ID: 1159959940

View in Genome Browser
Species Human (GRCh38)
Location 18:74547522-74547544
Sequence CAGGCATCCCTAAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159959940_1159959948 26 Left 1159959940 18:74547522-74547544 CCATCCTCCTTTAGGGATGCCTG 0: 1
1: 0
2: 0
3: 20
4: 193
Right 1159959948 18:74547571-74547593 GTCCTTCATTAAAGTATCCCAGG 0: 1
1: 0
2: 2
3: 8
4: 88
1159959940_1159959944 -7 Left 1159959940 18:74547522-74547544 CCATCCTCCTTTAGGGATGCCTG 0: 1
1: 0
2: 0
3: 20
4: 193
Right 1159959944 18:74547538-74547560 ATGCCTGCTCCTTTCCTGGCAGG 0: 1
1: 0
2: 1
3: 30
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159959940 Original CRISPR CAGGCATCCCTAAAGGAGGA TGG (reversed) Intronic
900639930 1:3683856-3683878 CAGGGACCCCCAAAGGAAGATGG + Intronic
900962871 1:5936932-5936954 CAAGCATCCCTGTAGGAGCAGGG + Intronic
901178933 1:7326524-7326546 CTGGTATCCTTAAAGGAAGAGGG + Intronic
901248385 1:7752253-7752275 CGGGCATCACTAGAGGAGAAAGG - Intronic
902789207 1:18753991-18754013 CTGGCTTCACAAAAGGAGGAAGG - Intergenic
904834051 1:33323592-33323614 CAGGCATTCCTAGGGGAGAAAGG + Intergenic
904908394 1:33915304-33915326 CAGGGATCCATAAAGGAGAGGGG + Intronic
906479215 1:46189298-46189320 GAGCCACCCCCAAAGGAGGAGGG - Exonic
907677892 1:56535626-56535648 CTGACATCCCTTAAGGAGAAAGG + Intronic
907846732 1:58215314-58215336 CAGGCATCTCTGAGGGAGGGAGG - Intronic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
913280564 1:117181436-117181458 CAGGGATTCCTAAAGGGAGAAGG - Intronic
914242722 1:145862900-145862922 CTAGCATCCCTACAGGATGACGG + Intergenic
915494886 1:156274983-156275005 AAGGCTTCCAAAAAGGAGGAAGG + Intronic
915542372 1:156575966-156575988 CAGGCTTCCCTTAAGAAGGGAGG - Intergenic
915762556 1:158329640-158329662 CAGGCTTCACTAAGGCAGGAAGG + Exonic
915847086 1:159277745-159277767 TGGGAATCCCTAAAGGTGGAAGG - Intergenic
916143581 1:161721271-161721293 CAGGCACTCCTAAAGCAGGCAGG + Intergenic
917143910 1:171867161-171867183 CAGGGCTCCCTAAAGGATAAAGG + Intronic
917321935 1:173791699-173791721 CAGCCATCCCCAATAGAGGAAGG + Intergenic
918105438 1:181412225-181412247 CAGGCATTAAAAAAGGAGGAAGG + Intergenic
918344547 1:183595208-183595230 CAGGAAACCCTGAAGGAGGCAGG + Intronic
919260901 1:195192006-195192028 CTGGCATCCCTGAAAGAGAAGGG + Intergenic
920172306 1:204079720-204079742 AGGGCATTCCTAAAGCAGGAAGG - Intronic
920313549 1:205062246-205062268 CAGGCCTCCCCAAAGCTGGAAGG - Intronic
920632620 1:207667447-207667469 CAGGGATCCTTATAAGAGGAAGG - Intronic
921140633 1:212302744-212302766 AAGGAATCCCTAAAGGAATAGGG - Intronic
922555376 1:226528445-226528467 CAGGCAGCCCTTAAAGAGAAGGG - Intergenic
