ID: 1159962157

View in Genome Browser
Species Human (GRCh38)
Location 18:74563786-74563808
Sequence GTAGAGCAGTAAACTGCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159962155_1159962157 -10 Left 1159962155 18:74563773-74563795 CCATATTTCACAGGTAGAGCAGT 0: 1
1: 0
2: 2
3: 14
4: 140
Right 1159962157 18:74563786-74563808 GTAGAGCAGTAAACTGCCAAGGG 0: 1
1: 0
2: 0
3: 14
4: 99
1159962153_1159962157 29 Left 1159962153 18:74563734-74563756 CCTGGGTTATTTTCTAGGAGGCA 0: 1
1: 0
2: 1
3: 9
4: 152
Right 1159962157 18:74563786-74563808 GTAGAGCAGTAAACTGCCAAGGG 0: 1
1: 0
2: 0
3: 14
4: 99
1159962152_1159962157 30 Left 1159962152 18:74563733-74563755 CCCTGGGTTATTTTCTAGGAGGC 0: 1
1: 0
2: 3
3: 16
4: 111
Right 1159962157 18:74563786-74563808 GTAGAGCAGTAAACTGCCAAGGG 0: 1
1: 0
2: 0
3: 14
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159962157 Original CRISPR GTAGAGCAGTAAACTGCCAA GGG Intronic
901353449 1:8620334-8620356 GAAGAGCAGCAGACTGCCAAGGG - Intronic
901955290 1:12779847-12779869 TTAGAGCAGTAAGCTTACAAGGG + Intergenic
902325288 1:15696145-15696167 TTAGAGAAGTAAACTGCCAGAGG + Intronic
903482546 1:23664616-23664638 GTAAAGCAGCAGATTGCCAATGG + Intergenic
906490455 1:46264200-46264222 GTAGAAAGGTAAACAGCCAAGGG - Intronic
908421966 1:63967636-63967658 TTAGAGCAGTTCAGTGCCAACGG - Intronic
912662215 1:111542380-111542402 GTAGAGCAGGAAGCTGCCTGAGG + Intronic
915034320 1:152909655-152909677 GTAGAACAGTACCCTGCCCAAGG + Intronic
916852846 1:168721146-168721168 GTGGAGCAGTGAAGTGGCAAGGG + Intronic
917519697 1:175737769-175737791 CTAGAGCAGGGCACTGCCAAGGG - Intronic
920010452 1:202863369-202863391 GTAAAGAAGTGCACTGCCAATGG - Intergenic
921654606 1:217719918-217719940 GATGAGCAGAAAACTGCCCATGG + Intronic
922141428 1:222891822-222891844 GTTGAGGAGTAAAAGGCCAATGG + Intronic
923768977 1:236920759-236920781 GCAAAGCAGAAAACTCCCAATGG + Intergenic
924849669 1:247813686-247813708 GTAGAGCTGTGTACTGACAATGG - Intergenic
1063768977 10:9176160-9176182 GTAGCCCAGAAAGCTGCCAAGGG - Intergenic
1065632324 10:27693096-27693118 GAAGAGGACTAAACTGCTAACGG + Intronic
1067512744 10:46909383-46909405 GTTGGGAAGTAACCTGCCAAAGG + Intergenic
1067649501 10:48142439-48142461 GTTGGGAAGTAACCTGCCAAAGG - Intergenic
1070187377 10:74078040-74078062 GTAGAGCACTAAATTTACAAAGG - Intronic
1077153889 11:1083093-1083115 GTTGAGCAGTACACTGCCATCGG - Intergenic
1078438441 11:11344655-11344677 GGAGGGAAGTAACCTGCCAAAGG - Intronic
1078880576 11:15444963-15444985 GTAGACCAGTCTACTGCCACAGG + Intergenic
1080344527 11:31309541-31309563 GAAGACCAGTAAACAGCCAGGGG + Intronic
1083144596 11:60749040-60749062 GTAGAGCAGAACCCTGCCAAGGG + Intergenic
1086424074 11:86667074-86667096 TTAGAGCAGTAAACCTGCAAAGG - Intronic
1086571646 11:88291627-88291649 GTAGATAAGGAAACTGCCTAAGG + Intergenic
1088398967 11:109401827-109401849 AAACAGCAGTAAACTGCCAGTGG + Intergenic
1091287564 11:134416247-134416269 GAAGAGCAGTTCACTGCCAGAGG - Intergenic
