ID: 1159966597

View in Genome Browser
Species Human (GRCh38)
Location 18:74601106-74601128
Sequence GACACTGATGTGTCTGCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159966597 Original CRISPR GACACTGATGTGTCTGCTTC GGG Intronic
901197028 1:7445975-7445997 GACACAGCTGTGGCTGCTCCAGG + Intronic
903948802 1:26981641-26981663 CACACTGATTTTTCTGCCTCAGG + Intergenic
907312334 1:53546063-53546085 GACAGTGGTGTGCCTGCATCAGG + Intronic
908569791 1:65397243-65397265 GACACTCAGATGTCTGCTTTGGG + Intronic
908612663 1:65880053-65880075 GATGCTGATGTGTCTGTGTCTGG + Intronic
909948756 1:81693778-81693800 GCCACTGATTTGTCTCCTGCTGG - Intronic
913226011 1:116698950-116698972 GATTCTGATGTGACTGGTTCAGG - Intronic
913286322 1:117229965-117229987 GACACTGATGGCTCTACCTCAGG - Intergenic
918517311 1:185377134-185377156 GACACTGAGGGGTCAGCTGCTGG + Intergenic
919836212 1:201575239-201575261 GAGAGAGATGTGTCTTCTTCAGG + Intergenic
920117133 1:203628957-203628979 CCCACAGATTTGTCTGCTTCAGG - Intronic
921095738 1:211885861-211885883 GACTTTAATCTGTCTGCTTCAGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923566278 1:235078973-235078995 GCCACAGGTGTGTCTCCTTCAGG - Intergenic
924178219 1:241414303-241414325 GAAAGGGAAGTGTCTGCTTCTGG + Intergenic
1063662870 10:8046011-8046033 AACCCAGATGTGTCTGCATCTGG + Intergenic
1066067374 10:31772182-31772204 GGCACTGATGTGTCTCAATCTGG - Intergenic
1071822457 10:89292311-89292333 GGCACTGATTTGTCTTCTTCTGG + Intronic
1074492947 10:113955319-113955341 GACCATGATGTGTCTGGTCCAGG - Intergenic
1074934091 10:118160273-118160295 GACACTGATGTGGCTGTCACAGG - Intergenic
1075927031 10:126259901-126259923 GACAGTGATGAGTCTGGTTTAGG + Intronic
1076449175 10:130544455-130544477 GACACTGATGTCACTCCTTCAGG + Intergenic
1077819272 11:5720013-5720035 GACACAGATGTGTGTGGTGCAGG - Intronic
1079402875 11:20119880-20119902 GACAATGATCTGTCTGGTGCAGG + Intronic
1080813575 11:35730522-35730544 GACTCTGATGTGTCTGGCTATGG - Intronic
1081987682 11:47318365-47318387 GACATGTATGTTTCTGCTTCAGG - Intronic
1086159231 11:83702689-83702711 GACACTGATCTGTCTCTTCCTGG + Intronic
1087546892 11:99595913-99595935 GATACTGATGTGGCTGGTTAGGG - Intronic
1088844148 11:113650815-113650837 GATGCTGATGTGTCTGGTCCAGG + Intergenic
1091406521 12:212938-212960 GAAATTGGTGTGTTTGCTTCTGG - Intronic
1091865863 12:3836141-3836163 GACTTTGATGTGTCTGCATTTGG - Intronic
1094504559 12:31050704-31050726 GAAACTGATCTGGCTGGTTCTGG - Intergenic
1096515028 12:52151041-52151063 GTCACTGATGTGCCTTCTTTGGG + Intergenic
1097310760 12:58116566-58116588 TACATAGATGTGTCTGTTTCTGG - Intergenic
1101511578 12:105397848-105397870 GGAACTGATGGGTCTGCTTCTGG - Intergenic
1103210073 12:119159160-119159182 GGGACTGATGTGCCTCCTTCTGG - Exonic
1106621167 13:31372630-31372652 GGCACTGAGGTGTCAGCCTCAGG - Intergenic
1109652109 13:65341638-65341660 ACCACTGATCTATCTGCTTCTGG + Intergenic
1111748765 13:92300468-92300490 GACACTGATGTTGCTATTTCAGG + Intronic
