ID: 1159962154

View in Genome Browser
Species Human (GRCh38)
Location 18:74563764-74563786
Sequence CACTAATATCCATATTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159962152_1159962154 8 Left 1159962152 18:74563733-74563755 CCCTGGGTTATTTTCTAGGAGGC 0: 1
1: 0
2: 3
3: 16
4: 111
Right 1159962154 18:74563764-74563786 CACTAATATCCATATTTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 232
1159962153_1159962154 7 Left 1159962153 18:74563734-74563756 CCTGGGTTATTTTCTAGGAGGCA 0: 1
1: 0
2: 1
3: 9
4: 152
Right 1159962154 18:74563764-74563786 CACTAATATCCATATTTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 232
1159962150_1159962154 11 Left 1159962150 18:74563730-74563752 CCTCCCTGGGTTATTTTCTAGGA 0: 1
1: 0
2: 0
3: 21
4: 170
Right 1159962154 18:74563764-74563786 CACTAATATCCATATTTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 232
1159962148_1159962154 12 Left 1159962148 18:74563729-74563751 CCCTCCCTGGGTTATTTTCTAGG 0: 1
1: 0
2: 1
3: 25
4: 235
Right 1159962154 18:74563764-74563786 CACTAATATCCATATTTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159962154 Original CRISPR CACTAATATCCATATTTCAC AGG Intronic
902693363 1:18124356-18124378 CACTAGTATCCTCATTTTACAGG + Intronic
903486543 1:23693424-23693446 TACTGTTATCCATATTTTACAGG - Intronic
904693414 1:32312326-32312348 TATTATTATCCTTATTTCACAGG - Intronic
904809450 1:33153672-33153694 CACTAGCATCCCTATTTCAGAGG + Intronic
905063637 1:35161139-35161161 CACGAATTTCCATTTTACACAGG - Intergenic
905121630 1:35686742-35686764 CACTTCTGTCCATATTTCCCAGG + Intergenic
906423562 1:45690025-45690047 AATTAGTATCCATATTTCAAAGG + Intronic
906794704 1:48687690-48687712 CACGAATGCCCCTATTTCACAGG - Intronic
906983572 1:50657725-50657747 AACTAGTATCTCTATTTCACTGG - Intronic
907223192 1:52921919-52921941 CACTATTATCCCCATTTTACAGG - Intronic
908504672 1:64784536-64784558 CACTAATAGGCATATATAACAGG - Intronic
908910425 1:69066565-69066587 GACTAATATCCAGAATTTACAGG - Intergenic
908995981 1:70154857-70154879 TATTATTATCCCTATTTCACAGG + Intronic
909880689 1:80873717-80873739 CACTAAGAGCCATCTTTCAAGGG + Intergenic
910003558 1:82366689-82366711 CTCTAATATCTAAGTTTCACTGG - Intergenic
910363197 1:86435650-86435672 CACTATTATCCCTATCTTACAGG - Intronic
910386259 1:86685884-86685906 CACTATTATCTATATTTTTCTGG + Intergenic
913582769 1:120243492-120243514 AACTAATATCCACAATGCACTGG - Intergenic
917146798 1:171900787-171900809 CAATAATATGCATATTTTATCGG - Intronic
917563485 1:176185522-176185544 AACTGATGTCTATATTTCACTGG - Intronic
921851166 1:219933542-219933564 TATTATTATCCCTATTTCACAGG - Intronic
924110512 1:240694650-240694672 GTCTAATATCTTTATTTCACAGG + Intergenic
924482920 1:244452698-244452720 CTCTATTATCCTTATTTTACAGG + Intergenic
1062879992 10:970345-970367 CACTAACACCCATCTTTCAGGGG + Intergenic
1073835033 10:107431481-107431503 CACTAATATTAATAATTGACAGG - Intergenic
1073842289 10:107511525-107511547 CACTGATGTTCTTATTTCACTGG + Intergenic
1075504664 10:123011272-123011294 CACTAATATACCTACTTCAGAGG - Intronic
