ID: 1159966963

View in Genome Browser
Species Human (GRCh38)
Location 18:74604390-74604412
Sequence CACACTTCCCAGACCTCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159966956_1159966963 21 Left 1159966956 18:74604346-74604368 CCTTTGCTTGTCTGCTATGTCCA No data
Right 1159966963 18:74604390-74604412 CACACTTCCCAGACCTCCATAGG No data
1159966961_1159966963 1 Left 1159966961 18:74604366-74604388 CCACCAGGGGTCTTAGGTTTAAC No data
Right 1159966963 18:74604390-74604412 CACACTTCCCAGACCTCCATAGG No data
1159966962_1159966963 -2 Left 1159966962 18:74604369-74604391 CCAGGGGTCTTAGGTTTAACTCA No data
Right 1159966963 18:74604390-74604412 CACACTTCCCAGACCTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159966963 Original CRISPR CACACTTCCCAGACCTCCAT AGG Intronic