924053936 1:240106184-240106206 AAGGCATCCCAAAAGGCAGAAGG - Intronic
924495514 1:244585004-244585026 AAGGCATCCATAAAGGAAGAGGG - Intronic
1067441938 10:46313411-46313433 CAGGCATCTGCAAAAGAGGACGG + Intronic
1069200465 10:65608718-65608740 TAGGGATTCCAAAAGGAGGAAGG + Intergenic
1069541276 10:69295956-69295978 CATGCATCCCCAAGGCAGGAAGG - Intronic
1069731002 10:70613293-70613315 CAGTCAACCCAAAAGAAGGAAGG - Intergenic
1072046928 10:91666633-91666655 CAGACCTCCCTGAAGAAGGAGGG - Intergenic
1072428702 10:95352445-95352467 CTTGCACCCCTAAAGGAGGGTGG + Intronic
1073455455 10:103634135-103634157 CAGGGATCCCGGATGGAGGATGG - Intronic
1076039036 10:127227290-127227312 CAGGCATCCTTAATGGTGGTAGG - Intronic
1083476211 11:62917283-62917305 CTAGAATCCCTAAAGAAGGAGGG + Intronic
1085709912 11:78819912-78819934 CTGGCTTCCCCAGAGGAGGATGG + Intronic
1086607563 11:88714341-88714363 CAGGCATGCATAAAGGTGGTGGG + Intronic
1086675149 11:89596562-89596584 AAGGCTTCCCTAAAGGAGTGAGG - Intergenic
1087024043 11:93632278-93632300 AAGGCATGCGTAAAGGAGAATGG + Intergenic
1089100830 11:115961239-115961261 CAGGCATTGCTAAGGGATGAAGG - Intergenic
1089220110 11:116863629-116863651 CAGGCATCCCTGGAGGAGCATGG - Intronic
1089742574 11:120594911-120594933 CCGACACCCCTAAAGCAGGAAGG - Intronic
1092096480 12:5846763-5846785 CAGGTATCCCTATAAGAGAAAGG - Intronic
1092103922 12:5907543-5907565 TAGGCATCCCCAAAGGGAGAAGG - Intronic
1092731836 12:11542094-11542116 CTGGCAACCCTAAAAGAGAAGGG + Intergenic
1096225614 12:49865134-49865156 CAGGTATCCTTCTAGGAGGACGG + Intergenic
1098810162 12:75077883-75077905 CAGGCATCCCAAAAGGAGAGTGG + Intronic
1100854172 12:98743700-98743722 CAGGCATCTCTAAAAGAGAAAGG - Intronic
1101212312 12:102546831-102546853 CAGGTATCCTGAAAGGAGGGTGG + Intergenic
1103889140 12:124225422-124225444 CAGGCATCCCTAACAGAAAATGG + Intronic
1103989417 12:124788491-124788513 CAGGCATCTGAAAGGGAGGAGGG - Intronic
1106524325 13:30526917-30526939 CAGACATTCCTAATGGAGCACGG - Intronic
1108171474 13:47746186-47746208 CAGGCATCTCCACAGGAGGATGG - Intergenic
1110324417 13:74197851-74197873 CAGTCATCCCTCCAGGAGGAGGG + Intergenic
1110508185 13:76314779-76314801 CAGGCAACTATAAAGGGGGAAGG - Intergenic
1111981502 13:95020841-95020863 CATGCAACTCTAAAGGAGGATGG + Exonic
1113555180 13:111228134-111228156 CTGGCATCCAAAAAAGAGGAGGG + Intronic
1113903316 13:113807957-113807979 CAGGCCTCCCCAGAGGAAGAGGG - Intronic
1117200133 14:53381737-53381759 CAGGCATCAGCAAAGGAAGAAGG - Intergenic
1118476511 14:66122080-66122102 CCAGCCTACCTAAAGGAGGACGG - Intergenic