1094068879 12:26390976-26390998 GAAGAGGTATAAACTGCCAAGGG + Intronic
1096458525 12:51807586-51807608 CTTGAGCAGTGACCTGCCAAGGG + Exonic
1110963952 13:81666971-81666993 GTAGAACAGGAAACTGTCAAGGG + Intergenic
1113201395 13:107870106-107870128 GTAGAGCAGTAAACTCCAGTTGG + Intergenic
1114430595 14:22657197-22657219 TTAGAGCAATCAACAGCCAAGGG + Intergenic
1114768306 14:25399928-25399950 GTAGAGCAGAAAACTGAGGAAGG - Intergenic
1116171462 14:41407774-41407796 GTAGAACTATAAACTGTCAAGGG + Intergenic
1116201319 14:41801589-41801611 GTAGAGAAGTAAACAGGCATAGG - Intronic
1116236950 14:42291155-42291177 GCTGATCAGTAAACTGCAAATGG + Intergenic
1119495778 14:75077607-75077629 GTCCAGCAGGTAACTGCCAAAGG + Exonic
1120859329 14:89240831-89240853 GTGGAGCAGTAACCTGCCTGGGG + Intronic
1121190964 14:92029725-92029747 GAAGAGAAGAAAACTGACAAAGG + Intronic
1122686628 14:103511277-103511299 ATAGAGCAGGAAACTGCAGAAGG - Intergenic
1123634181 15:22286841-22286863 GAAGGGCAGCAGACTGCCAAGGG + Intergenic
1129633863 15:77293204-77293226 GGAAGGCAGTAAACTGCCAATGG - Intronic
1132593562 16:737667-737689 GTAGGGCAGGAAAATGCCGAAGG + Intronic
1133551153 16:6855753-6855775 GTAGAGGATAAAACTTCCAAGGG - Intronic
1138127159 16:54448259-54448281 TCAGAGCAGATAACTGCCAAGGG - Intergenic
1141675735 16:85516259-85516281 GTAGAGCAGCAGCCTGCCCAAGG - Intergenic
1143292983 17:5846596-5846618 TTAGAGCAGCAAACGACCAAGGG - Intronic
1146219373 17:31004997-31005019 ATAGCGCAGAAAGCTGCCAAAGG - Intergenic
1148771401 17:50069218-50069240 TTAGAGAAGTAAATTGCCCAAGG + Intronic
1156590495 18:38482667-38482689 GCATAGCAGTAAACCCCCAAAGG + Intergenic
1158354142 18:56597569-56597591 GTAGAGTAGTAAACAGGAAAGGG - Exonic
1159962157 18:74563786-74563808 GTAGAGCAGTAAACTGCCAAGGG + Intronic
1160764246 19:800265-800287 GAACAGCAGCAAACTGTCAAAGG + Intronic
1165201967 19:34152046-34152068 GGAGAGCAGGAAACCTCCAAAGG - Intergenic
927051032 2:19329510-19329532 GTAGAGAAGTAAACTAACAGTGG - Intergenic
928832213 2:35500684-35500706 TTAGAGAAGAAAACTGCCATAGG - Intergenic
931865845 2:66410302-66410324 GCAGAGAGGGAAACTGCCAATGG + Intergenic
932794367 2:74681817-74681839 GTAGAGCAGAAAACTTCAAAGGG - Exonic
934518429 2:95004241-95004263 GAAGAGAAGTGAACTGCCCAAGG - Intergenic
939574116 2:143875299-143875321 GTAGTGGAGTATTCTGCCAAAGG - Intergenic
945271440 2:207944297-207944319 GTAGAATAAGAAACTGCCAAGGG + Intronic
1173843266 20:46172847-46172869 AGAGAGTAGTAAACTGCCAAGGG - Intergenic
1175530194 20:59669502-59669524 ATTGAACAGTACACTGCCAATGG - Intronic
1178770692 21:35501065-35501087 CTAGTGCAGTAACCTCCCAATGG + Intronic
1178815697 21:35927460-35927482 GTAGACGAGTAATCTGCCAGGGG - Intronic
1184136230 22:42551506-42551528 GTAGACCTGGAAACTGCCAAGGG + Intergenic
951423992 3:22520600-22520622 GTGGAGCAGTACTCTGCCTAAGG - Intergenic
951988171 3:28644342-28644364 GTAGAGAAGGAGACTGCTAATGG + Intergenic
957616517 3:82534996-82535018 GTATGGCAGTAAACTTCCAACGG - Intergenic
959883986 3:111478213-111478235 TTAGAGCAGGGAACTGACAAAGG - Intronic