1075987702 10:126802100-126802122 GACTAATATCCAGAATTTACAGG - Intergenic
1079786873 11:24684370-24684392 AACTAATTTACATATTTCCCTGG + Intronic
1081600593 11:44490018-44490040 CACTATTATCCCCATTTTACAGG - Intergenic
1084351282 11:68601703-68601725 CACTTAGATCCATGTGTCACTGG + Intronic
1085275318 11:75294797-75294819 CACTTCTACTCATATTTCACTGG - Intronic
1085777350 11:79378703-79378725 TTCTATTATCCATATTTTACAGG - Intronic
1087442228 11:98201276-98201298 GTCTAATATCCAGAATTCACAGG - Intergenic
1087524419 11:99291336-99291358 CACTCATATCTTTATTACACTGG + Intronic
1088520317 11:110691008-110691030 TACTACTATCTTTATTTCACAGG + Intronic
1088552144 11:111023868-111023890 CACTAATTTCCATTATTCAAAGG + Intergenic
1093585653 12:20832589-20832611 CACCAAGATCCATATCCCACAGG + Intronic
1095413348 12:41947649-41947671 TACTATTATCCTTACTTCACAGG + Intergenic
1095803636 12:46294647-46294669 GACTAATATCCAGAATACACAGG + Intergenic
1096921481 12:55091261-55091283 TACTAATTTCCATATTTCTTAGG + Intergenic
1097657469 12:62385568-62385590 CCCTCATATCAGTATTTCACTGG + Intronic
1099736224 12:86569295-86569317 AACTAATATCCAAAATTTACAGG + Intronic
1101665572 12:106810132-106810154 AAATAACATCCATATCTCACAGG - Intronic
1105889460 13:24671969-24671991 CACTGAAATGCATATTTAACTGG - Intergenic
1106911564 13:34468707-34468729 CATTAATATCCTTATTTTACAGG + Intergenic
1107716205 13:43201987-43202009 CCCCAATCTCCATGTTTCACTGG + Intergenic
1108462124 13:50677160-50677182 AACTAATGTACATGTTTCACTGG + Intronic
1109347585 13:61134720-61134742 CAGTAATAATCATCTTTCACTGG - Intergenic
1110793780 13:79613800-79613822 CAATAATCCCCATATTTCAAGGG - Intergenic
1112750449 13:102578053-102578075 CCCTAATATCCAGCTTTCAGAGG + Intergenic
1116642067 14:47476863-47476885 TAATAACATCTATATTTCACTGG + Intronic
1119135029 14:72209907-72209929 GATTAATAACCATATTTAACTGG - Intronic
1119529789 14:75352004-75352026 CACTAATTTCCACATTGCAGGGG + Intergenic
1120249405 14:82044125-82044147 TACTACTACCCATGTTTCACAGG - Intergenic
1120516494 14:85476984-85477006 CGTCAATATCCCTATTTCACAGG - Intergenic
1121423892 14:93834583-93834605 CATGAATCTCCATATTTCACTGG - Intergenic
1121714884 14:96066445-96066467 CAAAAATATCCTTATTTCCCTGG + Intronic
1122314566 14:100818101-100818123 TACTATTATCCCTATTTTACAGG + Intergenic
1122403708 14:101483712-101483734 TGCTAATATCCATTTTTAACTGG - Intergenic
1124094369 15:26635216-26635238 CCCTCATCTCCATATTTCAAAGG + Intronic
1126275467 15:46874235-46874257 AACTAATTCCCATCTTTCACTGG - Intergenic
1126977704 15:54202928-54202950 GACTAATATCCAGAGTTTACAGG + Intronic
1130530491 15:84744337-84744359 TCCTAATATCAATATTTCTCAGG - Intergenic
1130613834 15:85384959-85384981 CACTGATATCCACATTCCCCAGG - Intronic
1131548810 15:93338720-93338742 CACTTATCTCCATCCTTCACAGG - Intergenic
1133304494 16:4801008-4801030 CACCAATGCCCATGTTTCACTGG + Intronic
1134824702 16:17275237-17275259 AATTAGTATCCACATTTCACAGG + Intronic
1135663574 16:24316939-24316961 CATTCTAATCCATATTTCACTGG - Intronic
1136281043 16:29211521-29211543 AACTAATATCCTGATTTCAATGG - Intergenic
