ID: 1159958993

View in Genome Browser
Species Human (GRCh38)
Location 18:74541109-74541131
Sequence TTGTAGGTTCTGAAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159958986_1159958993 30 Left 1159958986 18:74541056-74541078 CCTGCGAGTTGTTGGGCACTGGA 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1159958993 18:74541109-74541131 TTGTAGGTTCTGAAAGTGGAGGG 0: 1
1: 0
2: 2
3: 19
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159958993 Original CRISPR TTGTAGGTTCTGAAAGTGGA GGG Intronic
900295703 1:1948176-1948198 TCCCCGGTTCTGAAAGTGGAAGG + Intronic
900512106 1:3065624-3065646 TTGTAGATTCCGGGAGTGGAGGG + Intergenic
901078408 1:6569924-6569946 TGGCAGGTTCTGGAAGGGGAGGG + Intronic
901226498 1:7615907-7615929 TTGTAGGTGCTGGATGTGAATGG - Intronic
901499292 1:9641674-9641696 TTGTGGGTTTTGCAGGTGGAGGG - Intergenic
904767483 1:32861644-32861666 CTGTAGGTTTTGAAAGCAGAGGG - Intergenic
905255088 1:36675512-36675534 TTGGAAGCTCCGAAAGTGGAAGG + Intergenic
905382868 1:37576073-37576095 AGGTAGGTTCTGAAAGTTGGGGG - Intronic
907971273 1:59384011-59384033 TTTTGGGTTCACAAAGTGGAGGG + Intronic
910606218 1:89087654-89087676 TTGTAGGTACCTAAACTGGAAGG + Intergenic
911156490 1:94642490-94642512 TTTTAGCTTCAGCAAGTGGATGG - Intergenic
911946005 1:104109909-104109931 TAGTAGGTTTTGAAGTTGGATGG + Intergenic
912247235 1:107972164-107972186 TTTTTGGTTTTGAATGTGGATGG - Intergenic
912560860 1:110550599-110550621 TTGCTGGTTTTGAAGGTGGAAGG - Intergenic
914867671 1:151445796-151445818 TTATAGATGCTGAAAGTGAAAGG - Intronic
915924810 1:160008510-160008532 TTGTAAGTTCTTAAAGGGAAGGG - Intergenic
917229221 1:172818056-172818078 TTGATGGTGGTGAAAGTGGAAGG + Intergenic
917800817 1:178568468-178568490 TTCTAATTTCTTAAAGTGGAAGG + Intergenic
917846117 1:179021933-179021955 CTGTGGATTCTGAAAGTGGTGGG - Intergenic
917903041 1:179562518-179562540 TTGGAGCTTTTTAAAGTGGAGGG - Intronic
921738427 1:218655381-218655403 TGGTGGGTTCTGAGAGTTGATGG - Intergenic
921953916 1:220962029-220962051 TTGTGGGTTCTAGAAGTGAATGG + Intergenic
922017484 1:221665577-221665599 TAGAAAGTTCTGAAAGGGGAAGG - Intergenic
922770274 1:228178140-228178162 ATGTGGGCTCAGAAAGTGGAAGG - Exonic
924278381 1:242411111-242411133 TTATAGGTTCTTCAAGTAGAAGG + Intronic
924768639 1:247058447-247058469 TTCTAGTTTCTTAAAATGGAAGG - Intronic
1065711044 10:28518397-28518419 TTCTAGTTCCTGAAGGTGGAAGG + Intergenic
1067091734 10:43269728-43269750 TTTTAGTTTCTGAAGTTGGAGGG + Intergenic
1076204127 10:128581753-128581775 CTTTAGGTCCTGAAAGTGGAAGG - Intergenic
1077933534 11:6758658-6758680 TTGTTGGCTTTGAAGGTGGAAGG - Intergenic
1078155775 11:8798732-8798754 TTGTGGGTCCTGCAACTGGAGGG + Intronic
1078241151 11:9531660-9531682 TTGTATGATATAAAAGTGGAGGG + Intergenic
1079802606 11:24889095-24889117 TTTTGGCTTCTGTAAGTGGAAGG - Intronic
1080050066 11:27850679-27850701 TTGCTGGCTCTGAAGGTGGATGG - Intergenic
