ID: 1159966358

View in Genome Browser
Species Human (GRCh38)
Location 18:74598806-74598828
Sequence GAGTTTAAGCTGGTGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 278}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159966347_1159966358 13 Left 1159966347 18:74598770-74598792 CCAGCTAGCACGCCCTGGGTGCT 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1159966358 18:74598806-74598828 GAGTTTAAGCTGGTGGAGGCGGG 0: 1
1: 0
2: 3
3: 14
4: 278
1159966349_1159966358 1 Left 1159966349 18:74598782-74598804 CCCTGGGTGCTTGGCCTCCTTCT 0: 1
1: 0
2: 1
3: 17
4: 281
Right 1159966358 18:74598806-74598828 GAGTTTAAGCTGGTGGAGGCGGG 0: 1
1: 0
2: 3
3: 14
4: 278
1159966350_1159966358 0 Left 1159966350 18:74598783-74598805 CCTGGGTGCTTGGCCTCCTTCTG 0: 1
1: 0
2: 2
3: 30
4: 392
Right 1159966358 18:74598806-74598828 GAGTTTAAGCTGGTGGAGGCGGG 0: 1
1: 0
2: 3
3: 14
4: 278
1159966343_1159966358 24 Left 1159966343 18:74598759-74598781 CCTCTTTCCAGCCAGCTAGCACG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1159966358 18:74598806-74598828 GAGTTTAAGCTGGTGGAGGCGGG 0: 1
1: 0
2: 3
3: 14
4: 278
1159966345_1159966358 17 Left 1159966345 18:74598766-74598788 CCAGCCAGCTAGCACGCCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 142
Right 1159966358 18:74598806-74598828 GAGTTTAAGCTGGTGGAGGCGGG 0: 1
1: 0
2: 3
3: 14
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159966358 Original CRISPR GAGTTTAAGCTGGTGGAGGC GGG Intronic
900358235 1:2274995-2275017 GTGTGTCAGCAGGTGGAGGCTGG + Intronic
901532816 1:9864135-9864157 GAGTGTGATCAGGTGGAGGCAGG + Intronic
902192247 1:14772043-14772065 AAATTTAATCTGGTGGAGGATGG + Intronic
903383503 1:22912475-22912497 GTGTTAAAGCTGGTGTAGTCGGG - Exonic
903875340 1:26469992-26470014 GAGTTTGAGATGGTGAGGGCAGG - Exonic
906089975 1:43170819-43170841 GACTTTGAGCTGATGGAGGCGGG + Exonic
906607491 1:47182125-47182147 GAGTTTAAACTGGCAGAGGTGGG + Intergenic
906928425 1:50143953-50143975 GAGTTTAAGCTCATGAAGTCAGG - Intronic
908702793 1:66920332-66920354 GAGTTGAAGCTGGTAAATGCAGG - Intronic
910036369 1:82794147-82794169 GAGTTTAAGATGTGAGAGGCAGG - Intergenic
910149845 1:84129857-84129879 GAGTCTAAGCTGGAGGATGTAGG - Intronic
910462637 1:87465035-87465057 GAGTCTAAGATCTTGGAGGCAGG + Intergenic
911279609 1:95906791-95906813 GAATTTAGACTGGTGGAGGTGGG + Intergenic
913498142 1:119447073-119447095 GCACTAAAGCTGGTGGAGGCTGG - Intergenic
914763742 1:150620093-150620115 TATTTTAAGCTGGTGTGGGCTGG - Intronic
916418227 1:164612117-164612139 TAGTTCAAGAAGGTGGAGGCGGG + Intronic
916480665 1:165211729-165211751 GGGTTTCAGCAGGTGGAGGTGGG - Intronic
917833569 1:178920465-178920487 AAGATTAAGCTGGTGGAGAGAGG - Intronic
919297232 1:195718406-195718428 GAGTTGGTGCTGGTGGAGGAGGG + Intergenic
919723430 1:200865432-200865454 GACTTGAAGCTGGTGGCAGCAGG - Intergenic
919890571 1:201970927-201970949 GAGTTTATGTTTGTGAAGGCTGG - Intergenic
920027858 1:203014051-203014073 GACTTTAAGATGGTATAGGCAGG - Intronic
920291701 1:204928018-204928040 GCTTTTCAGCAGGTGGAGGCAGG + Intronic
920806156 1:209235828-209235850 CAATTTAAGCTGGTTGTGGCTGG + Intergenic
921279224 1:213549259-213549281 GAGTCTTAGGTGGTGGAGGAAGG + Intergenic
922222517 1:223619247-223619269 GAGGATAAGCTGGAGGAGGTTGG + Intronic
924408559 1:243778138-243778160 GACTATAAGCTGTTTGAGGCAGG + Intronic