964732311 3:159880309-159880331 AAAGAGCAGAAAACTGCAAAAGG - Intronic
968153081 3:196354618-196354640 ATAGAGCTGTATACTGTCAAAGG - Exonic
969925462 4:10581559-10581581 GAACAGAAGTAAACTTCCAAGGG - Intronic
975428590 4:74259885-74259907 GTAGAGCAATCAATTGACAATGG + Intronic
992877942 5:81076316-81076338 GCTGAGCAGTAAACTTGCAAAGG + Intronic
995030516 5:107475406-107475428 GTAGCACAGAAAACTGCAAAAGG + Intronic
995683727 5:114747961-114747983 GTAGAACAGGAAATTGCAAAAGG - Intergenic
999451157 5:151679305-151679327 GGAAAGGAGAAAACTGCCAACGG + Intronic
1001824900 5:174736517-174736539 CCAGAGCAGCAAACTGCCTAAGG + Intergenic
1002621621 5:180492466-180492488 GTAGACCAGTAAGCTGCCTGTGG - Intergenic
1006511360 6:34523107-34523129 GCAGCGAAGTAACCTGCCAAAGG - Intronic
1006943012 6:37765455-37765477 ATAAAGCAGTAGACTGGCAAAGG + Intergenic
1009766727 6:68086577-68086599 GGAGAGCAGAAAAGTGCTAAGGG - Intergenic
1012451887 6:99361498-99361520 GTATGGAAGTAAACTGCCTAGGG + Intergenic
1013073685 6:106751928-106751950 TTAGAGCAGGAACCTGCCTAGGG - Intergenic
1013722536 6:113048310-113048332 GTAGGGCAGAAATCTGCCACAGG + Intergenic
1015828803 6:137345207-137345229 GTAGAAAAGAAAGCTGCCAAAGG + Intergenic
1022185041 7:27959124-27959146 TTATAGCTGTAACCTGCCAAGGG + Intronic
1022626463 7:32041897-32041919 GTAGAGAAATGAACTACCAAAGG + Intronic
1023584627 7:41716397-41716419 GGAGAGAAGTGAACTGCTAAAGG + Intergenic
1026403840 7:70043911-70043933 ATAGAGCAGTGAAATGCAAAGGG - Intronic
1033842389 7:145390120-145390142 GTAGAGCTGGAAACTGTCAAGGG + Intergenic
1033842546 7:145392787-145392809 GTAGAGCTGGAAACTGTCAAGGG + Intergenic
1034235614 7:149566786-149566808 GAAGGGCAGTAATCTGCCCAAGG + Intergenic
1041977741 8:63818674-63818696 GAAGAGCTGTAACCTCCCAATGG + Intergenic
1042443181 8:68851696-68851718 GTAGTGGAGGAAACTGCTAAGGG - Intergenic
1045726329 8:105178063-105178085 GTAGAACAGTAAGCTGACCAAGG + Intronic
1046328314 8:112679307-112679329 ATAGAGTAGTAACCTGGCAAGGG + Intronic
1048227602 8:132603835-132603857 AGAGAGCAGAGAACTGCCAAAGG + Intronic
1048415750 8:134225890-134225912 GTAGAGCAGTATAGAGCAAAAGG + Intergenic
1051390173 9:16555344-16555366 GAAGAGCACTAAACTGTTAAGGG + Intronic
1054805411 9:69392205-69392227 GCAGAGCAGTGAAAGGCCAAAGG - Exonic
1190043143 X:47088401-47088423 CTAGAGCAGGAAACTGCCGAGGG + Intronic
1190583138 X:51907890-51907912 ACAGAGCAGTAAGCTGCAAAAGG + Intergenic
1191067578 X:56366927-56366949 GTAGAGCATTAAACGACCAATGG - Intergenic
1191963781 X:66733456-66733478 GTAGTGAAGTAAACAGGCAAAGG - Intergenic
1192970230 X:76221024-76221046 ATAGAGCATTAAACCACCAAAGG - Intergenic
1196822975 X:119718131-119718153 TAAGAGCACTAAACTCCCAAAGG + Intergenic
1198127070 X:133655856-133655878 GTAAAGCTGTTAAGTGCCAAAGG - Intronic
1199978367 X:152907439-152907461 GTAGAGCAGGAACATGCCCATGG + Intergenic
1202305565 Y:23466517-23466539 GAAGGGCAGCAGACTGCCAAGGG + Intergenic
1202565244 Y:26204072-26204094 GAAGGGCAGCAGACTGCCAAGGG - Intergenic