1118793277 14:69115675-69115697 CAGGCATCATTAAAGGATGTGGG - Intronic
1120873710 14:89360235-89360257 CAGCTGCCCCTAAAGGAGGAAGG + Intronic
1121836399 14:97096420-97096442 CAAGCATCCTTAAATGTGGAAGG + Intergenic
1127809248 15:62549172-62549194 CAGGGAGCCCTACAGGAAGAAGG - Intronic
1132710856 16:1266603-1266625 CAGGCATCCTTATAAGAGAAAGG + Intergenic
1132810438 16:1794311-1794333 CAGGCATTCCTAGAAGAGGCTGG - Intronic
1134075156 16:11285591-11285613 AAGACATCACCAAAGGAGGAAGG + Intronic
1135114503 16:19713489-19713511 CAGCCACCCCCAAAGGAAGAAGG - Intronic
1135963652 16:27018354-27018376 CAGGCAAAGCTAAAGGAAGAAGG + Intergenic
1137230842 16:46565682-46565704 CAGAAATGCTTAAAGGAGGAAGG + Intergenic
1137926798 16:52547567-52547589 CAGGCACCCATGAAGAAGGAAGG - Intronic
1138613716 16:58147764-58147786 CAGGCAGCACTGAGGGAGGAGGG - Intergenic
1139121666 16:64026087-64026109 CAGACATCCTTCAAGGAGCAAGG - Intergenic
1140135050 16:72198524-72198546 CAGCCATTCGGAAAGGAGGAGGG - Intergenic
1141185133 16:81781560-81781582 CAGGTTGCCCTAAAGGAGCAGGG + Intronic
1141185320 16:81782922-81782944 CAGGTTGCCCTAAAGGAGCAGGG - Intronic
1141739858 16:85883969-85883991 CAGCCATCATTAGAGGAGGAAGG - Intergenic
1142658819 17:1413374-1413396 CAGGCAGCCCTGCTGGAGGATGG + Intergenic
1144209926 17:13005505-13005527 CATGCACCCTTTAAGGAGGACGG + Intronic
1146464621 17:33076353-33076375 CAGGCTCACATAAAGGAGGAGGG - Intronic
1146647255 17:34583475-34583497 CAGGCAGCCCTGGAGGAGGAGGG - Intronic
1146795744 17:35779304-35779326 CAGGCATTCCTAGAGAAGTACGG - Exonic
1146970048 17:37065262-37065284 CAGGCCTCCCCACAGGAGAAAGG - Intergenic
1149388896 17:56170260-56170282 CAGGTATCCCTGAAGGGGCAGGG - Intronic
1151662149 17:75524950-75524972 CAGGCTTCCCGAAGGGAGGAGGG + Intergenic
1152340078 17:79719547-79719569 CAGGCTTCCAGAGAGGAGGAAGG + Intergenic
1153932203 18:9887857-9887879 GAGGCATCACTGAAGGAGGCCGG + Exonic
1154370814 18:13761784-13761806 CAGGCAAAGCTCAAGGAGGAAGG - Exonic
1155677982 18:28453261-28453283 CAGGCAACCCTTAAAGAGAAGGG - Intergenic
1156067120 18:33156848-33156870 CAGGCATTGCTATAGGAGCAGGG - Intronic
1156540600 18:37906102-37906124 CAGGCATCCCACAGTGAGGAAGG - Intergenic
1157803361 18:50638981-50639003 CAGGCCTCCACAGAGGAGGAAGG + Intronic
1158978040 18:62730356-62730378 CAGACATCCCAAAATGTGGAGGG - Intronic
1159403051 18:67961846-67961868 CAGGCATCCTTAAAGTGGGAAGG - Intergenic
1159959940 18:74547522-74547544 CAGGCATCCCTAAAGGAGGATGG - Intronic
1160058286 18:75507018-75507040 CAGTCATCCCTGAGAGAGGAAGG + Intergenic
1161680978 19:5679659-5679681 CAGGCAGCCCTACAGAAGGCTGG - Exonic
1163536831 19:17881780-17881802 GAGACATCCCTACAGGAGCAAGG - Intronic