1068910574 10:62374582-62374604 GAGTTCCTGCTGGTGGGGGCCGG - Intronic
1069075529 10:64034821-64034843 GAGTTGCATCTGGTGCAGGCTGG - Intergenic
1070393073 10:75988324-75988346 GCCTTCAAGGTGGTGGAGGCTGG - Intronic
1071526272 10:86361359-86361381 GAGTTTGTGCTGGTGAAAGCTGG - Intronic
1074864620 10:117537550-117537572 GAGCTGGAGCTGATGGAGGCAGG + Intergenic
1074898330 10:117795905-117795927 GATTTTAAGCTGCTGCAGGTGGG + Intergenic
1076568227 10:131413209-131413231 CAGAGTCAGCTGGTGGAGGCTGG + Intergenic
1077043376 11:534294-534316 GAATATAAGCTGGTGGTGGTGGG - Exonic
1077664950 11:4099477-4099499 GAGTTAAAAGTGGTTGAGGCAGG + Intronic
1078654033 11:13221639-13221661 GACTTGAAGCTGGCGGAGGGAGG + Intergenic
1080264913 11:30390496-30390518 GAGTTTATGGTAATGGAGGCCGG + Intronic
1081103052 11:39028961-39028983 GAGCTTGAGCTGGTGCAGGGGGG + Intergenic
1083205781 11:61148172-61148194 GTGCTGGAGCTGGTGGAGGCTGG - Intronic
1085220862 11:74872733-74872755 CAGTTTCAGCTGCTGGAGCCAGG - Intronic
1085794722 11:79528559-79528581 GAGTGGAAGCTGGTGGAGGAAGG - Intergenic
1086194060 11:84115857-84115879 GAGTATAAGCTCCAGGAGGCAGG + Intronic
1087129931 11:94659985-94660007 GAATTGAAGCTGGAGAAGGCAGG - Intergenic
1087880350 11:103408428-103408450 GGGTTTAAGATGGTAGAGCCCGG - Intronic
1088562229 11:111126867-111126889 GATTGTAAGCTGGGGGAAGCGGG - Intergenic
1088814634 11:113412773-113412795 GAGAGTCAGCTGGTGGTGGCTGG + Exonic
1089593121 11:119557647-119557669 CTATTTAAGGTGGTGGAGGCAGG + Intergenic
1089620979 11:119721972-119721994 GCGTGTGAGCTGGTGGTGGCTGG + Intronic
1090766455 11:129880287-129880309 GATTTGCAGCTGGTGGAGGAAGG - Intronic
1091332278 11:134739295-134739317 GGGTTGGAGCTGGCGGAGGCAGG + Intergenic
1091501663 12:1023620-1023642 TATTTTAAGCTGGTGGAGGCAGG + Intronic
1092902839 12:13076051-13076073 GAGGTAAAGGTGGTGAAGGCTGG - Exonic
1095960394 12:47830834-47830856 GAGTGGAAGCTGGAGCAGGCCGG + Intronic
1100406890 12:94279730-94279752 GAATGGAAGCTGGTGGGGGCAGG - Intronic
1101771286 12:107753960-107753982 GAGGGTAAGGTGGTGGAGGTAGG + Exonic
1103985905 12:124767340-124767362 GACTTTACGCTGCTGAAGGCAGG - Intergenic
1104933285 12:132351697-132351719 GAGTTAAAGCTGGGAGAGCCTGG + Intergenic
1109088662 13:58010620-58010642 GAATTTAAGTTGGTGGAGGAAGG - Intergenic
1109792397 13:67267169-67267191 GGGTTTAATGTGGTGGATGCTGG - Intergenic
1110011408 13:70338890-70338912 GAGTATAAGTTGGTGGATGATGG + Intergenic
1110011886 13:70346321-70346343 GTGTTTTAGTTGGTGGAGGGCGG - Intergenic
1112360530 13:98713711-98713733 GAGGTGAGGCTGGTGGAGGCTGG + Intronic
1113408166 13:110061183-110061205 GAGTGTAAGCTGGCAGTGGCTGG - Intergenic
1113629100 13:111868868-111868890 GAGTTGAAGCTGGTGGTGCCTGG - Intergenic
1113796204 13:113060139-113060161 GAGAATTTGCTGGTGGAGGCCGG - Intronic
1117673389 14:58130951-58130973 GAGATTAAGATGGTGGGGGGTGG - Intronic
1119651704 14:76388547-76388569 AAGTTTAAGGTGGTGGTGGAGGG + Intronic
1122009344 14:98732852-98732874 GAGGTCTAGCTGGTGGAGTCGGG + Intergenic