1080898922 11:36469241-36469263 TGGTAGGTTCTGCCAATGGAGGG + Intergenic
1081780567 11:45708415-45708437 TTGTATGTTCTGTATGAGGAAGG - Intergenic
1083825038 11:65196602-65196624 TTCTAGTTTCTTAAGGTGGAAGG + Intronic
1087595178 11:100244476-100244498 TTGAAGGTTTTGAAAGATGAAGG - Intronic
1089885240 11:121815071-121815093 TTGAAGGCTCTGGAACTGGAAGG + Intergenic
1090577401 11:128121189-128121211 TTCTAGTTTCATAAAGTGGAAGG - Intergenic
1090980864 11:131720506-131720528 TTGTAGGTGATGAAAGAGGCAGG + Intronic
1091794232 12:3288216-3288238 TGGTCGGCTCTGAAAGTGCAGGG - Intergenic
1093096356 12:14976199-14976221 TTGTAGGTTCTGAGACTGGAAGG + Intronic
1096525858 12:52209904-52209926 GGGCAGGTTCTGAAAGGGGAGGG - Intergenic
1096589095 12:52645364-52645386 TTGGAGGTTCTGGAGGTAGAGGG - Exonic
1097907614 12:64936551-64936573 TTCTATGTTCTGAAAGAGAAAGG + Intergenic
1098285137 12:68899162-68899184 GTGTGGATTCAGAAAGTGGAAGG + Intronic
1098917397 12:76271935-76271957 TTGCAGGTGGTGGAAGTGGAAGG + Intergenic
1100237272 12:92673319-92673341 TTTTAGGATATGATAGTGGATGG - Intergenic
1100804713 12:98270244-98270266 TTGTAGGTTTTCAAATTGGTTGG - Intergenic
1100901346 12:99244201-99244223 TTGTTAGATCTGAGAGTGGAAGG + Intronic
1101412899 12:104483910-104483932 CTGTAGCTTCTGCAAGTAGAGGG + Intronic
1103196847 12:119051497-119051519 TAGAGGTTTCTGAAAGTGGAGGG + Intronic
1103574043 12:121863862-121863884 TTTCAGGTTCAGGAAGTGGAAGG - Intergenic
1105121122 13:16781843-16781865 TTGTAGTATATGGAAGTGGACGG + Intergenic
1105528831 13:21200126-21200148 TGGTAGGTTCTGAACCTGCATGG - Intergenic
1105821375 13:24084013-24084035 TTGCCTATTCTGAAAGTGGAAGG + Intronic
1105830134 13:24156926-24156948 TTGTTGGTTGTGAAGGTGGCAGG - Intronic
1105856538 13:24377725-24377747 TTCTACTTTCTGAAATTGGAAGG - Intergenic
1106562632 13:30859829-30859851 TCGTAGGTGCTGAAAGAGCATGG + Intergenic
1106687118 13:32072126-32072148 ATGTAGATTCTGAAACTTGAAGG + Intronic
1108459593 13:50652017-50652039 TTGTGGCCTCTGGAAGTGGAGGG + Intronic
1117221193 14:53608353-53608375 CTGGAGGTTCTGAAACTGGTTGG + Intergenic
1117930736 14:60838531-60838553 TTCTAGTTTCTAAAGGTGGAAGG + Intronic
1119535376 14:75398844-75398866 TTGTAGGTCCTGAAATGGAAAGG - Intergenic
1122031919 14:98918676-98918698 TTGGAGGCTCTGAAAATGCAAGG - Intergenic
1122106007 14:99455463-99455485 TTGTAGGTTCTTAAAAAGAAGGG + Intronic
1125045055 15:35235707-35235729 TTTTAGCTTTTGAAAATGGAGGG + Intronic
1125365081 15:38904952-38904974 TTGTAGGTTTTGAAGGTAGGAGG + Intergenic
1125602504 15:40923357-40923379 TTGTAGGGTCAGAGAATGGAGGG - Intergenic
1128962889 15:72026520-72026542 TTCTAGTTTCTTAAGGTGGATGG - Intronic
1129320410 15:74771619-74771641 TTCTAGATTCTGAAAGAGGCAGG + Intergenic
1130132453 15:81155558-81155580 TTGTAGGTTCTGACACTCTATGG - Intergenic
1133260059 16:4543325-4543347 TGGTAGGATATGAAAGAGGAGGG + Intergenic
