ID: 1159968661

View in Genome Browser
Species Human (GRCh38)
Location 18:74621902-74621924
Sequence GAGGACTAGCACATAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159968661_1159968664 14 Left 1159968661 18:74621902-74621924 CCAGTGTTTATGTGCTAGTCCTC 0: 1
1: 0
2: 0
3: 8
4: 116
Right 1159968664 18:74621939-74621961 GACCCTATTACATCTACACGTGG 0: 1
1: 0
2: 0
3: 4
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159968661 Original CRISPR GAGGACTAGCACATAAACAC TGG (reversed) Intronic
901403056 1:9027460-9027482 GAGGAGCAGCAAACAAACACTGG - Intergenic
901471808 1:9461919-9461941 CAGCCCTAGCAAATAAACACAGG + Intergenic
912900895 1:113647164-113647186 AAGGAATAGCACATGCACACTGG + Intronic
1064710298 10:18116552-18116574 AAGGTCTAACACATAAGCACTGG - Intergenic
1068002587 10:51353249-51353271 GAGTAATACCACACAAACACAGG + Intronic
1071903341 10:90144674-90144696 GAAGACTAGCAGACAAACAGTGG - Intergenic
1077223470 11:1427435-1427457 GCAGACTAGCACGTTAACACGGG - Intronic
1077900765 11:6486328-6486350 GAGGACTGGGAAATAACCACCGG - Intronic
1080888485 11:36388175-36388197 ATGGGCTAGCAAATAAACACTGG - Intronic
1085216034 11:74833141-74833163 GAGGAATAACACAGAAATACTGG + Intronic
1085571573 11:77562761-77562783 GAGTAATAGCTCATAAACACAGG - Intronic
1086561799 11:88176983-88177005 TAGAACTAGGACTTAAACACAGG + Intergenic
1087299865 11:96419758-96419780 GAGTAATACCCCATAAACACAGG + Intronic
1087317521 11:96621155-96621177 GAGGACAAGAAAATAAAGACAGG - Intergenic
1088645045 11:111911341-111911363 GAGGACTATCAAATAGAAACAGG + Intronic
1089492039 11:118889904-118889926 GAGGACAAGCCCAGAAACCCAGG + Intronic
1090111615 11:123916502-123916524 GAGAAATACCACATAAGCACTGG + Intergenic
1094201081 12:27795025-27795047 GGGGATTACTACATAAACACAGG - Intronic
1099770504 12:87047378-87047400 AAGGACTTGCACATAAAGATGGG + Intergenic
1100449393 12:94690815-94690837 CAGGACTAGCTCATAAGCAATGG + Intergenic
1102592121 12:113964704-113964726 GAGGCCTAGCAGATAGTCACTGG + Intronic
1103019144 12:117519847-117519869 TTGGAGAAGCACATAAACACCGG + Intronic
1103999910 12:124853961-124853983 GATGCCTAGCACATAATCGCAGG - Intronic
1104063352 12:125286222-125286244 GAGAACCAGCACATAATCCCAGG + Intronic
1104082590 12:125443470-125443492 AGGGACTAACACATAATCACAGG - Intronic
1104629055 12:130384456-130384478 GAGTACCAGCACATAGGCACGGG + Intergenic
1105545655 13:21348733-21348755 GAGGACAAGCACAAAATCTCTGG + Intergenic
1106581088 13:31018925-31018947 GAGGAGTAGCATTTACACACTGG - Intergenic
1107337464 13:39370316-39370338 GAGCTCTAGCACAGAATCACAGG - Intronic
1109085014 13:57959491-57959513 TAAGACTAGTACATAAAGACAGG - Intergenic
1118430431 14:65713907-65713929 GAGTAATACCACATAAACACAGG - Intronic
1121328305 14:93034461-93034483 GAGGAAAAGCACAGAAATACAGG - Intronic
1121827422 14:97021867-97021889 GTGGACTAGCACGTAGACATGGG - Intergenic
1123143258 14:106104277-106104299 GGGGAAAAGCAAATAAACACGGG - Intergenic
1126233607 15:46355455-46355477 AAGGACTAGCTCAAAAACTCTGG + Intergenic
1127174006 15:56334605-56334627 GAGTAATACCCCATAAACACAGG + Intronic
1127800998 15:62477506-62477528 GAGGACAAGCACATAGATGCAGG - Intronic
1131352885 15:91717756-91717778 GAAAACTAGGAGATAAACACAGG - Intergenic
1131928208 15:97409935-97409957 GTGGAACAGCACCTAAACACTGG - Intergenic
1137632403 16:49956211-49956233 GAGGACCAGGACATTACCACAGG - Intergenic
1137918071 16:52454665-52454687 TAGGACTACCACATAAAAAGAGG + Intronic
1139130118 16:64132905-64132927 GAGGACTAGCACCAAAAAACAGG + Intergenic
1139540420 16:67611142-67611164 GAGGAACAGCCCATAAACATAGG + Exonic
1143129780 17:4670842-4670864 GAGGACTAGCCCCAAAACAGAGG + Intergenic
1145962785 17:28897279-28897301 GAGGAGAAGCAAATAAACACAGG + Intronic
1150472647 17:65450203-65450225 TAGGAATAGCACATAAAACCTGG - Intergenic
1150753880 17:67892852-67892874 GTGGACTATCAGATAAACAGTGG - Intronic
1151267264 17:72966387-72966409 GAGGCTTAGCACATATACTCAGG + Intronic
1156863204 18:41862323-41862345 GAGAACTAGCAAATAAACTGTGG - Intergenic
1159968661 18:74621902-74621924 GAGGACTAGCACATAAACACTGG - Intronic