1123139636 14:106062422-106062444 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123141948 14:106088395-106088417 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123145922 14:106129810-106129832 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123148122 14:106153901-106153923 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123149241 14:106165476-106165498 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123154513 14:106211209-106211231 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123156871 14:106235335-106235357 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123158883 14:106258041-106258063 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123160000 14:106268879-106268901 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123162206 14:106289299-106289321 GAGATGCAGCTGGTGGAGTCTGG - Intergenic
1123172718 14:106389663-106389685 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123175279 14:106410761-106410783 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123178378 14:106443402-106443424 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123186170 14:106518849-106518871 GAGGATCAGCTGGTGGAGTCTGG - Intergenic
1123187953 14:106538083-106538105 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123189710 14:106557215-106557237 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123192751 14:106586649-106586671 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123193424 14:106592946-106592968 GAGGTGCAGCTGGTGGAGACTGG - Intergenic
1123197622 14:106631471-106631493 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123198972 14:106643403-106643425 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123200414 14:106657996-106658018 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123201231 14:106666357-106666379 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123202056 14:106675285-106675307 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123207642 14:106728433-106728455 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123212658 14:106775436-106775458 GAGGTGCAGCTGGTGGAGTCCGG - Intergenic
1123214147 14:106790971-106790993 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1123215210 14:106802971-106802993 GAGGTGCAGCTGGTGGAGTCCGG - Intergenic
1123216123 14:106810713-106810735 GAGGTGCAGCTGGTGGAGTCCGG - Intergenic
1123222247 14:106867921-106867943 GAGGTACAGCTGGTGGAGTCTGG - Intergenic
1202946552 14_KI270726v1_random:33118-33140 GAGGCGCAGCTGGTGGAGGCTGG + Intergenic
1123401141 15:19987935-19987957 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1125723501 15:41856519-41856541 GGGTACAAGCTGGTGCAGGCTGG - Exonic
1126212279 15:46113363-46113385 GAGTATAAGCAGGAAGAGGCTGG - Intergenic
1126424678 15:48514590-48514612 GCATTTAAGCTGGTGAAGGGAGG - Intronic
1129016687 15:72474769-72474791 GAGGTGGAGCTGGTGGAGCCCGG + Exonic
1130082817 15:80749400-80749422 GGTTTTAAGCTGGTGGATGTGGG + Intronic
1132180860 15:99751991-99752013 AAGATAAAGCTGGTGGAGGGAGG + Intergenic
1132599226 16:766599-766621 GAGGTTATGCTGGTGGTGGAGGG + Intronic
1134514147 16:14873350-14873372 GAGTGGGAGGTGGTGGAGGCAGG + Intronic
1134701789 16:16271849-16271871 GAGTGGGAGGTGGTGGAGGCAGG + Intronic
1134970041 16:18522801-18522823 GAGTGGGAGGTGGTGGAGGCAGG - Intronic
1135393744 16:22115343-22115365 GAGCTTAAGTTCCTGGAGGCTGG - Exonic
1135730065 16:24886854-24886876 GAGGTTAAGGAGGTTGAGGCAGG + Intronic
1136680977 16:31962088-31962110 GAGGTGCAGCTGGTGGAGTCTGG + Intergenic
1136693196 16:32051990-32052012 GAGGTTCAGCTGGTGCAGTCTGG + Intergenic