1133498326 16:6341276-6341298 TTGTCGGCTTTGAAAATGGAAGG - Intronic
1136627866 16:31472746-31472768 TTCTGGGTTCTGGAAGTGAAAGG + Intronic
1140171187 16:72606642-72606664 TTGTAAGTTTTGAAATTGGAAGG - Intergenic
1141293291 16:82741113-82741135 TTTTGGGTTGTGAAAGTGGAAGG - Intronic
1141296358 16:82773360-82773382 ATGAAGGGTCTGGAAGTGGAAGG + Intronic
1141555735 16:84835528-84835550 CTGTTGGGTCTGAAAGTGGTTGG - Intronic
1141622159 16:85242049-85242071 TTGCAGCTCCTGAGAGTGGAGGG - Intergenic
1142231479 16:88902161-88902183 TTCTAGCATCTGAAAGTGGAAGG - Intronic
1143584856 17:7845983-7846005 TTGAAGGTTCTGGGAGTGGGAGG + Intronic
1147791062 17:43014576-43014598 TTGTTGCCTCTGAGAGTGGAGGG - Intergenic
1148436549 17:47690211-47690233 TTCTAGGGTCTGGAACTGGAGGG + Intergenic
1149341331 17:55689261-55689283 ATGAAGGAACTGAAAGTGGATGG - Intergenic
1150198598 17:63328302-63328324 TTTTAGGTTCAGAAAGTACATGG - Intronic
1150854447 17:68737610-68737632 TTGTAGGTTAAGAAAAAGGATGG - Intergenic
1152102671 17:78311784-78311806 TTGTGGGATTGGAAAGTGGAAGG - Intergenic
1153778823 18:8476791-8476813 TCTTAGGTTCTAAAGGTGGAGGG - Intergenic
1156048713 18:32906605-32906627 TTGACAATTCTGAAAGTGGATGG - Intergenic
1156114981 18:33776632-33776654 TTGTAGCCTCTGAAAAAGGAAGG - Intergenic
1157498138 18:48170945-48170967 TTGTGGGATCAGAAAGTGAAGGG - Intronic
1158415971 18:57250124-57250146 TTTTAGGTTCTGTCAGTGGATGG + Intergenic
1159753617 18:72335249-72335271 TTGGAGTTTCTGAAAGTGAATGG - Intergenic
1159958993 18:74541109-74541131 TTGTAGGTTCTGAAAGTGGAGGG + Intronic
1160120257 18:76123749-76123771 TTGTTGCTTCTGAAAGTCCAAGG + Intergenic
1160440057 18:78882931-78882953 TTGTAGATTGTGAAAATGGTCGG - Intergenic
1162330141 19:10023031-10023053 TTGTATATTCTTAAAGAGGAAGG + Intergenic
1164342007 19:24412053-24412075 TTGTAGAATCTGCAAGAGGATGG + Intergenic
929652516 2:43695388-43695410 ATGTTGGGCCTGAAAGTGGAAGG + Intronic
929766361 2:44847211-44847233 GTGGAGGTTCTGAAGATGGATGG - Intergenic
931084108 2:58809931-58809953 CTGTAGTTTTTGGAAGTGGAGGG + Intergenic
931724714 2:65098240-65098262 AAGTAAGTACTGAAAGTGGATGG - Intronic
932172430 2:69569288-69569310 TTGTAGATTCTACAAGTGGTGGG - Intronic
933049406 2:77584376-77584398 TTGTGGCTTATGAAAGTGGAAGG + Intronic
933279490 2:80317372-80317394 TTGTATATTCTGAAAGTGGAAGG - Intronic
934039934 2:88119602-88119624 TTGTAGGTTATGACAGAGTATGG + Intergenic
934368196 2:92698179-92698201 TTGTGGAATCTGCAAGTGGATGG + Intergenic
934378244 2:92859088-92859110 TTGTGGAATCTGCAAGTGGATGG + Intergenic
934437987 2:93821716-93821738 TTGTGGAATCTGCAAGTGGATGG + Intergenic
934441542 2:93878788-93878810 TTGTGGAATCTGCAAGTGGATGG + Intergenic
935386890 2:102509259-102509281 TTGCAGGCTCTGAAGATGGAAGG - Intronic
935921050 2:108015476-108015498 TTTTGGGTTCTGAAAATGGACGG + Intergenic
936596819 2:113856012-113856034 ATGAAGATTCAGAAAGTGGAAGG + Intergenic
