRCh38)
Location 18:74511143-74511165
Sequence GGTTTATGGAAGCTGGGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159954725_1159954731 -3 Left 1159954725 18:74511143-74511165 CCAATTCCCAGCTTCCATAAACC 0: 1
1: 0
2: 0
3: 16
4: 207
Right 1159954731 18:74511163-74511185 ACCACCGTCCTACACCAGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 97
1159954725_1159954729 -7 Left 1159954725 18:74511143-74511165 CCAATTCCCAGCTTCCATAAACC 0: 1
1: 0
2: 0
3: 16
4: 207
Right 1159954729 18:74511159-74511181 ATAAACCACCGTCCTACACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1159954725_1159954730 -6 Left 1159954725 18:74511143-74511165 CCAATTCCCAGCTTCCATAAACC 0: 1
1: 0
2: 0
3: 16
4: 207
Right 1159954730 18:74511160-74511182 TAAACCACCGTCCTACACCAGGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159954725 Original CRISPR GGTTTATGGAAGCTGGGAAT TGG (reversed) Intronic
905323767 1:37135828-37135850 GGTTATTGGAGGCTGGGAAGAGG - Intergenic
907144293 1:52218793-52218815 GGTTTTGGGAAGCGGGTAATGGG + Intronic
907162551 1:52381846-52381868 GTTATATGGGACCTGGGAATTGG - Intronic
909193437 1:72585178-72585200 GGTTTAGAGTAGCTGGGAACTGG - Intergenic
911850350 1:102811033-102811055 GGTTTATTGAAGATGAGATTTGG + Intergenic
912677022 1:111692060-111692082 TGTTTATGGAAGCTTGGATTAGG + Intronic
915145440 1:153793775-153793797 GATTTCTGGAAGCTGAGAAAGGG + Intergenic
916061714 1:161103273-161103295 GCTTTAGGGAATCTAGGAATAGG - Intronic
916075918 1:161199962-161199984 GGTTTAGGGCAGTTGGGAGTGGG - Intronic
917442807 1:175081823-175081845 GGTGTAAGGAAGCAGGGATTGGG + Intronic
917976248 1:180240767-180240789 GGTTTCCGAAAGCTGGGAAGTGG - Intronic
921801093 1:219403355-219403377 GTTTTCTGAAAGCTGGGAAGAGG - Intergenic
922967645 1:229704511-229704533 TGTTTATGGAATTTGGGAAAAGG - Intergenic
923272318 1:232368877-232368899 GGAACATGAAAGCTGGGAATTGG + Intergenic
924025291 1:239826030-239826052 GGTTTCTGGGAACTGGGAAGAGG + Intronic
1063333869 10:5190252-5190274 TTTTTATGGCAGTTGGGAATGGG - Intergenic
1063614640 10:7591308-7591330 GGTTTAGGGAAGCTGGGTGTGGG - Intronic
1064119166 10:12604314-12604336 GGATGGTGGAAGTTGGGAATAGG + Intronic
1068013054 10:51478557-51478579 GTTTTAGGGAAACTGGGAATTGG - Intronic
1070144742 10:73765593-73765615 TGTTCATGGAAGCTGGGATTTGG + Intronic
1070332320 10:75427075-75427097 GGTTTGAGGAAGGTGGGAGTGGG - Intergenic
1070441266 10:76445986-76446008 GCTTTGGGGAAGCTGGGACTAGG - Intronic
1071377222 10:85019622-85019644 AGTTGATAGAAGATGGGAATCGG - Intergenic
1072695351 10:97599264-97599286 AGATAAGGGAAGCTGGGAATAGG + Intronic
1073577009 10:104634869-104634891 GGCTTATTGATGCTGGTAATAGG + Intergenic
1075216681 10:120542517-120542539 TGTTTATGAAAGATGGGATTTGG + Intronic
1077970672 11:7186446-7186468 GGTTACTAGATGCTGGGAATGGG - Intergenic