1136694537 16:32066065-32066087 GAGGTGCAGCTGGTGGAGTCTGG + Intergenic
1136793689 16:32995213-32995235 GAGGTTCAGCTGGTGCAGTCTGG + Intergenic
1136795035 16:33009329-33009351 GAGGTGCAGCTGGTGGAGTCTGG + Intergenic
1136873268 16:33827366-33827388 GAGGTGCAGCTGGTGGAGTCTGG + Intergenic
1136874877 16:33845053-33845075 GAGGTGCAGCTGGTGGAGTCTGG - Exonic
1136876222 16:33859165-33859187 GAGGTTCAGCTGGTGCAGTCTGG - Intergenic
1136888502 16:33950239-33950261 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
1137440600 16:48495856-48495878 GTGTTTAAGCTGCTGTAGGCAGG + Intergenic
1141667872 16:85475197-85475219 GGGTCTGGGCTGGTGGAGGCAGG - Intergenic
1142430465 16:90023453-90023475 GGGTTTCAGCTGGTGGGGGGAGG + Intronic
1203083951 16_KI270728v1_random:1167583-1167605 GAGGTGCAGCTGGTGGAGTCTGG + Intergenic
1203095951 16_KI270728v1_random:1256906-1256928 GAGGTTCAGCTGGTGCAGTCTGG + Intergenic
1203097295 16_KI270728v1_random:1270984-1271006 GAGGTGCAGCTGGTGGAGTCTGG + Intergenic
1144825206 17:18101896-18101918 GAGATTGAGAAGGTGGAGGCCGG - Intronic
1146429767 17:32781012-32781034 GAATTTAACTTGTTGGAGGCTGG + Intronic
1148837637 17:50474268-50474290 GTGTGTAAGGTGGAGGAGGCTGG + Intronic
1149899776 17:60464422-60464444 GAGTTTAAGGGGTTGGAGGAAGG - Intronic
1150805554 17:68316043-68316065 GAGATGAAGCTGGAGTAGGCAGG - Intronic
1152157261 17:78642539-78642561 CAGTTAAAGATGGTGGAGCCAGG + Intergenic
1152913826 17:83022285-83022307 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913834 17:83022332-83022354 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913842 17:83022379-83022401 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913850 17:83022426-83022448 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913858 17:83022473-83022495 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913866 17:83022520-83022542 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913874 17:83022567-83022589 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913882 17:83022614-83022636 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913890 17:83022661-83022683 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913898 17:83022708-83022730 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913907 17:83022755-83022777 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913916 17:83022802-83022824 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913924 17:83022849-83022871 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913932 17:83022896-83022918 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913940 17:83022943-83022965 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913948 17:83022990-83023012 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913956 17:83023037-83023059 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913964 17:83023084-83023106 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913972 17:83023131-83023153 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913980 17:83023178-83023200 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913988 17:83023225-83023247 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152913996 17:83023272-83023294 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152914004 17:83023319-83023341 GAGTTCACGCTGGTGCAGGTGGG - Intronic