936666178 2:114598354-114598376 TTTTAGGTTGGGAAAGAGGATGG + Intronic
938368112 2:130751321-130751343 TGATAGGTTCTGAAACTGGTTGG - Intergenic
938744226 2:134261710-134261732 ATGTAAGTTCTGAAAGAGGAGGG + Intronic
939178418 2:138778995-138779017 TTGCAAGTTCTGAGGGTGGAAGG - Intronic
941327226 2:164131416-164131438 TTGGAGGTTCGGGGAGTGGATGG - Intergenic
943510340 2:188818560-188818582 TTCTAGATTCTGAAAGTAAATGG - Intergenic
944515296 2:200507046-200507068 TTGAAGTTTCTGAAAGTGTTGGG - Exonic
1169080141 20:2793384-2793406 TTCTAGGCACTTAAAGTGGAGGG - Intergenic
1169731303 20:8788073-8788095 ATGTAGGTTCTGAAAATGTAGGG + Intronic
1171200841 20:23241018-23241040 AAGAAGGTTCTGGAAGTGGATGG + Intergenic
1171378888 20:24717509-24717531 TTCTAGTTTCTTAAGGTGGATGG + Intergenic
1171576971 20:26339867-26339889 TTGTAGAATCTGCAAGTGGATGG + Intergenic
1172813000 20:37663747-37663769 TTATATGGTCTGAAAATGGAGGG - Intergenic
1172833952 20:37860541-37860563 GTGTAAGTTCTGGAACTGGAGGG - Intronic
1173357532 20:42308050-42308072 CTATATGTTCTGAAAGTGGGAGG + Intronic
1176689698 21:9890086-9890108 ATGTTGGTTCTTAAGGTGGAAGG - Intergenic
1177583501 21:23058914-23058936 TTGCTGGTTTTGAAAATGGAAGG + Intergenic
1179145950 21:38767577-38767599 CTGTGGAGTCTGAAAGTGGAGGG - Intergenic
1179520185 21:41938488-41938510 ATGCAGGTTCTGGAGGTGGATGG - Intronic
1179797771 21:43795216-43795238 TTGAAGGTTCTGAAGATGCAAGG + Exonic
1180849524 22:19007873-19007895 GAGTAAGTTCTCAAAGTGGAGGG + Intergenic
1184249551 22:43252399-43252421 TTGCAGGTTCTGCCAGGGGACGG + Intronic
1184905148 22:47477999-47478021 TAGTAAGTTTTGAAATTGGAAGG + Intronic
950156128 3:10723042-10723064 TGGAAGCTGCTGAAAGTGGAAGG + Intergenic
950482352 3:13252230-13252252 TTGTAGAGACAGAAAGTGGAAGG - Intergenic
951656717 3:25017214-25017236 GTTTAGGTTCTGAAAGGGGGGGG - Intergenic
953297471 3:41734803-41734825 TTGAAGGTTCTGACTGTGAATGG - Intronic
954950238 3:54466012-54466034 TTGGTGGTTTTGAAGGTGGAGGG - Intronic
954961963 3:54573987-54574009 CTGCAGGTTCTTAAAGTGCAGGG + Intronic
956293814 3:67690635-67690657 CTGAAGGTTCTGAAAGGGGGTGG + Intergenic
956314503 3:67919515-67919537 TTGGAGACTCTGAAAGTGGGAGG - Intergenic
956524775 3:70145773-70145795 TTCTAGTTTCTTAAGGTGGAAGG - Intergenic
959083046 3:101822738-101822760 TTTTATGTTCTGAAATTTGAGGG + Exonic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965167609 3:165215934-165215956 TTGTTGTTTCTGAATGTGAACGG - Intergenic
965539225 3:169855564-169855586 TTACAGGTTCTGTAAGTTGAAGG + Intronic
965883190 3:173411936-173411958 TTGTATTTTCTGAAAGAGAATGG + Intronic
966645357 3:182240537-182240559 TTGTAAGTACAGAAAATGGAGGG + Intergenic
969591163 4:8122682-8122704 ATGTAGGGTCTGACAGTGGATGG - Intronic
969611625 4:8230648-8230670 TTCTAGTTTCTTAAGGTGGAAGG + Intronic
970247430 4:14078032-14078054 TTGTATCATCTGAAAGTTGATGG - Intergenic
