ID: 1159966956

View in Genome Browser
Species Human (GRCh38)
Location 18:74604346-74604368
Sequence TGGACATAGCAGACAAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159966956_1159966960 -9 Left 1159966956 18:74604346-74604368 CCTTTGCTTGTCTGCTATGTCCA No data
Right 1159966960 18:74604360-74604382 CTATGTCCACCAGGGGTCTTAGG No data
1159966956_1159966963 21 Left 1159966956 18:74604346-74604368 CCTTTGCTTGTCTGCTATGTCCA No data
Right 1159966963 18:74604390-74604412 CACACTTCCCAGACCTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159966956 Original CRISPR TGGACATAGCAGACAAGCAA AGG (reversed) Intronic