1152914012 17:83023366-83023388 GAGTTCATGCTGGTGCAGGTGGG - Intronic
1153239203 18:3015372-3015394 TAGTGTAAGCTGGTGGACACGGG - Intergenic
1153700821 18:7691967-7691989 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700830 18:7692001-7692023 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700839 18:7692035-7692057 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700848 18:7692069-7692091 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700857 18:7692103-7692125 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700866 18:7692137-7692159 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700875 18:7692171-7692193 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700884 18:7692205-7692227 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700893 18:7692239-7692261 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700902 18:7692273-7692295 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700911 18:7692307-7692329 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700920 18:7692341-7692363 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1153700929 18:7692375-7692397 GAGGTTAAGGAGGTGGAGGATGG + Intronic
1154334505 18:13455047-13455069 GAGGCGAAGCTGGTGGATGCTGG + Intronic
1158414906 18:57241790-57241812 GAATTTGAACTGGAGGAGGCTGG + Intergenic
1158835856 18:61331529-61331551 CAGTTTAAGCTGCTAGAGACCGG + Intergenic
1159966358 18:74598806-74598828 GAGTTTAAGCTGGTGGAGGCGGG + Intronic
1160077059 18:75687848-75687870 GAGTTAGAGTTGGAGGAGGCAGG - Intergenic
1163630863 19:18417408-18417430 GAGATTAAACTGGGGGTGGCAGG + Intergenic
1165138491 19:33685556-33685578 GGGTGTAAGCAGGTGAAGGCAGG + Intronic
1165282208 19:34807194-34807216 GTGTTTAGGCTGGGGGAAGCGGG - Intergenic
1165933931 19:39377721-39377743 GAGCTGGAGCTGGTGGAGGTGGG - Exonic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166144411 19:40824247-40824269 AAGACTAAGCAGGTGGAGGCGGG + Intronic
1166183342 19:41123817-41123839 AAGACTAAGCGGGTGGAGGCAGG - Intronic
1166427174 19:42689248-42689270 CAGCTTAAGCTGCTGGAGCCAGG + Intronic
1166438711 19:42791714-42791736 CAGTTTGAGCTGCTGGAGCCAGG + Intronic
1166473723 19:43102503-43102525 CAGTTTCAGCTGCTGGAGCCAGG + Intronic
1166494505 19:43289440-43289462 CAGTTTGAGCTGCTGGAGCCAGG + Intergenic
1166738691 19:45101343-45101365 GAGGTGAGGCTGGAGGAGGCAGG + Intronic
1167571846 19:50293366-50293388 GAGGTGAAGCTGGGGTAGGCTGG + Intronic
1168105035 19:54161252-54161274 GAGGGTAAGCTGGTGGGGGAAGG + Exonic
925599210 2:5590827-5590849 GAGTGTAAGCTCCTGGAGGGTGG - Intergenic
927192976 2:20529595-20529617 GAGTTTGAACTGGTGGAGGCAGG + Intergenic
927692960 2:25221344-25221366 CAGAATAAGCTGGTGGTGGCCGG + Intergenic
934512861 2:94961324-94961346 GAGGTTCAGCTGGTGGAGTCTGG - Intergenic
934513889 2:94971985-94972007 GAGGTGCAGCTGGTGGAGTCTGG - Intergenic
934521811 2:95024681-95024703 GAGTCTAAGCTGGAGGTTGCGGG + Intergenic
934842227 2:97633943-97633965 GAGTTAAAGATGGTGGGGGGAGG - Intergenic
934972077 2:98771858-98771880 GATCTAAAGCTGGTGGATGCAGG - Intergenic
935492344 2:103735772-103735794 CAGTGGAAGCTGCTGGAGGCAGG + Intergenic
939964043 2:148593131-148593153 GAGTTTAAGCTACTGCAGGCAGG - Intergenic
940717797 2:157247318-157247340 CAGTTTTAGCTGGTAGAGTCAGG + Intergenic