1116774812 14:49167170-49167192 GACACTGATATGGCAGATTCAGG - Intergenic
1127645959 15:60959638-60959660 GACACTAATATGTCTGCATCTGG - Intronic
1127827202 15:62714866-62714888 CACACTGATGTGGATGCTTTGGG - Intronic
1129553118 15:76474885-76474907 GAAACAGATGAGTCTCCTTCTGG - Intronic
1131688295 15:94795214-94795236 GACAATGTAGTGTTTGCTTCGGG + Intergenic
1131894563 15:97012358-97012380 GACACTGATGCTTCTGTTGCAGG - Intergenic
1132016190 15:98319553-98319575 GTCACTGATGTCTCTTCTCCAGG + Intergenic
1133505758 16:6410663-6410685 CACACTGATGTTGCTGCCTCTGG + Intronic
1133853395 16:9526836-9526858 GACTCTGATGTTGCTGCATCGGG + Intergenic
1138392585 16:56681517-56681539 GACACTGCTGGGTCTGAATCCGG - Intronic
1138864731 16:60802978-60803000 CACACTGACGTGTCTGCTCGAGG - Intergenic
1139312227 16:66037296-66037318 GACAGTTATGTGTCTGCTGCTGG - Intergenic
1141899365 16:86980632-86980654 GACACTGTTGTGAAAGCTTCAGG + Intergenic
1144386720 17:14755006-14755028 GACATTGGTGTGGCTTCTTCAGG - Intergenic
1145029386 17:19493136-19493158 TGCTCTGGTGTGTCTGCTTCTGG - Intergenic
1148874776 17:50680456-50680478 GACACTGATGCTGCAGCTTCTGG - Intronic
1149840787 17:59963252-59963274 GACCCAGATGTCTTTGCTTCAGG + Exonic
1150244901 17:63667037-63667059 GACAGAGAGGTGCCTGCTTCTGG - Exonic
1152814160 17:82397656-82397678 GGCACTGCTGTGTCTGCAGCAGG + Intronic
1155414276 18:25580985-25581007 AACACTGCTGTGGCTGCTTGTGG - Intergenic
1155653406 18:28168249-28168271 GATACTGATTTGTTTGCTGCTGG - Intronic
1156101113 18:33595894-33595916 GACAGGGATATGTCAGCTTCAGG + Intronic
1157749016 18:50161647-50161669 GTCACTGATCCTTCTGCTTCAGG - Intronic
1159966597 18:74601106-74601128 GACACTGATGTGTCTGCTTCGGG + Intronic
1160800485 19:965443-965465 GACACTGCTGTGTGTGCTGTTGG - Intronic
1161066721 19:2242265-2242287 GACACGGCTGTATCAGCTTCTGG + Intronic
1162228416 19:9244012-9244034 GTCACTGATGGGTCTGATACTGG - Intergenic
1163023467 19:14495999-14496021 GAGAAGGATGTGTCTGCTCCGGG - Intronic
1163681554 19:18685067-18685089 GCCACTGATGTGACTGGCTCAGG + Intronic
1164907793 19:31981750-31981772 GACAGTGATGAGTCTGCATAGGG - Intergenic
1168263568 19:55209086-55209108 GACACTGTCGTGTCTGCTGCGGG - Intronic
1168263590 19:55209184-55209206 GATACTGTCGTGTCTGCTGCGGG - Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925350789 2:3199711-3199733 GACATGGGTGTGTCTGCATCTGG + Intronic
925350804 2:3199774-3199796 GACAGGGGTGTGTCTGCATCTGG + Intronic
925350824 2:3199863-3199885 GACATGGGTGTGTCTGCATCTGG + Intronic
927998113 2:27500629-27500651 GACACTGATGTTGCTGGTGCAGG - Intronic
930135135 2:47895571-47895593 TACACAGATGTGTTTACTTCAGG + Intronic
930552843 2:52857278-52857300 GGCACAGATGTTTCTGCTTTGGG - Intergenic
930657223 2:54018305-54018327 TACACTGATGTTGCTGATTCAGG + Intronic
930877794 2:56239137-56239159 GACACTGAAATGTCTGCTTAGGG - Intronic
937024214 2:118683909-118683931 GACCCTGATGTGTCTTCTTCAGG + Intergenic
938252122 2:129823304-129823326 GACACTGCTGTGCCTGCCTGTGG - Intergenic