1078386744 11:10899243-10899265 GGGCTATGGCAGCTGGGAACCGG + Intergenic
1078982877 11:16558251-16558273 GGTTTATGAAGGCAGGGAGTTGG - Intronic
1081885616 11:46493389-46493411 GGTCTAGGGAAAGTGGGAATAGG + Intronic
1082213585 11:49537326-49537348 GGTATATGGAAGCTCTGAATCGG - Intergenic
1083587706 11:63872578-63872600 GGTTTATGGCCTCTGGGAAAAGG - Intronic
1084574514 11:69980264-69980286 GGGTTAGGGAAGTGGGGAATGGG + Intergenic
1085163273 11:74369292-74369314 GGATAATGGAAAGTGGGAATTGG + Intronic
1086543084 11:87935758-87935780 GGTTCATGGATGCAGGGAGTAGG - Intergenic
1086583524 11:88426071-88426093 AGCTTATCAAAGCTGGGAATAGG + Intergenic
1086636026 11:89087123-89087145 GGTGTATGGAAGCTCTGAATCGG + Intergenic
1087185491 11:95188526-95188548 TGTTTATGTAAGGTGGGAACTGG - Intronic
1087219848 11:95535065-95535087 GGTTTAAGGAAGGTGGGAAGAGG + Intergenic
1088249469 11:107850262-107850284 TGTTTGTGGAGGCTGGGAGTTGG + Intronic
1089344093 11:117779005-117779027 GGTTTAAAGTAGCTGGGAACGGG - Intronic
1089554832 11:119310607-119310629 GGCTGATGGAAGCTGGGCAGTGG + Intronic
1090668657 11:128930970-128930992 GGATTATGGAGGCAGGGATTAGG + Intergenic
1091970862 12:4785815-4785837 TCTTTATGGAGGCTGGGACTGGG + Intronic
1093577827 12:20754687-20754709 GAATTATGGAAACTTGGAATTGG + Intergenic
1094754722 12:33454748-33454770 GCTTGATGGAAACTGTGAATGGG - Intergenic
1096553500 12:52389575-52389597 GGTTGAGGGAAGCTGGGACATGG - Intergenic
1097082408 12:56442288-56442310 GGATTAAGGCAGCTGGGAATAGG + Intronic
1097288328 12:57894485-57894507 GGCTGAGGGAAGCTGGAAATAGG + Intergenic
1097394913 12:59061493-59061515 AGTTTATGGAGGATGGGCATTGG + Intergenic
1098877275 12:75879096-75879118 GAATTATGGAAGGTGAGAATTGG - Intergenic
1101535456 12:105612470-105612492 AGTTTTTGGAAGATGAGAATGGG - Intergenic
1107751531 13:43572413-43572435 GGTCTATGGAACGTTGGAATTGG - Intronic
1108122466 13:47204207-47204229 GGTTGCCAGAAGCTGGGAATGGG + Intergenic
1109178460 13:59184646-59184668 GGTTTGGGGGAGGTGGGAATAGG - Intergenic
1111685679 13:91498461-91498483 GGTTTATGTAAGAAGGGAAGGGG + Intronic
1119856885 14:77907754-77907776 GGTCTGGGGAAGCTGGGAATCGG - Intronic
1121174674 14:91882346-91882368 GGTTCAAGGAGGCTGAGAATGGG + Intronic
1122144231 14:99679592-99679614 GGTTCAAGGAAGCTGGAAACTGG + Exonic
1128886730 15:71294968-71294990 GTTTTATGGCACCTGGGAACTGG + Intronic
1130072598 15:80660697-80660719 GGTGTAGCGAAGCTGGAAATAGG - Intergenic
1130167305 15:81475218-81475240 TGTGTATAGGAGCTGGGAATTGG + Intergenic
1130391477 15:83459424-83459446 GGTTTATGAAAGATGGGTCTTGG + Intronic
1131342607 15:91616691-91616713 GATCTATGGAAACAGGGAATGGG + Intergenic
1131450426 15:92534960-92534982 GGGTCAGGGAAGCTTGGAATGGG + Intergenic
1131612128 15:93976371-93976393 GGTTTTTGGACCCTTGGAATAGG - Intergenic