1137944999 16:52725604-52725626 GACTATTGTCCATATTTTACAGG - Intergenic
1138047820 16:53744342-53744364 CATTAATTTCCAAATTTCTCTGG + Intronic
1140076327 16:71702180-71702202 CACCAATATACAAATTTGACAGG + Intronic
1140138998 16:72236730-72236752 CACTTATATCCACATTTCACTGG + Intergenic
1141277264 16:82599710-82599732 CACTTATATCCAGATTCCAATGG + Intergenic
1142085401 16:88177444-88177466 AACTAATATCCTGATTTCAGTGG - Intergenic
1142942854 17:3397412-3397434 TATTAATATCAATATTTTACTGG + Exonic
1147443379 17:40460872-40460894 CACTAATCTCCATCTTTCCCTGG - Intergenic
1147487249 17:40828398-40828420 CATTACTATCCATATTTTATAGG - Intronic
1149029622 17:52068140-52068162 CCATAATATCCACATTTCAAAGG + Intronic
1149309400 17:55379239-55379261 AACTATTATTCATATTCCACAGG - Intergenic
1150690776 17:67365374-67365396 TACTATTATCCTTATTTTACAGG - Intronic
1150896603 17:69218426-69218448 AACTATTATCCACATTTTACAGG - Intronic
1151720768 17:75854805-75854827 TACTACTGTCCACATTTCACAGG - Intronic
1153063533 18:1019014-1019036 CTGGAATATCCAGATTTCACTGG + Intergenic
1153496036 18:5700520-5700542 CATTAATATTCAAATTTCACAGG - Intergenic
1154136566 18:11785188-11785210 GACTAATTTCCAAATTCCACTGG - Intronic
1155422637 18:25671856-25671878 CACCACTCTTCATATTTCACAGG - Intergenic
1158636218 18:59160694-59160716 CACTAAAATCCACAATTCAATGG - Intergenic
1159962154 18:74563764-74563786 CACTAATATCCATATTTCACAGG + Intronic
1164799330 19:31063098-31063120 CACAAATATCCATCTTTCCATGG + Intergenic
1168073771 19:53967536-53967558 CACTAAAATCTGAATTTCACTGG + Intronic
1168281330 19:55307136-55307158 CACCAATATTAATATGTCACAGG + Intronic
925400258 2:3567629-3567651 CAGTTATCTCCATTTTTCACAGG - Intergenic
926653889 2:15377515-15377537 TACTATTATCCACATTTTACAGG + Intronic
927740320 2:25563067-25563089 GCCTAATCTACATATTTCACTGG + Intronic
928257381 2:29734669-29734691 CACAAATATCCAAATATCAATGG + Intronic
928407415 2:31025192-31025214 CACTATTATTCCTATTTCAGAGG + Intronic
928642607 2:33316006-33316028 CCCTAATATCCTTATTTCCAAGG + Intronic
928989090 2:37212560-37212582 AACTAAGATCAGTATTTCACAGG - Intronic
929287851 2:40155767-40155789 AACTAGTATCCATATTGGACTGG + Intronic
929962425 2:46506725-46506747 CACTAATATGCATCTTTTATTGG - Intronic
930264918 2:49188512-49188534 CTCTAACATGCAAATTTCACAGG + Intergenic
935875392 2:107501014-107501036 CACTGCTATCCACTTTTCACTGG + Intergenic
938655858 2:133432831-133432853 CAATAATATCCCCATTTCATAGG - Intronic
939211403 2:139179783-139179805 AAGTTATATCCATATTTTACAGG - Intergenic
939883702 2:147658366-147658388 CACTACTCTTCATATCTCACTGG + Intergenic
940083582 2:149832550-149832572 CATTTCTATTCATATTTCACTGG + Intergenic
941217135 2:162726374-162726396 AACTCATATACATATTTCAAGGG + Intronic
943444083 2:187961710-187961732 CAGTAAAATCCATAATTCATTGG - Intergenic
945631317 2:212281417-212281439 CCCAAATATCCATATGTGACTGG - Intronic
945855158 2:215060063-215060085 CAGTAAGATCCATATTCCTCAGG + Intronic
947459934 2:230295269-230295291 CACTAAGCTTCATATTCCACTGG + Intronic