938275309 2:130015397-130015419 GATTCTGATATGTCAGCTTCTGG - Intergenic
938326267 2:130406134-130406156 GATTCTGATATGTCAGCTTCTGG - Intergenic
938363671 2:130715325-130715347 GATTCTGATATGTCAGCTTCTGG + Intergenic
938929736 2:136076160-136076182 GGCACTGATGTTTCTGCAACTGG + Intergenic
948025374 2:234772214-234772236 TACACGGATATGGCTGCTTCTGG - Intergenic
948537498 2:238657057-238657079 GACACTGATGTGTCTGCTGCGGG + Intergenic
1170480490 20:16760538-16760560 GAAACCTATGTGTCTGCTTGCGG - Intronic
1171351915 20:24509108-24509130 CACACTAAGGTGTCTGCATCAGG - Intronic
1172026952 20:31955037-31955059 GACACTGCTGTGTATGCCTGTGG + Intergenic
1173404610 20:42753716-42753738 GACACTGATTTGTCCTCTGCTGG - Intronic
1181004191 22:20002184-20002206 GTCACGGATGTGTCTACCTCTGG + Intronic
950167904 3:10815707-10815729 GACGCTGATATGTCTGGTCCAGG - Intergenic
950270379 3:11610080-11610102 TGCACTGATGTGTCTCCTTCAGG + Intronic
950681528 3:14588519-14588541 GCCACTGATGTGTACCCTTCTGG + Intergenic
956662368 3:71611800-71611822 AACAAAGGTGTGTCTGCTTCTGG - Intergenic
957425875 3:80038080-80038102 CACCCTGATGTGCTTGCTTCAGG + Intergenic
962130387 3:132667140-132667162 GATACTGATGTTACTACTTCAGG - Intronic
962526053 3:136238429-136238451 GACCTTGCTGTGACTGCTTCTGG - Intergenic
962927331 3:140007254-140007276 AACTCAGATCTGTCTGCTTCTGG - Intronic
965074676 3:163960596-163960618 TACATTGATGTTTGTGCTTCTGG - Intergenic
965610821 3:170542230-170542252 GAAACTGAGGTCTTTGCTTCAGG - Intronic
969134868 4:5021398-5021420 GGCACAGATGTGTTTTCTTCTGG + Intergenic
969973689 4:11074682-11074704 GATGCTGATGTTTCTGCTCCAGG - Intergenic
971554308 4:27993895-27993917 GCCACTGATGAGTCTGCCTATGG + Intergenic
971748857 4:30620030-30620052 GACGCTGATGTGGCTGATCCTGG + Intergenic
971826971 4:31636488-31636510 GACACTTGTGTGTCTTCTTTAGG - Intergenic
974862002 4:67533675-67533697 AACAGTAATCTGTCTGCTTCTGG - Intronic
976773515 4:88681354-88681376 GAAACTGTTGTGGCTGCCTCTGG + Intronic
976989530 4:91348443-91348465 GTAACTGATTTGTCTGGTTCTGG + Intronic
979426142 4:120570380-120570402 GATACTGTTGTGGCTGCTCCAGG - Intergenic
981533278 4:145773742-145773764 GACAGTGATGGGTTTGTTTCAGG + Intronic
982130516 4:152224891-152224913 GCCACTGAAGTTTGTGCTTCAGG - Intergenic
984471014 4:180173778-180173800 AGCACTGAAGTGTTTGCTTCAGG - Intergenic
988158698 5:27491146-27491168 AACATTGATTTCTCTGCTTCAGG + Intergenic
992987470 5:82247872-82247894 GCCACTGATGTCTTTGCTACTGG + Intronic
993060314 5:83030485-83030507 AACACTGATGTATTTGCTGCAGG + Intergenic
997059941 5:130488772-130488794 GACACTGTTGTGCTGGCTTCAGG + Intergenic
998587299 5:143440347-143440369 GAAACTGCTGTGTGAGCTTCAGG + Intergenic
999277057 5:150338537-150338559 GCCACTCAGGTGGCTGCTTCAGG - Intronic
1000382089 5:160638411-160638433 GGAACTGTTGTTTCTGCTTCAGG - Intronic
1001840287 5:174870469-174870491 GACTCTGATATTTCTACTTCAGG + Intergenic
1001942403 5:175750119-175750141 GAAACTGATGAGTGGGCTTCAGG - Intergenic
