ID: 1159955542

View in Genome Browser
Species Human (GRCh38)
Location 18:74516087-74516109
Sequence GGAGCCTGACAACCACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159955542 Original CRISPR GGAGCCTGACAACCACAGGC AGG (reversed) Intronic
900309837 1:2028391-2028413 AAAGCATGAAAACCACAGGCGGG - Intronic
900582509 1:3416056-3416078 GAAGCCTGACCCCCACAGCCTGG + Intronic
900788963 1:4666844-4666866 GGAGCCTGTGAATCACAGGAGGG + Intronic
900788995 1:4666971-4666993 GGAGCCTGTGAATCACAGGAGGG + Intronic
901102560 1:6730497-6730519 GGAACCTGACACCCACTGTCGGG - Intergenic
901706841 1:11080030-11080052 GGAGCCTGACTCCCACAATCAGG + Intronic
902163867 1:14553758-14553780 GGCGCCTGACAACCACCCGGTGG - Intergenic
902783250 1:18717549-18717571 GGGGCCTGGCCACCACAGCCAGG - Intronic
902847045 1:19119615-19119637 GCAGCCTTACGACCATAGGCTGG + Exonic
903914442 1:26753322-26753344 AGAGCCTGACAAACTCATGCTGG + Intronic
904150814 1:28438076-28438098 GGAGACTGCCAACCACATTCTGG - Intronic
905657215 1:39692470-39692492 GGAGCCAGACATCCCCGGGCTGG + Intronic
907587901 1:55637799-55637821 CTAGCCTAACTACCACAGGCTGG + Intergenic
912456729 1:109803106-109803128 GGAGTCTGGCAGGCACAGGCTGG - Intergenic
915741074 1:158118782-158118804 GGTGCCTGGGACCCACAGGCTGG - Intergenic
917135111 1:171781885-171781907 GGAGCTTGCCCACCACACGCAGG - Exonic
919919895 1:202161510-202161532 GGAGCCTGCCAAGGTCAGGCAGG - Exonic
922742492 1:228021846-228021868 AGAACCTGAGAACCTCAGGCTGG - Intronic
923254806 1:232212275-232212297 GGAGCCTGGCAGCCACTGGAGGG - Intergenic
923561611 1:235046082-235046104 GCAGCCTGACACCCACCGTCTGG - Intergenic
923914942 1:238491656-238491678 GGAGACTGAGAACCAGAGGCTGG + Intergenic
924295784 1:242585831-242585853 GGAGCCTGACCACCACCGCCTGG + Intergenic
1067043896 10:42974011-42974033 GGAGTCTGACAACACCAGACAGG - Intergenic
1067404898 10:46012947-46012969 GGAGCTTGATAACCACTGGCAGG + Exonic
1069051119 10:63795670-63795692 GATGCATGACAGCCACAGGCAGG - Intergenic
1073219281 10:101856396-101856418 CGAGCCTGAAGACCACAGGATGG - Intronic
1074738185 10:116457702-116457724 GGGGCCTCACAGCCTCAGGCAGG + Intronic
1075181835 10:120218102-120218124 GGAGGCTGCCTACCACAGCCAGG + Intergenic
1075222826 10:120599667-120599689 GGAAACTGACCACCCCAGGCAGG - Exonic
1075432844 10:122403719-122403741 GGAGCCTCACTCCCCCAGGCCGG + Intronic
1076469935 10:130711235-130711257 GGGGCTGGACAGCCACAGGCTGG + Intergenic
1076756659 10:132576134-132576156 GGAGCCTGACCTGCACAGGGAGG - Intronic
1076835706 10:133020049-133020071 GGCGCCTGACATCGACATGCAGG + Intergenic
1077065350 11:638701-638723 GGACCCTGCCTACCCCAGGCTGG + Intronic
1077284938 11:1761464-1761486 GGATCCTGTCAACCACGGGTCGG + Exonic
1077446331 11:2592719-2592741 GGAGCCTGACACTCACAGCCCGG + Intronic
1077488144 11:2848429-2848451 GGACCCTGCCAGGCACAGGCAGG + Exonic
1078489771 11:11758172-11758194 GGAGCCTGATTACCCTAGGCTGG - Intergenic
1078542983 11:12226291-12226313 GGAGCCTGACAAGCTCAGCATGG + Exonic