947470167 2:230394407-230394429 CACTAAGCTTCATATTCCACTGG + Intronic
1169810379 20:9603790-9603812 CACTATTATCCCCATTTTACAGG + Intronic
1170454131 20:16516819-16516841 CCCTTAGATTCATATTTCACTGG - Intronic
1170824375 20:19781185-19781207 CACTTCCATCCATATTTTACTGG + Intergenic
1170867352 20:20170980-20171002 CATTATTATCCTCATTTCACAGG + Intronic
1174723468 20:52837947-52837969 AACTAATACCCAAATCTCACTGG - Intergenic
1177346067 21:19872707-19872729 CACTACTATTCAAATTTTACTGG + Intergenic
1177870783 21:26570520-26570542 CAATAATATCAACACTTCACTGG + Intronic
1178132120 21:29585587-29585609 CAGTAGTTTCCATATTTCGCAGG - Intronic
1181684285 22:24517629-24517651 CAATTATATGCATATTACACTGG - Intronic
1203295029 22_KI270736v1_random:33844-33866 CATTCATATCCTTATTTCATAGG - Intergenic
949353075 3:3145644-3145666 AAGTAATATTCATTTTTCACTGG + Intronic
949655542 3:6214197-6214219 CACTAATATGCAAATTATACTGG + Intergenic
949853892 3:8442458-8442480 CACCACTATCCCCATTTCACAGG + Intergenic
951323822 3:21278772-21278794 AAATAAAATCCAGATTTCACAGG - Intergenic
951935330 3:28016652-28016674 TATTATTATCCCTATTTCACAGG + Intergenic
952511181 3:34057686-34057708 CTTTATTTTCCATATTTCACTGG + Intergenic
952701329 3:36330968-36330990 GACTCATATCAGTATTTCACTGG + Intergenic
955839698 3:63098506-63098528 AACTAATATCCATAATCTACAGG - Intergenic
957129682 3:76206870-76206892 AACTAATATCAATGTTTAACAGG - Intronic
957200636 3:77131016-77131038 CAATAATATATATATTTCAAAGG - Intronic
957558803 3:81795420-81795442 AAATAATATCCATACTTCATTGG - Intergenic
957813403 3:85257987-85258009 CAAAAATATACTTATTTCACAGG + Intronic
958152518 3:89708886-89708908 GACTAATATCCAGAATTTACAGG + Intergenic
959352325 3:105281466-105281488 CACCAAGTTCCATATTTCAGGGG - Intergenic
959990883 3:112630692-112630714 TACTATTATTCACATTTCACAGG + Intronic
961590916 3:127981090-127981112 CATTAATATCCATCTCTAACTGG + Intronic
961968084 3:130926948-130926970 CACGGATGTACATATTTCACTGG + Intronic
962495603 3:135936266-135936288 CACTAACCTCCATAGTCCACTGG - Intergenic
962717576 3:138139952-138139974 GACTAATATCTATATTTTATAGG - Intergenic
963639868 3:147846050-147846072 CAATAATATCCATGTTTTGCTGG - Intergenic
964579853 3:158220980-158221002 TATTAAAAGCCATATTTCACAGG + Intronic
965283982 3:166793045-166793067 ACCTAATATCCATATCCCACTGG + Intergenic
966352496 3:179046094-179046116 CTCTAAAATCCATATTTCAAAGG - Intronic
966555537 3:181255634-181255656 CATTATTATCCCTATTTTACTGG - Intergenic
966605906 3:181821455-181821477 TACTTATATACATATTTCACGGG - Intergenic
969040765 4:4294023-4294045 TACTATTATCCACATTTTACAGG - Intronic
969148397 4:5144258-5144280 CACCAATATGCCTATTTTACAGG - Intronic
970011475 4:11464379-11464401 CTCTAATATTCCTATTTCTCAGG + Intergenic
973686213 4:53372540-53372562 CACTGACACCCATATTTCTCTGG - Intergenic
974246016 4:59318971-59318993 CACTTTTATTCATATTTCATTGG + Intergenic
974546755 4:63320764-63320786 GACTACTATCCATATTTTACTGG - Intergenic
974634990 4:64551862-64551884 AACTAATAACCATATTTTGCTGG + Intergenic
974781350 4:66557533-66557555 CATTAATTTACAAATTTCACAGG + Intergenic