1132341961 15:101084707-101084729 TGTTTCTGGATTCTGGGAATTGG - Intergenic
1134567673 16:15265412-15265434 GGTTTGTGGTAGCGGGGTATTGG - Intergenic
1134734765 16:16490941-16490963 GGTTTGTGGTAGCGGGGTATTGG + Intergenic
1134932708 16:18220965-18220987 GGTTTGTGGTAGCGGGGTATTGG - Intergenic
1136387822 16:29941027-29941049 TCTTTCTGGAAGCTGGGACTTGG + Intronic
1137597800 16:49736402-49736424 GGTTCAGGGAAGCTGGGTTTGGG - Intronic
1138392931 16:56683313-56683335 GGTTTGGGGAAGCTGGTCATTGG - Intronic
1139660839 16:68419702-68419724 GGTTCATGGAAGCTGGGCCCTGG - Intronic
1141888699 16:86911525-86911547 GGTTTATGGAACTTGGGAGCAGG - Intergenic
1143674093 17:8418134-8418156 GGATTTTGGAAGCTGGAAAGTGG - Intronic
1146426709 17:32747051-32747073 GTATTATGGAACCTGGGAACAGG + Intronic
1146617517 17:34368819-34368841 CGTTCAGGGAAGCTGGGACTGGG - Intergenic
1147910560 17:43853513-43853535 GGGTCATGGAAGCGGGGAAGGGG + Intronic
1148654738 17:49274831-49274853 AGTGGATGCAAGCTGGGAATGGG - Intergenic
1148892256 17:50816791-50816813 GGCTGAGGGAAGCAGGGAATTGG - Intergenic
1149718114 17:58814209-58814231 GTTAGATGGAAGATGGGAATAGG + Intronic
1153302567 18:3604167-3604189 GGCTTTTATAAGCTGGGAATGGG - Intronic
1153371944 18:4327746-4327768 GGTTTTCAGAAGCTGGAAATGGG - Intronic
1155397008 18:25397208-25397230 GATCTATGGTTGCTGGGAATGGG + Intergenic
1156105679 18:33657325-33657347 GGATTATAGAGGCTGAGAATTGG + Intronic
1158406102 18:57161039-57161061 TGTTTATGGCAGCTGGCGATAGG - Intergenic
1159954725 18:74511143-74511165 GGTTTATGGAAGCTGGGAATTGG - Intronic
1165122566 19:33569967-33569989 GGATTCCGGAAGCTGGGACTGGG + Intergenic
1165163044 19:33829352-33829374 GGTGTTTGGAAGCTGGGAGAGGG + Intergenic
925107565 2:1306122-1306144 GGTTTATGGAAGGTGGGCAAGGG + Intronic
926359829 2:12076378-12076400 GCTTTCTAGAAGCTGGGCATTGG - Intergenic
928162514 2:28941000-28941022 GGTCTCTGGGAGCTGGGAAAAGG + Intronic
930389523 2:50743441-50743463 AGTTTATGTTAGCTGGGAAATGG + Intronic
930561243 2:52962182-52962204 AGATTATGGTAGCTGGGACTAGG - Intergenic
931011661 2:57922875-57922897 GGTTACTAGAAGCTGGGAAGAGG - Intronic
932239594 2:70146296-70146318 GGTGTCTGGAGGCTGGGAGTGGG + Intergenic
932928219 2:76001996-76002018 GGTTAACAGAGGCTGGGAATAGG - Intergenic
934554317 2:95279222-95279244 GGCTGATAGAGGCTGGGAATGGG - Intronic
937561447 2:123229847-123229869 TGTTTATGGAAGCTGAAGATAGG + Intergenic
939963330 2:148585676-148585698 GGTTTGAGGAAGCTGGGCCTTGG + Intergenic
940684144 2:156825111-156825133 TGTTTGTGGAAGCTAAGAATGGG + Intergenic
942334001 2:174861003-174861025 GCTTTATGGAAGGAGGGATTAGG - Intronic
942857825 2:180572028-180572050 GGTTGGTAGAAGGTGGGAATGGG + Intergenic
942889225 2:180966710-180966732 GGTTTCTAGAAGCTGGAAAAAGG - Intergenic