972074772 4:35073227-35073249 TTTTAGGTTCAGAAAGTACAAGG + Intergenic
972708073 4:41565129-41565151 TGGTAGGTTGTGAAAGTGATGGG + Intronic
974391124 4:61270254-61270276 TTGTAGGCTCTGTAAGTGCCAGG + Intronic
975218662 4:71787814-71787836 TTCTAGCTTGTGCAAGTGGATGG + Intronic
976427677 4:84924823-84924845 GTGTAGGTTCTGTAGTTGGAAGG - Intronic
981041821 4:140230184-140230206 TGGTAGGCTCTGAAAATAGAGGG + Intergenic
983994424 4:174164075-174164097 TTGTTGGATCAGAAACTGGAAGG - Intergenic
989925226 5:49865354-49865376 TTGTAAGATCTGCAAGCGGATGG + Intergenic
989933678 5:49991052-49991074 TTGTAAGATCTGCAAGCGGATGG + Intergenic
990214541 5:53515485-53515507 TTGTTGGCTCTGAAATTGGAAGG - Intergenic
991471218 5:66970944-66970966 CTGGAGGTTTTGAAAGTGAAAGG - Intronic
991561289 5:67956195-67956217 TTATATGTTCTGAGAGAGGAAGG - Intergenic
991565675 5:68001795-68001817 CTGGAGGTACTGAGAGTGGAAGG - Intergenic
992173028 5:74122865-74122887 TTGATGGTGCTGAAAGGGGATGG + Intergenic
992217543 5:74540767-74540789 TTATAGATCCTGAAAGTGGGTGG + Intergenic
992658469 5:78933972-78933994 TTAAAGGCTCTGAAGGTGGAAGG + Intronic
994157947 5:96524348-96524370 GTGAAGTATCTGAAAGTGGAAGG + Intergenic
994988992 5:106974651-106974673 TTGAAGGTTCTGCAAGGAGAGGG + Intergenic
995063268 5:107834706-107834728 CTGCAGCTTCTGACAGTGGAAGG - Intergenic
996325033 5:122263058-122263080 TGGTAGGCTCTGAAAAGGGAGGG - Intergenic
997639907 5:135442362-135442384 TTCTGGATTCTGTAAGTGGAAGG + Intergenic
999870266 5:155742578-155742600 TTGTAACGTCTGAACGTGGAAGG - Intergenic
1002003312 5:176211653-176211675 TTCCAGTTTCTTAAAGTGGAAGG + Intergenic
1003539626 6:7007038-7007060 TTGTAGGTCATGAAACAGGAAGG - Intergenic
1004352497 6:14902626-14902648 CTGTAGGTTCTGACACTGGTGGG - Intergenic
1004772464 6:18799385-18799407 TGTTAGGCTCTGAAAGTGGCTGG - Intergenic
1006279163 6:33033520-33033542 TTCTAATTTCTTAAAGTGGAAGG + Intergenic
1008551131 6:52632185-52632207 TTGTGGTTGCTGAGAGTGGAGGG - Intergenic
1008646116 6:53516679-53516701 TGGTAGGCTCTGAATCTGGAAGG + Intronic
1008946677 6:57105133-57105155 TTGCAGGTTCTGAACATGGCAGG - Intronic
1011693402 6:89890369-89890391 TTGAAGGTGATGAGAGTGGACGG - Intergenic
1014031560 6:116711395-116711417 TTGTAATTTCTGAAGGTGGAAGG + Intronic
1015233573 6:130944671-130944693 TGGTAGGGTCAGAAACTGGAAGG + Intronic
1016128313 6:140434047-140434069 TTGTTGCTTCAGAAAGTGCAAGG + Intergenic
1018526213 6:164712572-164712594 TAGAAGCTTCTGAAAGTGAAAGG + Intergenic
1018918840 6:168156764-168156786 TTGCAGGTGCTGAATGTAGACGG - Intergenic
1027535361 7:79392969-79392991 TTGGAATTTCTGAGAGTGGAGGG - Intronic
1028481301 7:91308814-91308836 TTCTAGTTTCTTAAGGTGGAAGG - Intergenic
1028797169 7:94916406-94916428 TTCTGGCTTCTGAAAGTGGCTGG + Intronic
1028858922 7:95625105-95625127 TTGCAGTGTCTTAAAGTGGAAGG - Intergenic
1030017645 7:105240637-105240659 TTGTAGTTTCAGAAAGTACAAGG + Intronic