974993525 4:69124345-69124367 CACTAATTTACAAATTTCAGAGG + Intronic
975279885 4:72549422-72549444 CCCTAACAACCATACTTCACAGG + Intronic
976551509 4:86401834-86401856 CACTGAAATACATATTTCAGTGG - Intronic
981030553 4:140121234-140121256 TACAAATATTAATATTTCACTGG + Intronic
982577468 4:157132897-157132919 GACTATTATTCAGATTTCACTGG - Intronic
984046015 4:174799029-174799051 AAATAATAATCATATTTCACTGG - Intronic
986428272 5:7655947-7655969 CACAAATACCCTTATTTTACAGG - Intronic
988184808 5:27846676-27846698 CCCTAATATCGGTATTTCCCTGG - Intergenic
988437728 5:31194935-31194957 CAATAAAATCCATATTTTATGGG + Intronic
988969532 5:36452595-36452617 TACTATTATCCAGATTTGACTGG + Intergenic
989400160 5:41000076-41000098 CAGTGATATCCTGATTTCACAGG - Intronic
989607605 5:43259665-43259687 AACTAATATCCAGAATTTACAGG - Intronic
990175796 5:53106775-53106797 TATTAATATCCATATTTTGCAGG - Intronic
990430664 5:55732404-55732426 CACTAAATTCCATAGTTCACTGG + Intronic
990802510 5:59620669-59620691 CACAAAGATCCTGATTTCACTGG - Intronic
992098757 5:73385760-73385782 GATTAATATACTTATTTCACAGG - Intergenic
992671997 5:79070047-79070069 CACAATTATCCCCATTTCACAGG + Intronic
993379868 5:87194319-87194341 CAATAATGTCTATATTTCAGTGG + Intergenic
994178645 5:96739847-96739869 CACAAATACCCATATTTAATTGG - Intronic
994977748 5:106831778-106831800 CACTTCTGTCCATATTTCATCGG - Intergenic
995359010 5:111271899-111271921 CACTATTATCCAGATGTCATTGG + Intronic
996892291 5:128436043-128436065 AACTAACAGCCATATTTCATGGG - Intronic
998537306 5:142945857-142945879 CACTAATATATATATTTTTCTGG + Intronic
999472698 5:151869788-151869810 CATTATTATACTTATTTCACTGG + Intronic
1000206542 5:159065708-159065730 CACTATTATACATATTTTATGGG - Intronic
1000771546 5:165361153-165361175 CATTAAGATACATATTTCAGAGG + Intergenic
1003264175 6:4551139-4551161 CTCTACTATTCATATTTGACAGG - Intergenic
1004825685 6:19418183-19418205 TACCAATATGCAAATTTCACAGG + Intergenic
1005126606 6:22453299-22453321 CATTAATATCTGCATTTCACAGG - Intergenic
1005396730 6:25390205-25390227 CAATAATAGCCATATTCCAGAGG - Intronic
1005417443 6:25615807-25615829 CACTGACATCCATATTTTCCAGG - Intronic
1008031656 6:46702612-46702634 CAATATTATCCATATTTTATAGG + Intronic
1009574060 6:65429561-65429583 CTCTAATATCCTTACTTCATTGG + Intronic
1009595859 6:65735435-65735457 GACTAATATCCAGAATTTACAGG + Intergenic
1011274438 6:85616249-85616271 GATTAATTTCCATATTTCATGGG - Intronic
1012117036 6:95313935-95313957 GACTAATATCCAGAATTTACAGG + Intergenic
1014737848 6:125115157-125115179 CACAAATACACATATTTCAATGG - Intergenic
1015582388 6:134739958-134739980 TACCAAATTCCATATTTCACTGG + Intergenic
1016773978 6:147883816-147883838 CACTCATTTCCACATTTCAGTGG - Intergenic
1019883780 7:3885965-3885987 CACTGAAATCCTTTTTTCACGGG - Intronic
1024339889 7:48246638-48246660 CACTAGTTTCATTATTTCACTGG - Intronic
1026637010 7:72092787-72092809 CACTTCTATTCACATTTCACTGG - Intronic
1028656373 7:93212592-93212614 AACCAATATCCACATTTCAGTGG + Intronic
1028980433 7:96962200-96962222 CACTAATGTCCATATTAGTCAGG - Intergenic