943107858 2:183569914-183569936 GTATTTAAACTGGTGGTGGCAGG - Intergenic
948033147 2:234836130-234836152 GAATTTAAGATGTTAGAGGCTGG - Intergenic
1168772020 20:421460-421482 GAATGTAAGCTGCAGGAGGCAGG - Intronic
1169816911 20:9666627-9666649 GAGCTTATGGTGGTGGAGGTGGG - Intronic
1172342121 20:34166709-34166731 CAGATTAAGCTGGATGAGGCTGG - Intergenic
1172531256 20:35632757-35632779 GAGGTTAAGGTTGTGGAGGGAGG - Intronic
1172635971 20:36410200-36410222 GAGCTTGAGGTGGTAGAGGCAGG - Intronic
1174489674 20:50884032-50884054 GAGTTTCATCTGGAGGAGCCAGG + Intergenic
1178849804 21:36203693-36203715 TAGGTTGAGCTGGTGAAGGCTGG + Intronic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1179468513 21:41594839-41594861 TATTTTAAGCTGGAGGAAGCTGG - Intergenic
1183231492 22:36584929-36584951 GAGCTTAGGCTGAAGGAGGCGGG - Intronic
1183922602 22:41181430-41181452 GAGCTGAAGCAGGTGGATGCTGG - Intergenic
1184109454 22:42386518-42386540 GAGTGTGAGCTGGTAGAAGCTGG - Intronic
1184694945 22:46133896-46133918 GAGCTAAAACTGGTGGAGCCGGG - Intergenic
949347019 3:3085812-3085834 GAGTTTGAGCTGGTGGAGTGGGG - Intronic
949564408 3:5231774-5231796 GAGCTTCAGATGGAGGAGGCAGG + Intergenic
951477337 3:23120962-23120984 GGGTTTAACTTGGTGGAGGCAGG - Intergenic
954291755 3:49653634-49653656 GAGGCTGAGCTGGGGGAGGCAGG - Exonic
955909168 3:63842688-63842710 GAGATTAAGAAGATGGAGGCTGG + Intronic
956869654 3:73404244-73404266 GAGTCTCAGCTGGTGGACACGGG - Exonic
960024822 3:112996578-112996600 GAGTTTAAGCTTTTAGAGGAGGG + Intronic
960134316 3:114090312-114090334 GAATAAAAGGTGGTGGAGGCGGG - Intergenic
961337062 3:126186928-126186950 CAGTTTCAGGTGGTGGCGGCTGG - Intronic
962307633 3:134302294-134302316 GAGATGAAGGTGGTGGAAGCTGG - Intergenic
963037384 3:141044140-141044162 GAATTTATTCTGTTGGAGGCAGG - Intergenic
964568812 3:158089992-158090014 GCTTTGAAGCTGGAGGAGGCAGG - Intergenic
966417515 3:179704812-179704834 GATTATAAGCTTGTTGAGGCCGG + Intronic
967225033 3:187282842-187282864 GAGATTAACATGGTGGCGGCGGG - Intronic
969450421 4:7269726-7269748 GAGATTAAGGTGTTGGGGGCTGG - Intronic
970364538 4:15345184-15345206 GTGTTAAAGGTGGTGGAGGTAGG - Intronic
971263254 4:25076157-25076179 GAGCAGCAGCTGGTGGAGGCTGG + Intergenic
972247275 4:37258662-37258684 GAGTGTCAGCAGGTGGAGGAAGG + Intronic
975027539 4:69569788-69569810 GACTGTGAGGTGGTGGAGGCAGG + Intergenic
977460926 4:97324093-97324115 GAGTTTATACTGGTGTAGGGTGG - Intronic
978933396 4:114345322-114345344 GAGTTTAACTTCCTGGAGGCTGG + Intergenic
979495908 4:121381592-121381614 GAGTTAGAGATGGTGGAGGGAGG - Intergenic
982077985 4:151757771-151757793 GAGTGGAAGCTGGTTGAGGCCGG - Intronic
983064411 4:163192529-163192551 CAGTTTAAGCTGCTGGAGCCTGG + Intergenic
986610117 5:9558748-9558770 GTGTTTGACTTGGTGGAGGCTGG - Intergenic
986750111 5:10779636-10779658 GAATGTAGTCTGGTGGAGGCTGG - Intergenic
987103483 5:14613774-14613796 CAGACTAAGCTGGTGGAGGATGG + Intronic
990509318 5:56476046-56476068 GAGGTCAAACTGGTGCAGGCTGG - Intronic
990585059 5:57202740-57202762 GATTGTAAGCTGTTAGAGGCAGG + Intronic
990936219 5:61152805-61152827 GAGTTTGAACTGGTGGAGGCAGG - Exonic
994107310 5:95961708-95961730 GAGTTTAAGATGGCGGCGGGGGG - Exonic
995604987 5:113844545-113844567 GAGTTTACTTTGGTGGAGGAAGG + Intergenic
996090482 5:119346243-119346265 CAGTGGAAGCTGCTGGAGGCTGG + Intronic