1163566955 19:18057671-18057693 CAGGCATCCCCACGGTAGGAAGG + Intergenic
1165843276 19:38802223-38802245 TCTGAATCCCTAAAGGAGGAGGG + Intronic
925337179 2:3107144-3107166 CAGGGCACCCTAAAGGTGGATGG - Intergenic
925337225 2:3107343-3107365 CAGGGCACCCTAAAGGTGGATGG - Intergenic
926046727 2:9715449-9715471 CAAGCAACCCTAGAGGAGGTGGG - Intergenic
926115635 2:10211386-10211408 CAGGCAAGCCGAGAGGAGGACGG + Exonic
926757549 2:16248554-16248576 CAGGGAACCCAAAAGCAGGAAGG + Intergenic
929587825 2:43127219-43127241 CAGGGAGCCCTATCGGAGGAGGG - Intergenic
929625264 2:43400193-43400215 CTGGCATCCATACAAGAGGAAGG + Intronic
934094744 2:88590355-88590377 CAGGCACTCCTGAAGTAGGAAGG + Intronic
935128208 2:100242346-100242368 CAGGGATTCCGAACGGAGGAAGG - Intergenic
935360566 2:102243300-102243322 CAGGCCTCCCTAGGGGTGGATGG + Intergenic
935886850 2:107630212-107630234 CAGGCATTCTTATAAGAGGAGGG - Intergenic
939843234 2:147213644-147213666 CAGGAATCTATAAAGGAGAATGG + Intergenic
940275777 2:151939151-151939173 CTGGCATCCAAAAAGCAGGAAGG + Intronic
943564605 2:189503074-189503096 CAGGTCTCCCTGAAGGAAGAGGG - Intergenic
943805707 2:192122483-192122505 AAGCCATTCCTAAAGGAGAAAGG - Intronic
944253998 2:197605924-197605946 GAGGAATCAATAAAGGAGGAGGG - Intronic
945417598 2:209594156-209594178 CAGGCATCCCAGAGGGAGTATGG + Intronic
946445155 2:219733200-219733222 CAGACATCTCTAAAGGAAGAGGG - Intergenic
946780350 2:223188307-223188329 CTGACATTCCTAAGGGAGGAGGG + Intronic
947940552 2:234050994-234051016 AGGGCATCCCTTAAGGAGGATGG - Exonic
949053096 2:241908116-241908138 CAGGCCACCCTAAGGGAGAAAGG - Intergenic
1172299032 20:33835429-33835451 CTGGAGTCCCCAAAGGAGGAGGG - Intronic
1172475904 20:35237420-35237442 CAAGCATCCTTATAAGAGGAAGG - Intronic
1175327029 20:58137033-58137055 CAAGAAACCCTAAAGGAGGGAGG + Intergenic
1176513151 21:7763684-7763706 CAGGCAGCCAAAAAGGAGAAAGG - Intronic
1178647264 21:34394208-34394230 CAGGCAGCCAAAAAGGAGAAAGG - Intronic
1178727901 21:35071285-35071307 CAGGCAGCAGTAAAGGGGGAAGG - Intronic
1180877292 22:19180526-19180548 CAGGCATCCTTACAGCAGGGAGG + Intronic
1182321673 22:29481782-29481804 CCAGCTTCCCTAAAGGAGAAAGG - Intronic
1182962602 22:34489664-34489686 AAGCCATCCCTAAAGGTGGCTGG + Intergenic
1184413124 22:44337275-44337297 CAGGCATCCTTATAAGAGGGAGG - Intergenic
1184951186 22:47843646-47843668 GAGGCACCCCTGGAGGAGGACGG + Intergenic
1184976651 22:48066991-48067013 CAGGCATCCTTACAAGAGGGGGG + Intergenic
949984850 3:9532678-9532700 AAGGCCTCCCTAAAAGAGGATGG - Intronic
950510778 3:13425130-13425152 CAGGCATCACTAGAGGATGATGG + Intergenic