1029912025 7:104163283-104163305 CACTTCTATTCATATTTCATTGG - Intronic
1032767533 7:135012526-135012548 TACTTCTATCCACATTTCACAGG - Intronic
1033215385 7:139489855-139489877 AACTAAAATCCCTACTTCACAGG + Intergenic
1033976117 7:147102226-147102248 CACAAAGCTCTATATTTCACAGG + Intronic
1040654294 8:49486826-49486848 CACTAATAACTATGTTTTACGGG + Intergenic
1041655430 8:60345150-60345172 CATTAATATCCTCATTTCAGAGG + Intergenic
1041855110 8:62443796-62443818 CACTAATATGTATATCTCATAGG + Intronic
1042281448 8:67061157-67061179 CAACAATATCCATTTTTCCCTGG - Intronic
1042775180 8:72422515-72422537 CACTAGTTTCAATATTTCTCAGG - Intergenic
1043369457 8:79573877-79573899 TATTAATATACATATTTTACAGG + Intergenic
1043574364 8:81640930-81640952 CAGTAAAATTCAAATTTCACTGG - Intergenic
1044337215 8:91001231-91001253 CACCAATATTCAGATTTCTCAGG + Intronic
1044628672 8:94258659-94258681 CATTAATATACCTATTTGACAGG - Intronic
1044962573 8:97545308-97545330 CACTTCTATTCACATTTCACTGG - Intergenic
1046089369 8:109480936-109480958 TATTATTATCCTTATTTCACAGG - Intronic
1046620343 8:116522494-116522516 CACTAATCTCCATCTTTCCTGGG + Intergenic
1046841509 8:118863160-118863182 CACTAATATGCATGTATTACAGG + Intergenic
1047276570 8:123410120-123410142 CATTAATATCTTAATTTCACTGG + Intronic
1048125569 8:131631524-131631546 CACTAATAACCATACTACAAAGG + Intergenic
1048136762 8:131753604-131753626 CACTAATATTCACGTATCACAGG - Intergenic
1048685910 8:136905321-136905343 CATTGATACCCATATTTAACTGG - Intergenic
1048877684 8:138849984-138850006 TACTATTATCCATATTTTACAGG + Intronic
1048961758 8:139585461-139585483 CTCTATTCTCCCTATTTCACAGG - Intergenic
1051133493 9:13890878-13890900 CATTAATATCCCTAATTTACAGG + Intergenic
1051133503 9:13890961-13890983 CATTAATATCCCTAATTTACAGG + Intergenic
1051251037 9:15158862-15158884 CACTTCCATCCATATTTCATTGG - Intergenic
1052050836 9:23848257-23848279 CACTAATATCCATAGACCACAGG - Intergenic
1053817510 9:41928288-41928310 CCCTTATCTCCAAATTTCACAGG + Intronic
1054107766 9:61071960-61071982 CCCTTATCTCCAAATTTCACAGG + Intergenic
1054613091 9:67259165-67259187 CCCTTATCTCCAAATTTCACAGG - Intergenic
1055267201 9:74508831-74508853 GACTAATATCAACATTTGACTGG + Intronic
1057754059 9:97817088-97817110 TGCTAATATCCCTTTTTCACAGG - Intergenic
1058548853 9:106091771-106091793 AACTAATATCTAGAATTCACAGG - Intergenic
1059738228 9:117123455-117123477 TATTATTATCCATATTTTACAGG - Intronic
1187080166 X:15977522-15977544 CTCAAAAATCCAAATTTCACTGG - Intergenic
1188060509 X:25595450-25595472 TATTATTATCCATATTTTACTGG - Intergenic
1188646927 X:32580477-32580499 TACTATTATCTCTATTTCACTGG - Intronic
1190450005 X:50569773-50569795 CACTGATATTCAGATTTCTCTGG - Intergenic
1191952361 X:66606331-66606353 TATTAGTATCCATATTTCATTGG - Intronic
1193546348 X:82835292-82835314 GACTAATATCCAGAATACACAGG + Intergenic
1197752874 X:129977559-129977581 CATTGATATCCATATTTAAGAGG + Intergenic
1197809817 X:130431108-130431130 CAGCACTCTCCATATTTCACAGG - Intergenic
1200748841 Y:6926481-6926503 CACTAATATCTGTACTTCTCTGG - Intronic