1080295573 11:30723364-30723386 GGAGGCTGGCTACCACAGGAGGG + Intergenic
1080885519 11:36364001-36364023 GCAGCCTGACAAGAACATGCAGG - Intronic
1082765873 11:57167229-57167251 GGGGCCTCACAAACACAGGCAGG + Intergenic
1083292052 11:61695905-61695927 GGAGCCTGTCATCCACACTCTGG - Intronic
1083620810 11:64048454-64048476 GGTCCCTGGCAACCACAGCCTGG - Intronic
1084996476 11:72984621-72984643 GAAGCCTGGCAGCCACAGCCAGG + Intronic
1085302842 11:75468446-75468468 GGAGCCTGACAACGGAAGGCTGG + Intronic
1086148611 11:83583011-83583033 AGAGCCAGACACCCTCAGGCTGG - Intronic
1088985721 11:114906191-114906213 GAAGGCTGGCTACCACAGGCTGG + Intergenic
1089444928 11:118544283-118544305 GGAGCCAGACAGCCTCAGGAAGG + Intronic
1089602883 11:119625994-119626016 GGACCCTGACATCCCCAGTCGGG - Intronic
1091532665 12:1374568-1374590 GGGGCCTGACAATCACAGTGGGG - Intronic
1092027605 12:5255988-5256010 GGTGCCTGACAATGACAGGAGGG - Intergenic
1092630657 12:10372661-10372683 GCAGCATGACCCCCACAGGCAGG + Exonic
1093191603 12:16081220-16081242 GAAGCCTGACAAACACAGCAAGG - Intergenic
1104111762 12:125710920-125710942 AGAGCCTGGGAACCACAGGCTGG + Intergenic
1104454769 12:128901951-128901973 GGAAACTGACAACCTCATGCTGG - Intronic
1107559332 13:41545971-41545993 GGAGCCTGGCGAACAGAGGCAGG - Intergenic
1110624172 13:77633138-77633160 GAAGCCAGGCAAACACAGGCCGG + Intronic
1110760717 13:79227731-79227753 AGAGCCTGATGACCACAGGAAGG - Intergenic
1112248142 13:97753283-97753305 GGATCCAGACACCTACAGGCAGG - Intergenic
1113861638 13:113490911-113490933 GGGGCCTGGCAGCCGCAGGCTGG - Exonic
1117874182 14:60234348-60234370 GCAGCCTGACAACCACTGGAAGG - Intergenic
1118630246 14:67695834-67695856 AGAGCTTGACAGCCTCAGGCTGG + Intergenic
1121931139 14:97973198-97973220 GGAGGCTGCCAACCCCAAGCAGG - Intronic
1122138499 14:99648151-99648173 GGAGACTGACACACACAGGAAGG + Intronic
1122279237 14:100611303-100611325 GGACCCTGCCTACCCCAGGCGGG - Intergenic
1122631213 14:103108613-103108635 GGGGCCTGAAGACCAGAGGCAGG + Intronic
1128656762 15:69468360-69468382 GAAGACTGACAACCACAGAGAGG - Intergenic
1132242235 15:100266671-100266693 CCAGCCTGACCACCACTGGCTGG + Intronic
1132530429 16:445605-445627 TGAGGCTGACACCCTCAGGCAGG + Intronic
1133209882 16:4257658-4257680 GAAGGCTGACAATCCCAGGCTGG + Exonic
1134564891 16:15242943-15242965 GAAACCTCAAAACCACAGGCAGG + Intergenic
1134737605 16:16513755-16513777 GAAACCTCAAAACCACAGGCAGG - Intergenic
1134929901 16:18198405-18198427 GAAACCTCAAAACCACAGGCAGG + Intergenic
1136524679 16:30821316-30821338 GGAGCTTGACATGCAGAGGCTGG + Intergenic
1137542338 16:49373380-49373402 GGTGCCTGATAACCACATGTTGG + Intergenic
1139250860 16:65494550-65494572 GCTGACTGACATCCACAGGCAGG - Intergenic
1139436450 16:66939352-66939374 GTGGCCTGACACCCACCGGCAGG - Exonic
1139964415 16:70737558-70737580 GGAGCCTGCCAGCCCCTGGCAGG + Intronic
1143725833 17:8845062-8845084 GGTGCCTGTCAACAACAGACTGG - Intronic
1144574204 17:16418667-16418689 GGAGCCTGCCCGACACAGGCAGG + Intronic
