ID: 1159962152

View in Genome Browser
Species Human (GRCh38)
Location 18:74563733-74563755
Sequence GCCTCCTAGAAAATAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159962152_1159962157 30 Left 1159962152 18:74563733-74563755 CCCTGGGTTATTTTCTAGGAGGC 0: 1
1: 0
2: 3
3: 16
4: 111
Right 1159962157 18:74563786-74563808 GTAGAGCAGTAAACTGCCAAGGG 0: 1
1: 0
2: 0
3: 14
4: 99
1159962152_1159962156 29 Left 1159962152 18:74563733-74563755 CCCTGGGTTATTTTCTAGGAGGC 0: 1
1: 0
2: 3
3: 16
4: 111
Right 1159962156 18:74563785-74563807 GGTAGAGCAGTAAACTGCCAAGG 0: 1
1: 0
2: 0
3: 12
4: 93
1159962152_1159962154 8 Left 1159962152 18:74563733-74563755 CCCTGGGTTATTTTCTAGGAGGC 0: 1
1: 0
2: 3
3: 16
4: 111
Right 1159962154 18:74563764-74563786 CACTAATATCCATATTTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159962152 Original CRISPR GCCTCCTAGAAAATAACCCA GGG (reversed) Intronic
901423371 1:9165486-9165508 GCCGCCCAGAAAATACTCCAGGG - Intergenic
902099375 1:13973315-13973337 GCCTCCTAGGGAATAAAGCAGGG - Intergenic
906144277 1:43550612-43550634 CCCTCCTAGAACATAACCCTGGG - Intronic
909796747 1:79749039-79749061 GCACTCTAAAAAATAACCCATGG + Intergenic
913555822 1:119966043-119966065 GCCTTCAAGAATATGACCCATGG + Intronic
914939369 1:152009012-152009034 GACTCCTAGACAATAACATAGGG - Intergenic
917958826 1:180126526-180126548 ACATCCTAGAAAAGACCCCAAGG + Intergenic
920718607 1:208365812-208365834 GTCTCCTAGAGAATCAACCATGG + Intergenic
923331761 1:232931760-232931782 GCCTCCTTCAAAAGAACCTAGGG + Intergenic
1065571670 10:27076862-27076884 GCCAACAAGAAAAAAACCCAGGG + Intronic
1070588129 10:77781481-77781503 GCCTCCAAGCACATCACCCACGG + Intergenic
1071711119 10:88050514-88050536 TTCTTCTAGAAAATAACACATGG + Intergenic
1073273714 10:102289589-102289611 GCTTCCTAGGAAATAGCCTAAGG + Intronic
1076838338 10:133032406-133032428 GCCACCTAGAAAGTAACAGAGGG + Intergenic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1079309016 11:19348034-19348056 GACTCCTAGAAAAAAACAAAAGG + Intergenic
1084855203 11:71980058-71980080 GTCTCCTAGAAAATGACACCTGG + Intronic
1088680115 11:112233145-112233167 GCCTCCTAGAGACAAAACCAAGG - Exonic
1090217928 11:124987221-124987243 GGCTTCTAGAAAATAATCCTGGG - Exonic
1090421353 11:126577444-126577466 GCATCCTAGAAACTAACCGCTGG + Intronic
1096346967 12:50857308-50857330 GCTTCCTAGAATTTATCCCAAGG - Intronic
1096881594 12:54677388-54677410 GGCTCCTAGAAGACAACACAGGG + Intergenic
1098189945 12:67937525-67937547 TCCTTTTAGAAAATAACCTAGGG + Intergenic
1100427876 12:94504044-94504066 GCCTCCTAGAAACTGATCAAGGG - Intergenic
1106342771 13:28847152-28847174 GCCTGCCAGAAAATCACCTAAGG + Intronic
1106987826 13:35376624-35376646 GCCTCCTAGAGAATATTCCTTGG - Intronic
1110002907 13:70228589-70228611 GCCTCCTAGAAAATAGAACTAGG - Intergenic
1112293647 13:98167154-98167176 ACCTCCTAGAAAATTGGCCAAGG - Intronic
1119882206 14:78109166-78109188 GCATACTTCAAAATAACCCATGG - Intergenic
1122261922 14:100528568-100528590 GCCTCATAGAAAGAAAGCCAAGG - Intronic
1122773688 14:104108002-104108024 CCCTCCCCGAAAAGAACCCAGGG - Intronic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1126296383 15:47141367-47141389 CCCTCCTTGAAAATAAAACAGGG + Intergenic
1126417839 15:48436974-48436996 CCCTGCTAGAATATAACCAAAGG + Exonic
1128620285 15:69143317-69143339 GTCTCCTAGAAACCAACCCAAGG + Intergenic