1030510642 7:110478938-110478960 GTGAAGGTTCGGAAAGTGGTTGG - Intergenic
1031015794 7:116575119-116575141 TTGTAAGTTCTCAAAATGGAGGG + Intergenic
1031611368 7:123831788-123831810 CTGTAGATTCTGAAAGTGGTTGG + Intronic
1032930910 7:136669220-136669242 TTGTAGTTATTGAAATTGGATGG + Intergenic
1033880982 7:145883541-145883563 TAGTAGTTTCTGAAATTGGAAGG - Intergenic
1034013748 7:147559202-147559224 TTGTAGATTGAGAAAGTGGCTGG + Intronic
1034565605 7:151912211-151912233 TTGTAGGGACTGCAAGTTGAAGG + Intergenic
1037324217 8:17672614-17672636 GTTTTGGTTCTGTAAGTGGAGGG - Intronic
1038395034 8:27240320-27240342 TGGAAGGCTCTGAAAGTGGTGGG - Intronic
1038631260 8:29246681-29246703 TAGTAAGTTTTGAAATTGGAGGG - Intronic
1038920674 8:32080578-32080600 TTGGAAGCTCTGAGAGTGGAAGG - Intronic
1039668030 8:39558210-39558232 TTGTAGGTTCTGAATATAGTTGG + Intergenic
1043527335 8:81111559-81111581 CTGTAGTTTCTGAAGTTGGAGGG - Intronic
1046234258 8:111402311-111402333 TTGGAGGCTCTCAAAGTGCAGGG - Intergenic
1048954799 8:139526825-139526847 TTGTAGGTTCTTAAAATGGCAGG + Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051787587 9:20762286-20762308 TTTTAGTTTCCGAAAGTAGAAGG + Intronic
1051983474 9:23053100-23053122 TTATAGGTTCTGAGAGTTGTGGG + Intergenic
1056024712 9:82481754-82481776 TTGGAGTTTCAGAAAGTAGATGG - Intergenic
1057295553 9:93835432-93835454 TTCCAGGTTCTTAAGGTGGAAGG + Intergenic
1057363887 9:94400385-94400407 TTTTAGGTTTTAAAACTGGAAGG + Intronic
1057659448 9:96987689-96987711 TTTTAGGTTTTAAAACTGGAAGG - Intronic
1061465821 9:130778651-130778673 CTGGGGGATCTGAAAGTGGATGG - Intronic
1203417718 Un_KI270364v1:1653-1675 TTGTAGAATCTGCAAGAGGATGG - Intergenic
1186824221 X:13322211-13322233 TTTTAGGTGCTGTCAGTGGATGG + Intergenic
1189201865 X:39203394-39203416 TTCTGGGTGCTCAAAGTGGAGGG + Intergenic
1190785933 X:53648961-53648983 GTCAAGTTTCTGAAAGTGGAAGG + Intronic
1192609117 X:72550057-72550079 TTGTAGTTTCAGAAAGTATAAGG - Intronic
1193036905 X:76961057-76961079 TTGTGCTTTCTGCAAGTGGATGG - Intergenic
1193989180 X:88284960-88284982 TTGTTGGTTTTGAAGATGGAAGG + Intergenic
1194269102 X:91787939-91787961 TTATAGACTCTGAGAGTGGAAGG + Intronic
1195455516 X:105064820-105064842 TTGAAGGATGTGAAGGTGGAAGG + Intronic
1195573905 X:106427805-106427827 TTTCAGGTTCTGAGAGTGGTGGG + Intergenic
1195646750 X:107239597-107239619 TTATAGGTACTGATAATGGAAGG - Intronic
1196134126 X:112188650-112188672 TTGGAGTCACTGAAAGTGGAAGG - Intergenic
1196562080 X:117161637-117161659 TTGTATGTTCTCAAAATTGATGG + Intergenic
1196700735 X:118665208-118665230 TTGTAGGTTCTGAGGGTAAAAGG - Intronic
1196769031 X:119274390-119274412 TTATATCTTTTGAAAGTGGAAGG + Intergenic
1199713236 X:150487132-150487154 TCAGAGGTTCTCAAAGTGGAAGG - Intronic
1200583798 Y:4981983-4982005 TTGCAGGCTCTGAAGATGGAGGG - Intergenic
1200586318 Y:5008948-5008970 TTATAGACTCTGAAAGTGGAAGG + Intronic