1144676392 17:17165005-17165027 AGAGGCTGACAACCAGAGCCTGG + Intronic
1145758214 17:27408382-27408404 GGAGACAGACAACAGCAGGCTGG - Intergenic
1146268670 17:31470245-31470267 GGTGCCTGAGGACCACAGGAGGG - Intronic
1147132440 17:38417536-38417558 GGAGCCTGGCTTCCACAGCCAGG + Intergenic
1147689269 17:42305618-42305640 GGACGATGACAACCACAGGTAGG - Exonic
1148578343 17:48726712-48726734 GGAACCTGCCAAGCCCAGGCTGG - Exonic
1148876011 17:50687629-50687651 GGAGACTGACAACCTCATCCAGG + Exonic
1150839402 17:68594036-68594058 GCAGCTAGAAAACCACAGGCAGG - Intronic
1151584580 17:75001430-75001452 GGAGCTGACCAACCACAGGCTGG + Exonic
1151715422 17:75828728-75828750 GGAGCCTGTAAAGCTCAGGCAGG - Intronic
1152466555 17:80469863-80469885 GGAGCGTGCCACCCACAGCCCGG - Exonic
1152573586 17:81130810-81130832 GGACCCTGCCAACCCCTGGCCGG + Intronic
1156321980 18:36035055-36035077 GGAGCCTGAAAACCAGAAGCTGG - Intronic
1157582365 18:48781072-48781094 GGAGCCTGACAACAAGAAGAGGG - Intronic
1159955542 18:74516087-74516109 GGAGCCTGACAACCACAGGCAGG - Intronic
1160580137 18:79879045-79879067 GGAGCCTGACCCCCACATCCGGG - Intronic
1160608013 18:80066666-80066688 GGAGCTTCAGCACCACAGGCAGG - Intronic
1161453844 19:4360706-4360728 GGAGCCTGGCCACCAGGGGCTGG + Exonic
1162459038 19:10803425-10803447 GGGGGCTGCCACCCACAGGCAGG - Intronic
1162844603 19:13382558-13382580 GGAGGCTGTCAACTAGAGGCTGG + Intronic
1163359561 19:16837233-16837255 GGAGCGTGAGAACCACTGGATGG + Intronic
1166178798 19:41092755-41092777 GGAGGCTGACATCCAGAGGTAGG - Intronic
1167409843 19:49338276-49338298 GGGGCCTGACAACCTCTGGTCGG - Intronic
1167894406 19:52569751-52569773 GGAGCCTGAGGGCCAGAGGCGGG - Intronic
925386415 2:3464888-3464910 CGGGCCAGACCACCACAGGCAGG + Intronic
930157556 2:48120891-48120913 AGAGTATGGCAACCACAGGCTGG - Intergenic
932298486 2:70646198-70646220 GGAGCATGATACACACAGGCAGG - Intronic
934550721 2:95259946-95259968 GGAGCCTGACACCACCAGGGAGG + Intergenic
934777440 2:96948473-96948495 GGAGCCTGACAGTCAGAAGCTGG + Intronic
947951326 2:234150017-234150039 GAAGTCTGAAAACCACAGGAAGG - Intergenic
948627099 2:239275969-239275991 GGAGCCTGTCCACCACCGCCTGG - Intronic
948708542 2:239810821-239810843 GGAGCCCTACAAGCACAGGCTGG - Intergenic
948908059 2:240989236-240989258 GGGGCCTGACACCCACAGAAGGG + Intronic
1169188831 20:3644207-3644229 GGAGCCTCACAAACACAGAGAGG - Exonic
1171172870 20:23031474-23031496 GGAGTCTGAGAGCCACTGGCTGG - Intergenic
1173595698 20:44257486-44257508 GGAGCCACAGAGCCACAGGCAGG + Intronic
1175858513 20:62135913-62135935 GGAGCCTGATGGCCACAGGCAGG - Intergenic
1177353577 21:19978080-19978102 GTAGCCTGTGAACCACAGGTTGG + Intergenic
1177431180 21:20994548-20994570 GGAGCCTGGGAAGCCCAGGCTGG + Intergenic
1179382856 21:40915450-40915472 GGTGTCTGACATCCAAAGGCAGG - Intergenic
1179622331 21:42625522-42625544 GGATGCTGACAACCACAGGAAGG - Intergenic
1179724525 21:43334405-43334427 GAACCCTGACCACCACAGGAAGG + Intergenic