1130081001 15:80733358-80733380 GCCTCCTTGAGAATTACACAAGG - Intronic
1130893101 15:88150042-88150064 GCCTCCCTGAACAAAACCCATGG + Intronic
1131596402 15:93802656-93802678 CCCTCCTGGAAATTAACCCCAGG - Intergenic
1143879656 17:10020182-10020204 GCCCCCTAGAAAATCACTCACGG + Intronic
1144552759 17:16255864-16255886 GTTTCCTAGAAAAGAAACCAGGG + Intronic
1146180580 17:30695728-30695750 ACTTCCTGGAAAATAGCCCAGGG - Intergenic
1148758543 17:49987368-49987390 GCCTCCCAGGGAAGAACCCAGGG + Intergenic
1155271072 18:24141702-24141724 GACTCCTAAAAAATCACCTAAGG - Intronic
1158464286 18:57676006-57676028 TGCTCTTAGAAAATAAGCCAGGG - Intronic
1159868388 18:73732701-73732723 ACCTCCTAGAAAATAAAGAATGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1160126393 18:76176299-76176321 GGCTCCTAGAATAGAGCCCAGGG + Intergenic
1163417235 19:17194214-17194236 GCCTCCTAGAAAAAGACCCAAGG + Intronic
1164731532 19:30508606-30508628 GCCTCTTAGAAATTAAACCAGGG - Intronic
1164846124 19:31433956-31433978 GCCTCCATGAAACTAAGCCAAGG - Intergenic
1167255023 19:48422123-48422145 GCATCCCAGAAAATATCCCAAGG - Intronic
926851107 2:17198294-17198316 GCTTCCTTGAAAATTACCCAAGG + Intergenic
928847533 2:35695668-35695690 GCCTTCAAATAAATAACCCAAGG - Intergenic
934646047 2:96059972-96059994 GCCTCCAAGACACTACCCCATGG + Intergenic
934720973 2:96576533-96576555 GCCTACTAGATAATTACCTAGGG + Intergenic
934839451 2:97616062-97616084 GCCTCCAAGACACTACCCCATGG + Intergenic
937195096 2:120147340-120147362 GCCCCTTAGAAAAAAAACCAGGG - Intronic
937469289 2:122161471-122161493 GCCACTTAGAAAAAAACACATGG - Intergenic
939208395 2:139139169-139139191 GCCACCTATAAAATAACCAAAGG + Intergenic
944587210 2:201182943-201182965 GCTTCCTAGAAACGAACCCGTGG - Exonic
944928235 2:204487637-204487659 GCCTCAAAGAGAATAACCCAAGG - Intergenic
948068411 2:235100200-235100222 GCCTTTTAAAAAATAAACCAAGG - Intergenic
1169976383 20:11333339-11333361 GCATCCTAGAAAACCTCCCAAGG + Intergenic
1171228096 20:23458049-23458071 GTCTCCTAGCAATTAATCCATGG - Intergenic
1172852737 20:37978264-37978286 GCCTCACAAAAAATAAGCCAGGG - Intergenic
1176636749 21:9252176-9252198 ACCACCAAGAAAAAAACCCAGGG - Intergenic
1182718386 22:32377961-32377983 GTCTCTGAGAAAATCACCCATGG - Intronic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
955777237 3:62446981-62447003 GTCTCCCAGAAAAGTACCCAGGG + Intronic
956205620 3:66751984-66752006 CCCTCATACAAAATAACCTATGG - Intergenic
956924666 3:73970881-73970903 GCCACTTAGAAAACAAACCAGGG - Intergenic
963848944 3:150188745-150188767 GCCTCCTAGAAGATAACATAGGG - Intergenic
965401244 3:168215335-168215357 CTCTCATAGAAAATAACCCAGGG + Intergenic
965489674 3:169320980-169321002 ACTTACCAGAAAATAACCCAGGG + Intronic
965616103 3:170594011-170594033 GCCTCCTCTACAATAACACAGGG - Intronic
966228148 3:177620270-177620292 GCCTCCCAGAACATAAACGACGG - Intergenic
1202750146 3_GL000221v1_random:152843-152865 ACCACCAAGAAAAAAACCCAGGG + Intergenic
971143331 4:23948529-23948551 GCCTCCTAGAGAGAAACCAAAGG - Intergenic
971706865 4:30056309-30056331 GGGTCCTAGACAATAAGCCATGG + Intergenic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
973828065 4:54729258-54729280 GCCTCCCATAAAAATACCCAAGG - Intronic
974239071 4:59221025-59221047 GCCTCAAAGAAAATAATGCAGGG - Intergenic
974435655 4:61854256-61854278 TCCTACTAGAAAACAACACATGG - Intronic