998960367 5:147480013-147480035 GAGTATAAAGTGGTGAAGGCTGG - Intronic
999844321 5:155461832-155461854 CATTGTAAGCTGCTGGAGGCTGG + Intergenic
1001413923 5:171529681-171529703 GAGATAAAGCTGTTGAAGGCAGG - Intergenic
1002688197 5:181031991-181032013 GAGTGTAGGCTGGGGCAGGCAGG + Intergenic
1002804517 6:559964-559986 GAGATGAAGCAGGTGCAGGCAGG - Intronic
1003368285 6:5498482-5498504 GAGTTTAAGTTGCTTGAGGGAGG + Intronic
1007585435 6:42986256-42986278 GAGGAGAAGCTGGGGGAGGCTGG - Intronic
1010574028 6:77510419-77510441 CAGTTTGAGCTGCTGGAGCCAGG + Intergenic
1011625623 6:89281220-89281242 GATTTTAAGCTCCTGGAGGAAGG - Intronic
1011790181 6:90890571-90890593 GAGGTTCGGCTGGTCGAGGCTGG - Intergenic
1017723409 6:157260045-157260067 GAGGATAATCTGGTGGAGGAAGG - Intergenic
1021398966 7:20187491-20187513 GAGTTTAAGCTGTGGGAAGAGGG - Intronic
1025144372 7:56491942-56491964 GAGTTGAAGAGGTTGGAGGCTGG + Intergenic
1025259977 7:57412421-57412443 GAGTTGAAGAGGTTGGAGGCTGG + Intergenic
1026226639 7:68447746-68447768 GAGATTAAGCAGGTGGGGTCTGG + Intergenic
1028458364 7:91062831-91062853 GGGTTTCAGCTGGTGTTGGCTGG + Intronic
1028656815 7:93218247-93218269 GATTTTAAGCTGAAGGAGGCAGG + Intronic
1028909754 7:96194906-96194928 GAGTTTCAGCTGAGGCAGGCTGG - Intronic
1029446831 7:100618084-100618106 AAGTGTAAGCTACTGGAGGCAGG - Intergenic
1030621822 7:111798293-111798315 CAGTTTGAGCTGCTGGAGCCAGG - Intronic
1032128574 7:129211777-129211799 GAGTTCAAGCTTCTGGAGGAAGG + Intronic
1041318911 8:56593712-56593734 GAGTGTGGGCTGGAGGAGGCAGG + Intergenic
1042521738 8:69719843-69719865 GAGTTTAAGCACTTTGAGGCGGG - Intronic
1048123360 8:131606527-131606549 GAGCTTCAGCTGGTGGGAGCTGG - Intergenic
1048609594 8:136007767-136007789 GAGATGAAGCTGATGGAGCCAGG - Intergenic
1053351393 9:37415566-37415588 GTGTTCTAGCTGGGGGAGGCTGG + Intergenic
1054922529 9:70556348-70556370 GAGTAAAAGGTGGGGGAGGCTGG - Intronic
1055353155 9:75410656-75410678 GAGTTTAAGCTTGGGGCTGCTGG + Intergenic
1057984220 9:99693431-99693453 AAATTAAAGCTGCTGGAGGCAGG - Intergenic
1058767344 9:108194647-108194669 GAGAATGAGCTGGAGGAGGCAGG - Intergenic
1058889518 9:109348971-109348993 GAGCTTTGGCAGGTGGAGGCAGG - Intergenic
1059392156 9:114006061-114006083 GAGGTGAAGCTGGTGGTGGGAGG + Intronic
1061262976 9:129490118-129490140 GAATTCAAACTGGTGGAGGAAGG + Intergenic
1061279275 9:129587809-129587831 TACTTTAAGATGGTGGAGACCGG + Intergenic
1188401996 X:29756839-29756861 GAGGTTATGCTGGTGTAGGGTGG + Intronic
1188520190 X:31030149-31030171 GACTTTAAGTTGATGGAGGGTGG + Intergenic
1189003633 X:36972182-36972204 GAGCTTCAGCTGGTGGTGGGGGG - Intergenic
1189280463 X:39817238-39817260 GAGTTTGAGGTGGTGGAGCCGGG + Intergenic
1195777317 X:108421790-108421812 AAATTTATGATGGTGGAGGCGGG + Intronic
1196949311 X:120860713-120860735 GAGCCTAAGAGGGTGGAGGCTGG - Intergenic
1198046140 X:132904844-132904866 GAGTGTAAGCTGGTACAAGCAGG - Intronic
1198325933 X:135573242-135573264 GAGATGAAGCTGGAGTAGGCAGG + Intronic
1199893395 X:152110067-152110089 GAGTTCAGCCTGGTGGGGGCAGG - Intergenic
1199953627 X:152725318-152725340 GAGTTCAGCCCGGTGGAGGCAGG + Intergenic
1201571710 Y:15422290-15422312 GAGATTAAGCTGGAAGTGGCAGG + Intergenic
1201853397 Y:18514441-18514463 GAGATTAAACTGGTGGAAGATGG + Intergenic
1201879924 Y:18805943-18805965 GAGATTAAACTGGTGGAAGATGG - Intronic