950562592 3:13743385-13743407 CAGGGACTCCAAAAGGAGGAGGG - Intergenic
950702363 3:14759333-14759355 GAGGCATCCAGAAAGAAGGAGGG + Intronic
952828253 3:37541834-37541856 CAGGCACCGCTAAAGGTAGAGGG - Intronic
953072308 3:39533119-39533141 CAGGCAACCCCAAAGATGGAGGG + Intergenic
954453857 3:50586411-50586433 CAGCTATGCCTAAAGGGGGAGGG + Intergenic
955087494 3:55717460-55717482 GAGGCATCCCTGAGGGAGAAAGG - Intronic
955596418 3:60595255-60595277 CAGGCATCAAGAAAGTAGGATGG + Intronic
955921495 3:63961403-63961425 CAGACATTCCCAAAGAAGGACGG - Intronic
956952020 3:74293812-74293834 CATGCATCCCTAAAGAATGGAGG - Intronic
959449696 3:106483571-106483593 CAGGGATCACTAAATGGGGAAGG - Intergenic
960960653 3:123068010-123068032 CAGGCATCCCTGAGAGAGGTCGG + Intronic
962396172 3:135016965-135016987 CAGGCATCCCTGAAGCTTGAAGG + Intronic
963056522 3:141190721-141190743 GAAGCATCCCGAGAGGAGGATGG - Intergenic
968511110 4:996349-996371 AAGGTCTCCCTAAAGGAGGCAGG + Intronic
975446808 4:74474967-74474989 AATGCATTCCTAAAGCAGGAGGG + Intergenic
977670876 4:99693392-99693414 CACACATCCCCAGAGGAGGAGGG - Intergenic
981084688 4:140670986-140671008 TATGCAGCACTAAAGGAGGAAGG + Intronic
982541606 4:156679064-156679086 CAGGAATGCCCAAAGGAGAATGG - Intergenic
984869301 4:184312496-184312518 CAGTCATTCCTAAAGGAAGGAGG - Intergenic
984962159 4:185108381-185108403 CCGGAATTCCAAAAGGAGGAGGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987194662 5:15514387-15514409 CAGGTATTCCTAATGGGGGAGGG - Intronic
990888826 5:60625699-60625721 TTGGAATCCCTGAAGGAGGAGGG - Intronic
992085389 5:73273805-73273827 CAGGAATTCGTAAAGGAGCAGGG - Intergenic
997302959 5:132819807-132819829 CAGGCAGCCAGGAAGGAGGATGG + Intergenic
997649854 5:135508421-135508443 CAGACATCCCGAAAGGAGTTTGG + Intergenic
999875065 5:155796053-155796075 CAGGCATCCCTAAATCAATAAGG + Intergenic
999975531 5:156908414-156908436 CAGGCTTCTCTAAAGGAGAGTGG + Intergenic
1001547060 5:172576903-172576925 CAGGAAGGCCTAAAAGAGGAGGG + Intergenic
1001875261 5:175194824-175194846 CAGGCAGCCCAGAAGGAGGGAGG + Intergenic
1002829714 6:808702-808724 CATGTATCCCTGAAGGATGAAGG - Intergenic
1002854642 6:1026290-1026312 AAGACAGCTCTAAAGGAGGAAGG + Intergenic
1005994546 6:30923359-30923381 CAGGCATCCATCGGGGAGGAGGG - Exonic
1006802909 6:36770716-36770738 CAGGCACCGCTAAAGCAGGAGGG - Intronic
1006987425 6:38185166-38185188 CAGCCAGCCCTGAAGGAGGAGGG - Intronic
1007299146 6:40853208-40853230 CAGGCACCCTTAAAGGGGGAAGG - Intergenic
1010025272 6:71207937-71207959 TAGTCATCCTTAAAGGAGAATGG - Intergenic
1011742974 6:90381749-90381771 CAGTCATCCATAAAGGAGCTGGG - Intergenic
