ID: 1159966961

View in Genome Browser
Species Human (GRCh38)
Location 18:74604366-74604388
Sequence GTTAAACCTAAGACCCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159966961_1159966970 29 Left 1159966961 18:74604366-74604388 CCACCAGGGGTCTTAGGTTTAAC No data
Right 1159966970 18:74604418-74604440 CTTGAACAGTCTGTGAAGAAGGG No data
1159966961_1159966971 30 Left 1159966961 18:74604366-74604388 CCACCAGGGGTCTTAGGTTTAAC No data
Right 1159966971 18:74604419-74604441 TTGAACAGTCTGTGAAGAAGGGG No data
1159966961_1159966969 28 Left 1159966961 18:74604366-74604388 CCACCAGGGGTCTTAGGTTTAAC No data
Right 1159966969 18:74604417-74604439 ACTTGAACAGTCTGTGAAGAAGG No data
1159966961_1159966963 1 Left 1159966961 18:74604366-74604388 CCACCAGGGGTCTTAGGTTTAAC No data
Right 1159966963 18:74604390-74604412 CACACTTCCCAGACCTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159966961 Original CRISPR GTTAAACCTAAGACCCCTGG TGG (reversed) Intronic