947434154 2:230058484-230058506 GGGTGAGGGAAGATGGGAATGGG + Intronic
949065245 2:241986298-241986320 GGATTTTGGGAGCTGGGCATGGG + Intergenic
1168980853 20:2002538-2002560 GGGATCTGGAAGCTGGGACTGGG + Intergenic
1169069233 20:2712293-2712315 GGATGATGGAAGCTGAGACTAGG + Intronic
1169586858 20:7095545-7095567 GGTTTGGGGAAGCTTGGCATTGG - Intergenic
1170610444 20:17908453-17908475 TGTGTATGGAAGCTGGGTGTGGG + Intergenic
1171793611 20:29549675-29549697 GAATTGTGGAAGCTGGGGATGGG - Intergenic
1171854860 20:30334713-30334735 GAATTGTGGAAGCTGGGGATGGG + Intergenic
1172792961 20:37518941-37518963 CGATTCTGGAAGCGGGGAATCGG + Exonic
1174061808 20:47838396-47838418 GCTTTATGGAAGGTCTGAATTGG - Intergenic
1174069700 20:47890833-47890855 GCTTTATGGAAGGTCTGAATTGG + Intergenic
1174375486 20:50124065-50124087 GGTTGGGGGGAGCTGGGAATGGG + Exonic
1176113033 20:63419100-63419122 GGTTTAGGGCAGGTGGAAATAGG - Intronic
1177856319 21:26404445-26404467 GGTTTAAGAAAGCTGGAAACAGG - Intergenic
1178253881 21:31032565-31032587 GATTCATGGGAACTGGGAATAGG - Intergenic
1178345462 21:31822764-31822786 AGGTTATGGGAGATGGGAATTGG + Intergenic
1178828659 21:36036454-36036476 GGTTTGGGGAAGAGGGGAATAGG - Intronic
1183106067 22:35615993-35616015 GGTAGACGGAAGCTGGAAATGGG + Intronic
1185225549 22:49649848-49649870 GGTTAATGGATGCGGGGAACCGG - Intronic
950634082 3:14303007-14303029 GTTTTGTGGATGCTGGGAGTGGG - Intergenic
952682291 3:36107618-36107640 AATTTATGGAAGATGGCAATAGG - Intergenic
953653347 3:44825923-44825945 GGCTTATGTGAGTTGGGAATGGG + Intronic
955640567 3:61078547-61078569 GGTAGATGAAAGCAGGGAATGGG - Intronic
956419692 3:69074231-69074253 GGTTTATGGAGGATGGGCATTGG - Intronic
957304242 3:78436322-78436344 TGATTATGGAAGATGGGAGTAGG - Intergenic
959125741 3:102288974-102288996 TGTTTAAGGAAGCTAGAAATAGG + Intronic
962080359 3:132132608-132132630 TGTTTGTGGAAGCAGGGAAGTGG + Intronic
963211314 3:142694666-142694688 AGTTTCAGGATGCTGGGAATTGG + Intronic
963528914 3:146448563-146448585 GGTTTATGGAAACAGAGAAATGG - Intronic
964459350 3:156905711-156905733 CTTTTAAGGAAGCAGGGAATGGG - Intronic
964674267 3:159260133-159260155 GTTTTATGGAATTTGGAAATTGG - Intronic
965384620 3:168031173-168031195 GGTTACTAGAAGCTGGGAAGGGG + Intronic
965851337 3:173029320-173029342 GTTTTATGGAAGCTGGTAGAAGG + Intronic
966479941 3:180396139-180396161 GGTTTCTGGAAGATGTGAACTGG + Intergenic
967279734 3:187810341-187810363 GATTTATTCAAGCTGGGGATGGG - Intergenic
970877723 4:20891703-20891725 GTGTCATGGATGCTGGGAATAGG + Intronic
972795902 4:42419526-42419548 GGGTTTGGAAAGCTGGGAATTGG + Intronic
973070680 4:45854946-45854968 TGTTTAGGGAAGCTGAAAATAGG + Intergenic
974107846 4:57490949-57490971 GGTTTAATGAAGCTGGAAACAGG - Intergenic
974365713 4:60946352-60946374 GTTTTATGGAAGCTAGAACTTGG - Intergenic