1013466982 6:110426494-110426516 CTGGCCTCCCTCCAGGAGGAGGG - Intronic
1013481567 6:110557496-110557518 GAGGCATCGCTAAATGGGGAAGG + Intergenic
1019119306 6:169790577-169790599 CAGGCTTCCCTCACGGAGGCGGG - Intergenic
1021355903 7:19652952-19652974 CTGGCATCCCTGAAGGAGATGGG + Intergenic
1021600389 7:22357683-22357705 CACGCATCCTTAAAGGACGAAGG + Intergenic
1024190332 7:47000198-47000220 TAGGCATCTTTAAAAGAGGAAGG + Intergenic
1024790994 7:52964752-52964774 CCAGCATCCTTAAATGAGGAAGG + Intergenic
1029197279 7:98814403-98814425 CAGGCAGCTCTGAAGAAGGATGG - Intergenic
1029238261 7:99142007-99142029 AATTCATCCCTAAAGCAGGATGG - Intronic
1030447894 7:109670469-109670491 CAGACATCCCTCCAAGAGGATGG - Intergenic
1031081107 7:117257742-117257764 CAGGCATCCCTGAGTGAGAATGG - Intergenic
1032020395 7:128404588-128404610 CAGGCATCCCTAGCGCAGGAAGG + Intronic
1035079692 7:156205502-156205524 CAGGGATCCCCATAGGAGAAAGG - Intergenic
1036948899 8:13122099-13122121 CGGGGATCCTTGAAGGAGGACGG - Intronic
1038560274 8:28570977-28570999 CAGGCATCTCTGAATGAGAAAGG - Exonic
1038998526 8:32953250-32953272 CTGGAATCCCTAACGGAGGTAGG - Intergenic
1039290808 8:36092481-36092503 CTGGCTTTCCTAAAGAAGGAAGG + Intergenic
1040386147 8:46916261-46916283 CAGGCAGCCATCCAGGAGGAAGG + Intergenic
1040834318 8:51716742-51716764 CAGGCATCCCCAAAGGCAGGTGG + Intronic
1042348351 8:67750523-67750545 CAGTCATGCCCAGAGGAGGATGG + Intergenic
1047070688 8:121339911-121339933 CAGGTATCTAAAAAGGAGGAGGG - Intergenic
1047380001 8:124352722-124352744 CAGGCATCTGTATAGGAGGCAGG + Intronic
1056607363 9:88097411-88097433 CAGGCAGGGCTAAAGTAGGATGG + Intergenic
1057417288 9:94876290-94876312 CAGGCATCCTCAATGGTGGATGG - Intronic
1059867758 9:118535675-118535697 CAAAGATCCTTAAAGGAGGAAGG - Intergenic
1061332481 9:129904329-129904351 CAGGCATCCCTAGAGAAGTTTGG + Intronic
1062302828 9:135885083-135885105 CAGGTACCCCGAAAGGAGAAAGG - Intronic
1203769372 EBV:41093-41115 CAGGCAACCGTAAGGGAGGGGGG - Intergenic
1203789650 EBV:144012-144034 CAGGCAACCGTAAGGGAGGGGGG - Intergenic
1186414263 X:9369800-9369822 CTGTCATCCCTGGAGGAGGAGGG + Intergenic
1188152107 X:26689827-26689849 GAGCCATCCTTAAAGGAGTAGGG + Intergenic
1188602826 X:31989964-31989986 TAGGCACTCCGAAAGGAGGAGGG - Intronic
1190523151 X:51300044-51300066 AAGGCTTCCCAAAAGAAGGATGG + Intergenic
1196897721 X:120354015-120354037 CAGGCATCTATAAAGTAGGAAGG + Intergenic
1197034248 X:121854713-121854735 CTGGCATGCATAAATGAGGACGG + Intergenic
1198650625 X:138860232-138860254 CAGGGCTCCCTCAAGTAGGATGG + Intronic
1198975342 X:142329114-142329136 TAGGCATCCCAAAAGGAGTTTGG + Intergenic