1179730421 21:43364460-43364482 GGGGCCTGACAATCACAGGATGG - Intergenic
1181031489 22:20150467-20150489 GGAGCAGGAGAACCACAGCCTGG - Exonic
1181417648 22:22771961-22771983 GCATCCTGCCCACCACAGGCAGG - Intronic
1181430856 22:22880887-22880909 GCATCCTGCCCACCACAGGCGGG - Intronic
1181511902 22:23393052-23393074 GGAGCAGGAGAACCACAGCCTGG + Intergenic
1183507234 22:38215843-38215865 GGAGAATGACAATCAAAGGCAGG - Exonic
1184895940 22:47406481-47406503 AGAGACTGACAACCACGGGGTGG + Intergenic
1184996953 22:48214285-48214307 GTAGCCTGAGGACCACAGCCTGG - Intergenic
1185363629 22:50424134-50424156 GGAGCCCGCCACCCACAGCCAGG - Intronic
952685932 3:36148459-36148481 GGAGTCTGACATCCAAGGGCAGG - Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
954434945 3:50490974-50490996 GGGCCCTGCCAACCCCAGGCAGG - Intronic
955624223 3:60899720-60899742 GCAGCCTGATAATCACCGGCTGG - Intronic
955713558 3:61805039-61805061 GGCGCCTGAAACCCAGAGGCAGG + Intronic
956671386 3:71694664-71694686 GGAGCCTGTGAATCACAGGAAGG - Intronic
959246321 3:103874098-103874120 GCAGCCTGACTAGCACATGCTGG - Intergenic
959246347 3:103874332-103874354 GCAGCCTGACTAGCACATGCTGG - Intergenic
959521389 3:107326549-107326571 GGATCCGCACAAACACAGGCAGG + Intergenic
961262694 3:125615416-125615438 GGAGTCTGACATCCAAGGGCAGG - Intergenic
961643289 3:128378696-128378718 TGTGCCTGACACCCCCAGGCTGG + Intronic
961778987 3:129310486-129310508 GGAGCTTGAAGTCCACAGGCAGG - Intergenic
963460835 3:145613005-145613027 GGAGCCTGATATTCAAAGGCAGG - Intergenic
964225735 3:154399167-154399189 GGAGGTTGAGAACCACTGGCTGG + Intronic
967199926 3:187063944-187063966 GGAGCATGTCACCCAGAGGCTGG + Intronic
967983227 3:195077882-195077904 CGTGACTGACAACCCCAGGCAGG - Intronic
968565339 4:1309651-1309673 GGACCCTGAGAGCCACTGGCAGG + Intronic
969253767 4:5989099-5989121 CGAGCGGGATAACCACAGGCTGG - Exonic
975696264 4:77016326-77016348 GTAGCCTGACAGCCAAAGCCTGG - Intronic
976482090 4:85557043-85557065 GGAGCCTGAGAGCAACAGGAGGG + Intronic
976828275 4:89284260-89284282 GGAGGCTGAAGACCACATGCTGG + Intronic
981517479 4:145625388-145625410 GGAGCCTAATGACCACTGGCAGG + Intronic
985800277 5:2001325-2001347 GGAGGCTGACAAATACAGACGGG + Intergenic
986052789 5:4105488-4105510 GGAGCCTCCCAGACACAGGCAGG + Intergenic
986800401 5:11254332-11254354 GGTTCCTGAGAACCACAGCCAGG - Intronic
987004965 5:13701117-13701139 GCAGCCTGAGAACAACTGGCTGG + Intronic
988683273 5:33503428-33503450 GCAGCCAGACAACCTCAGGGAGG + Intergenic
991542809 5:67748461-67748483 GAGGCCTGACAAACACAGCCTGG - Intergenic
996126559 5:119732127-119732149 GCAGGCTGGAAACCACAGGCAGG - Intergenic
996555965 5:124779111-124779133 GGAGCCTGATGACCAAGGGCAGG - Intergenic
998110111 5:139494882-139494904 GGAGCCTGATGACCACTGGCAGG - Intergenic
999192490 5:149758692-149758714 GAAGGCTGAAGACCACAGGCAGG - Intronic
999713059 5:154335511-154335533 AGAGCAGGACAAGCACAGGCTGG + Intronic
1010573530 6:77506475-77506497 TAAGCCTCACAACCTCAGGCTGG - Intergenic