1002778169 6:346303-346325 GACACTGTTGTTTTTTCTTCAGG + Intronic
1003989190 6:11469083-11469105 GATGCTGATGTTGCTGCTTCTGG + Intergenic
1007712428 6:43833272-43833294 GACTCTGATGGGTCTGCTCTGGG + Intergenic
1011177542 6:84581308-84581330 GACACTGATGGGTCTGTAGCAGG + Intergenic
1011856351 6:91696821-91696843 GACATTGATGATTCTGATTCTGG + Intergenic
1016767910 6:147815542-147815564 GTCCCTGCTGTGTCTGCCTCAGG - Intergenic
1017872803 6:158501535-158501557 GACAGAGACGTGTCTGCTTGGGG - Intronic
1019975629 7:4579131-4579153 GATACTGCTGTGGCTGCTTTTGG - Intergenic
1022010502 7:26304428-26304450 AAGACTGCTCTGTCTGCTTCTGG - Intronic
1022411583 7:30142507-30142529 GACGCTCATGTGGCTGGTTCTGG - Intronic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1023247872 7:38225851-38225873 GACACGGATGTGTCTGCATGTGG + Intronic
1024710540 7:52010470-52010492 GACACTGAAGTTTCCTCTTCCGG + Intergenic
1026428140 7:70316960-70316982 AACATTGATGTTTCTGCATCTGG + Intronic
1029446833 7:100618091-100618113 GACACTGAAGTGTAAGCTACTGG - Intergenic
1029696500 7:102217153-102217175 GACACAGATGGCCCTGCTTCAGG - Intronic
1031592377 7:123609446-123609468 GACACTGATGTGACAGGTGCTGG + Intronic
1032112745 7:129090844-129090866 GGCTCTGATGTGTGTGATTCAGG + Intergenic
1035606015 8:930072-930094 CACACTGATGTGTTTGCATCGGG + Intergenic
1037015679 8:13903253-13903275 GACACAGATGTGTCTGTCTTGGG - Intergenic
1039355534 8:36811446-36811468 GACACTGCTGTATCATCTTCTGG - Intronic
1040658175 8:49537192-49537214 GACACTGTTGTGTCTGATTCTGG + Exonic
1041864024 8:62547957-62547979 GATACTGATGTGGATGCTGCTGG + Intronic
1042510955 8:69610403-69610425 GAAACAGGTTTGTCTGCTTCTGG - Intronic
1044108673 8:88244150-88244172 TACACTGCAGTGTTTGCTTCAGG - Intronic
1046459332 8:114512367-114512389 GACACTCATCTTTCAGCTTCTGG - Intergenic
1048181962 8:132203377-132203399 GACCCTGATGTGTCCAGTTCAGG - Intronic
1048446315 8:134496034-134496056 GCCACAGCTGTTTCTGCTTCTGG - Intronic
1050002486 9:1092913-1092935 GTCTCTGAAGTGTCTGCTTTTGG - Intergenic
1056810753 9:89762137-89762159 CACACTGATGTGTCTGCATAGGG - Intergenic
1057149058 9:92779989-92780011 GACACTGATGACTCTATTTCTGG + Intergenic
1058015130 9:100023082-100023104 GACAATAATCTGTCTGCTTTAGG + Intronic
1058975820 9:110124645-110124667 GACACTGATGTCTCTACTCAAGG + Intronic
1060656371 9:125375113-125375135 GAACCTGGTGTGTCTGCCTCGGG - Intergenic
1061739875 9:132694495-132694517 GACACTGATATGTAATCTTCAGG - Exonic
1186517066 X:10174103-10174125 GACACTTTGGTGTCTGCCTCTGG + Intronic
1192478362 X:71463698-71463720 GACACTAAAGTGACTGGTTCTGG - Intronic
1194052922 X:89094325-89094347 GAGAGGGAAGTGTCTGCTTCTGG - Intergenic
1196345057 X:114645392-114645414 GAAACTGATGTCTGTGTTTCAGG - Intronic
1197673517 X:129304623-129304645 GACAGTGAAGTGATTGCTTCAGG + Intergenic
1199991864 X:152991952-152991974 GACTCTGCTGTGTGTGCTTCGGG + Exonic
1201397849 Y:13567924-13567946 GAGAATGATTCGTCTGCTTCTGG + Intergenic
1201436258 Y:13961956-13961978 GACACCCCTGTCTCTGCTTCTGG + Intergenic