976611213 4:87032568-87032590 GGCTCCTAGCAAACAACACATGG - Intronic
981268670 4:142818373-142818395 GCCTCTGAGAGAAAAACCCATGG - Intronic
989808690 5:45645492-45645514 GCCACATTGAAAATAATCCATGG + Exonic
990621784 5:57567802-57567824 GCCTCCTAGAGAAGAAAGCAGGG - Intergenic
995022310 5:107380572-107380594 GCCTCCTAGAAAAAAAAAAAAGG + Exonic
995653178 5:114395034-114395056 ACCTTCTAGAAAATAATCCAGGG - Intronic
997558072 5:134818949-134818971 CCCTCCTGGCAAAGAACCCAAGG + Exonic
998135121 5:139670375-139670397 GCCTCTGAGAAACCAACCCAGGG - Intronic
998744303 5:145239675-145239697 GCCTCCTAGTAAGTTATCCATGG + Intergenic
1001114837 5:168930879-168930901 GCCTCCTAGACAATAACCTGTGG + Intronic
1004681990 6:17904915-17904937 GCCTCCTGGAAATTAGCCTAAGG + Intronic
1005267088 6:24123475-24123497 CCCTTCTGGAAAACAACCCAGGG + Intergenic
1007413830 6:41680440-41680462 GCCTCCTAAAAACTAACCTCAGG - Intergenic
1008391754 6:50960036-50960058 ACCTCATGGAACATAACCCAGGG - Intergenic
1008653206 6:53584750-53584772 GCTTCCTAGAATATATCCCTTGG - Intronic
1011383308 6:86766421-86766443 GCCACCTAGACAATAACCCAAGG + Intergenic
1012759021 6:103273244-103273266 GCCCCCTACAGAATAACCAAAGG + Intergenic
1014940179 6:127429046-127429068 GAGTCCTAGAAAATAAGCCTGGG + Intergenic
1015194058 6:130506043-130506065 CCCAACTAGAAAATAACCCAAGG + Intergenic
1016337137 6:143018955-143018977 GCCACCTGGAGAAAAACCCAAGG - Intergenic
1017929748 6:158941456-158941478 GCCTTCCTGTAAATAACCCAAGG + Intergenic
1020924203 7:14303862-14303884 GCCACCATGAAAATTACCCAAGG + Intronic
1020924385 7:14306651-14306673 GCCTCTTAAAAGAAAACCCATGG - Intronic
1023367760 7:39481125-39481147 GACTACTAGGAAAAAACCCATGG + Intronic
1024237662 7:47410107-47410129 GCCTCCTAGGAAACAAGCCCAGG + Intronic
1025160720 7:56658088-56658110 CTATCCTTGAAAATAACCCAGGG - Intergenic
1035868025 8:3106000-3106022 TAGTCCTAGAAAATAAACCAAGG - Intronic
1038056619 8:23864355-23864377 CCCTCCAAGAAAACAAGCCATGG - Intergenic
1038119949 8:24601979-24602001 CCCTCCTAGAAAATCACTAAGGG + Intergenic
1039643983 8:39259560-39259582 GTCTTCTTGGAAATAACCCAAGG + Intronic
1039996100 8:42534556-42534578 TGATCCTAGAAAATAACCTAGGG + Intronic
1040420395 8:47234497-47234519 GACTCCTAGAATATAACATAGGG + Intergenic
1041993669 8:64026556-64026578 ACCTGCAGGAAAATAACCCAGGG - Intergenic
1042770773 8:72379456-72379478 GCATCCTAGAAGAAAAACCAAGG + Intergenic
1045342875 8:101270078-101270100 GCCTTGAAGAAAATAAACCAGGG + Intergenic
1045990932 8:108306877-108306899 GCCTCCTGGAAAATAACATCTGG - Intronic
1048857446 8:138696877-138696899 TCCTCCTAGAAAACTACCCATGG + Intronic
1052250822 9:26395150-26395172 ACCTCCTAGAAGATAATGCAGGG - Intergenic
1056233193 9:84567606-84567628 CACTCCTAGGAAATGACCCAAGG - Intergenic
1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG + Intronic
1061509965 9:131054376-131054398 GCCTCCCAAAACATTACCCATGG - Intronic
1061566424 9:131443831-131443853 GCCTCCTATAAAATCAGCCCAGG - Intronic
1062480482 9:136748605-136748627 GCCTCCTGCAAAATTACCCAGGG + Intergenic
1186480219 X:9890959-9890981 TCCTCCTAGAAAAGAACGCAGGG - Exonic
1189221681 X:39377610-39377632 GATTCCTAAAAAAGAACCCAGGG - Intergenic
1191885434 X:65883257-65883279 GCCTCCTAAAGAAAAATCCAAGG + Intergenic
1191907577 X:66110022-66110044 GCCCTCTAGAAAATGCCCCACGG - Intergenic
1195557814 X:106247289-106247311 TTCTCCAAGAAAATAACTCATGG - Intergenic