1013111288 6:107067442-107067464 GGAGCCTGACATTCCCAGTCGGG + Exonic
1013427645 6:110028385-110028407 GGAGCATGCCAAACACAGCCAGG - Intergenic
1015936771 6:138412395-138412417 GGAGACTGGGAATCACAGGCAGG + Intronic
1018028981 6:159827179-159827201 GACGCCTGACACCCACAGGGCGG + Intergenic
1018818021 6:167350522-167350544 GGACCCTGAGAACGACAGGGTGG + Intronic
1018872273 6:167792285-167792307 GCAGCCTGTCAAGCACAGGGAGG - Intronic
1022183878 7:27948153-27948175 GGAGCCTGAAAATCACAGGCTGG + Intronic
1026452246 7:70539772-70539794 GGAAGCTGACAAGCACTGGCAGG - Intronic
1029714891 7:102320387-102320409 GGAGCATGTCAAGCACAGACTGG - Exonic
1031942033 7:127799164-127799186 GAAACCTGACAACCACCGACAGG + Intronic
1034415076 7:150959937-150959959 GGAGCCTGGCAGCAACAAGCTGG - Intronic
1035369725 7:158372208-158372230 GGAGCTGGACACCCCCAGGCTGG + Intronic
1035369776 7:158372348-158372370 GGAGCTGGACACCCCCAGGCTGG + Intronic
1035645251 8:1214056-1214078 GGAGCCTGGCAACCACATGGAGG - Intergenic
1037745645 8:21642061-21642083 GGAGCCTGACATCCAAAGGATGG - Intergenic
1038022395 8:23561576-23561598 TGAGATTGACAACCTCAGGCTGG + Intronic
1046717223 8:117580915-117580937 GTTGCCTGAAAAACACAGGCAGG - Intergenic
1046842188 8:118871875-118871897 GGAGACAGAAATCCACAGGCAGG + Intergenic
1047768352 8:128008825-128008847 GGGGCCTGAAAAACACAGCCAGG + Intergenic
1049401651 8:142430313-142430335 TGAGCCTGGCAGACACAGGCCGG + Intergenic
1049528241 8:143140333-143140355 GGATGCTGACAGGCACAGGCTGG - Intergenic
1051819702 9:21150016-21150038 GGAGCTTGGCAACCTCATGCAGG + Intergenic
1052125258 9:24766240-24766262 GTAGCCTGGGAACCACAGTCAGG - Intergenic
1056887033 9:90453141-90453163 GGGGCCTCAAAAGCACAGGCCGG - Intergenic
1057371580 9:94479354-94479376 GGAGCCCGCCTGCCACAGGCTGG + Intergenic
1057383463 9:94588774-94588796 GGTGCCTGACACCCACTTGCGGG - Intronic
1058912692 9:109535311-109535333 GGAGGCTGACAACAGCAGGGAGG - Intergenic
1059714475 9:116900784-116900806 GGAGCCTGAGAACCAAACGAAGG - Intronic
1060348575 9:122837846-122837868 GGAGACTGAGAACCAGAGGCTGG + Intergenic
1060595215 9:124843646-124843668 TGGGCCTGACATCCACAGGGTGG + Intergenic
1061295179 9:129672976-129672998 GAAGTCTGGGAACCACAGGCCGG - Intronic
1061306673 9:129736466-129736488 GGAGCCCGCCCACCCCAGGCTGG + Intergenic
1061391804 9:130320897-130320919 GGAGCCCGACACTCACGGGCCGG - Intronic
1061507673 9:131040706-131040728 GGAGGCTGTGAGCCACAGGCTGG - Intronic
1061553173 9:131349717-131349739 GCAGCCTGGCACCCCCAGGCTGG - Intergenic
1061675712 9:132214405-132214427 GGGGCCTGACAGCCACATGAAGG - Intronic
1062331358 9:136046250-136046272 GGCCCCTGACAACGCCAGGCAGG + Intronic
1194321955 X:92459966-92459988 GGAGACTGAGAACCGTAGGCTGG + Intronic
1197859203 X:130951122-130951144 GGAGTCTGCAACCCACAGGCTGG - Intergenic
1200085910 X:153605025-153605047 GGAGACTGAGAACCAGAAGCTGG - Intergenic
1200630122 Y:5573443-5573465 GGAGACTGAGAACCGTAGGCTGG + Intronic