974696674 4:65384518-65384540 GGCATATTGAAGCTGGAAATGGG - Intronic
975362671 4:73489647-73489669 GATTTCTAGAGGCTGGGAATTGG - Intronic
976653328 4:87459745-87459767 GGTTTTTGGAAGCAAGGAAAAGG + Intergenic
976881291 4:89928660-89928682 GGCTTCTAGAAGCTGGGAATGGG - Intronic
977375856 4:96203167-96203189 AGTTTATTAAAGCTGGTAATTGG - Intergenic
977599516 4:98920801-98920823 GGTTTATGGATGGTGGGATTAGG - Intronic
983677276 4:170310195-170310217 GGACTATTGCAGCTGGGAATGGG + Intergenic
985863913 5:2496393-2496415 GGGCTCTGGAAGCTGGGAGTCGG - Intergenic
986485055 5:8227727-8227749 GGGAAATGGAAGCTGGGAAATGG - Intergenic
987320882 5:16768155-16768177 AGGTCATGGAAGCTGGAAATTGG - Intronic
994869987 5:105335452-105335474 GGTTTGGAGATGCTGGGAATAGG + Intergenic
995651688 5:114376863-114376885 GCTTGAAGGAAGCCGGGAATTGG + Intronic
995714442 5:115068367-115068389 GGATTATGGCAGCTGGGATCAGG + Intergenic
996696040 5:126396320-126396342 GGTAGATGGAAGGTGGGAGTAGG - Intronic
997765407 5:136498670-136498692 GGTTTAAGGAGGCTGAAAATAGG + Intergenic
997799401 5:136844542-136844564 GGGGTTTGGAAGCTGGGAAAAGG + Intergenic
1000331093 5:160206015-160206037 TGTTTATGGAAGGAGGGTATCGG - Intronic
1000472916 5:161668553-161668575 TATTTTTGGAAGTTGGGAATAGG + Intronic
1001938704 5:175726144-175726166 GGTTACTGGAGGCTGGGAATGGG + Intergenic
1003324450 6:5082113-5082135 GTCATATGGAAGCTGGGGATGGG + Intergenic
1003462875 6:6348335-6348357 GGTTTATGAAATTTGTGAATTGG + Intergenic
1004769458 6:18765328-18765350 AGGTTAGGGAAGCTGGGTATTGG + Intergenic
1005217079 6:23543072-23543094 GGTTTATGTAAAATGGAAATAGG - Intergenic
1005726949 6:28658701-28658723 GGTTTCTGGAGTTTGGGAATAGG - Intergenic
1006077106 6:31540732-31540754 GGTTTAGGGAAAGTGGGAACTGG - Intronic
1006166650 6:32069385-32069407 GGTTGCTGGAGGCTGGGACTGGG + Intronic
1006229520 6:32571218-32571240 GGTTTATGGAAAGAGAGAATTGG - Intronic
1006762657 6:36477007-36477029 GGTTTTTTGAATCTTGGAATGGG + Intronic
1007199538 6:40095036-40095058 GATTTATGGAAGAGGGGAACTGG + Intergenic
1008684243 6:53906473-53906495 GGATCAGGGAAGCTGGGGATGGG - Intronic
1010100613 6:72102597-72102619 GGCTTATAAAAGGTGGGAATTGG + Intronic
1016215640 6:141598986-141599008 GCTTTATGGAACCTAGGAAGAGG - Intergenic
1016217007 6:141616828-141616850 GGTTTTTGGAAGCAGGGCTTTGG + Intergenic
1017299757 6:152843154-152843176 GGTTACTGGGAGCTGGGGATGGG + Intergenic
1021309039 7:19070119-19070141 GCTTTATGGCAGTTGGGAGTGGG - Intronic
1024389948 7:48797379-48797401 GGTTTCTAGAGGATGGGAATTGG - Intergenic
1025875897 7:65479345-65479367 GGTTTATGGAATCAGGGTGTAGG - Intergenic
1027820017 7:83030834-83030856 GGTTTATAGAGACTGAGAATTGG + Intronic
1033959497 7:146896259-146896281 GGTGTATGCAAGTTTGGAATGGG - Intronic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1037403786 8:18520495-18520517 GGTTTTTGGAAGGTGGGAACAGG - Intergenic
1038255822 8:25950084-25950106 GGTTTATAGAAGCTGGTCTTCGG - Intronic
1038399059 8:27269231-27269253 GGGTTAGGCAAGCTGGGGATGGG + Intergenic
1038835607 8:31118145-31118167 GTTTTAATGAAGCTGTGAATTGG - Intronic
1039997824 8:42549571-42549593 GGGCTATGGAAGAGGGGAATAGG + Intronic
1042616918 8:70659815-70659837 GGTTGTTGGAGGCTGGGGATGGG + Intronic
1043536896 8:81215060-81215082 GGTTTATAGGGGCTGGGGATGGG + Intergenic
1044681365 8:94781567-94781589 GGCCTATGGAAGCAGGGAATTGG + Intronic
1047713706 8:127576437-127576459 GGTTTAAGGAGGCTGGGAGGTGG - Intergenic
1047761778 8:127959900-127959922 CATTTCTGGAAGCAGGGAATTGG + Intergenic
1048585994 8:135774668-135774690 AGTTAATGGAAGCAGTGAATAGG + Intergenic
1049537865 8:143190299-143190321 GGTTGCTTGAAGCTGGGAGTTGG - Intergenic
1050037859 9:1456323-1456345 TGTTTACGGAAACTGGGAAAAGG - Intergenic
1053478250 9:38397199-38397221 GGTTTAAGGAATCTGGAAACGGG + Exonic
1053792684 9:41697996-41698018 GAATTGTGGAAGCTGGGGATGGG + Intergenic
1054152496 9:61616824-61616846 GAATTGTGGAAGCTGGGGATGGG - Intergenic
1054181097 9:61910017-61910039 GAATTGTGGAAGCTGGGGATGGG + Intergenic
1054472266 9:65547972-65547994 GAATTGTGGAAGCTGGGGATGGG - Intergenic
1054656494 9:67671125-67671147 GAATTGTGGAAGCTGGGGATGGG - Intergenic
1056039595 9:82649219-82649241 AGTTTCTGGGAGTTGGGAATGGG - Intergenic
1057113955 9:92502429-92502451 AGAGTATGGAAACTGGGAATGGG - Intronic
1058046672 9:100364746-100364768 CGTTGTTGGAAGCTGGGAAGAGG + Intergenic
1058244437 9:102605157-102605179 TTTTTATGGAAACTGTGAATGGG - Intergenic
1058793263 9:108472109-108472131 AATCTATGGAGGCTGGGAATGGG - Intergenic
1058959291 9:109977878-109977900 GGTTTCTGGATTCTGGGAAAGGG + Intronic
1186157414 X:6739878-6739900 AGTTTCTAGAACCTGGGAATAGG + Intergenic
1186973477 X:14873971-14873993 GGTTAATGTAAGTTGGAAATCGG + Intronic
1187660006 X:21534100-21534122 GGTTACTGGAGGCTGAGAATGGG - Intronic
1189180449 X:38999597-38999619 GGTTTGTGGAAGTAGGGAAGAGG - Intergenic
1191874204 X:65778206-65778228 GTTTGATGGAAGTTGGGAAAGGG + Intergenic
1192116073 X:68412475-68412497 GGCTGAGGGCAGCTGGGAATGGG + Intronic
1192987950 X:76420563-76420585 TGTTTATGAAAACTGGTAATAGG - Intergenic
1193986753 X:88252238-88252260 GTTTTCTGGAAGCCAGGAATTGG + Intergenic
1194345703 X:92761800-92761822 TTTTTATGGTAGCTGGGAGTGGG + Intergenic
1196812923 X:119642947-119642969 GGATTATGGAAGGTGGGTGTGGG + Intronic
1199389015 X:147258067-147258089 GGTGTATGGAAGCAGAAAATGGG - Intergenic
1200654049 Y:5878451-5878473 TTTTTATGGTAGCTGGGAGTGGG + Intergenic
1200710653 Y:6481860-6481882 AGTATATGGCAGCTGGGATTGGG + Intergenic
1201023280 Y:9680124-9680146 AGTATATGGCAGCTGGGATTGGG - Intergenic