1164758403 19:30708183-30708205 GAGGACCAGTACATACACTCAGG + Intronic
926538371 2:14143118-14143140 GAGGACTAGTTCAGAAACATAGG + Intergenic
926785460 2:16513742-16513764 GATGAATAGTAAATAAACACAGG + Intergenic
927565203 2:24105514-24105536 CAGAACTAGCACAAAAACTCTGG + Intronic
929673567 2:43901049-43901071 GAGGCCTGGCATATATACACAGG + Intronic
930377165 2:50582598-50582620 CAAAACTAGCACATAAACATAGG + Intronic
930875992 2:56217220-56217242 GAGGACTAGGTGATAATCACAGG - Intronic
931548751 2:63418846-63418868 GAAGAAAAGCACAGAAACACAGG + Intronic
932594769 2:73087063-73087085 GAGGACAAGCACAGTAACAAGGG - Intronic
937037399 2:118793406-118793428 GGAGACTAGCTCATTAACACTGG + Intergenic
937211858 2:120278840-120278862 GAGGACCGGCACAGAAACAGCGG - Intronic
938578766 2:132627629-132627651 GGGGCCTAGCTCATAAACAAGGG + Intronic
946712395 2:222519704-222519726 GCGCACAAGGACATAAACACGGG - Intronic
948805251 2:240451134-240451156 GAGGGATGGCTCATAAACACTGG - Intronic
1170154576 20:13257799-13257821 GAGGACTGGCTCAAGAACACTGG - Intronic
1174642560 20:52057139-52057161 TAGGACTTGGACATAAACATGGG + Intronic
1179364553 21:40744553-40744575 GAGCACTGGAACTTAAACACTGG - Intronic
1181843739 22:25688605-25688627 GAGGACAAGAACAGAAACTCGGG - Intronic
951675481 3:25235549-25235571 GATGACTATCACAGACACACAGG - Intronic
952342360 3:32456912-32456934 GAGGACCAGCCCCTAAACCCAGG + Intronic
952350957 3:32537538-32537560 GAGAATTATCAGATAAACACAGG - Intronic
952943422 3:38459893-38459915 GAGGAGTAGAAAATAAACATGGG - Intronic
953996319 3:47522703-47522725 GGGGAATAGCTCATAAACAAAGG - Intergenic
953999553 3:47544966-47544988 TAGGACTCGCTCCTAAACACAGG + Intergenic
955696254 3:61640387-61640409 GAGGATCAACACATATACACTGG - Intronic
960234332 3:115264144-115264166 GAGGACCAGCACATAAAGGCAGG - Intergenic
964907189 3:161731841-161731863 GAGGCCTAACTCATATACACAGG + Intergenic
965473099 3:169119844-169119866 GAGGACTAGCAGATTAAAAAAGG - Intronic
966563941 3:181355214-181355236 GGAGACTAGGAAATAAACACAGG - Intergenic
968776953 4:2548010-2548032 CAGGAATGGCAAATAAACACAGG - Intronic
972384005 4:38546139-38546161 GAGTAATACCACACAAACACAGG - Intergenic
972868333 4:43262329-43262351 TAGGACTAGAGCATTAACACTGG + Intergenic
973870378 4:55160193-55160215 GAGGATTTGCACAGAAACATTGG + Intergenic
980804354 4:137792686-137792708 GTGGACTAACACACACACACAGG - Intergenic
982379848 4:154738671-154738693 GAGGACTGGCACAGAGCCACAGG - Intronic
991349411 5:65705358-65705380 CAGGAATATCACATAAACTCAGG + Intronic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
996916294 5:128715624-128715646 GAGGACCAGCAAGTAAATACTGG - Intronic
1000415081 5:160975880-160975902 GAGGACAAGCTCCTCAACACAGG - Intergenic
1000562901 5:162812648-162812670 GAGGCCAAGAACATCAACACAGG + Intergenic
1001887279 5:175304460-175304482 CAGAACTAGTCCATAAACACTGG + Intergenic
1003251251 6:4430857-4430879 GGGGATTAGGACTTAAACACAGG - Intergenic
1015127857 6:129774339-129774361 GAGGAAAAGCACATAAATACAGG + Intergenic
1017545278 6:155444399-155444421 GATGACTCGCACACAAACACTGG - Intronic
1017688211 6:156934831-156934853 GAAGACTAGTTCATAAAAACAGG - Intronic
1018891474 6:167986134-167986156 AAGGGCTACCACAGAAACACTGG - Intergenic
1024030403 7:45455730-45455752 GAAGAGTAGCACAGCAACACAGG + Intergenic
1024445937 7:49479173-49479195 AAGAACCAGCACAAAAACACTGG - Intergenic
1024449302 7:49520753-49520775 GAGAACTAGCACATGGTCACAGG + Intergenic
1024973458 7:55091694-55091716 CAGGAGTAGCACTTAAACAATGG + Intronic
1027555238 7:79655968-79655990 CTGGACTATCACATATACACTGG + Intergenic
1027596754 7:80183960-80183982 GAGCACCATCACATTAACACCGG - Intronic
1028293711 7:89100416-89100438 GAGTACTACCCCAAAAACACAGG + Intronic
1037025351 8:14028783-14028805 GAGTACTACCCCATAAGCACAGG + Intergenic
1037628100 8:20626030-20626052 GAAGACTACAACATAAAAACAGG + Intergenic
1037668237 8:20990731-20990753 GAGTAATACCCCATAAACACAGG - Intergenic
1044514539 8:93122965-93122987 ATGGACTAATACATAAACACAGG + Intergenic
1045891020 8:107157261-107157283 CAGAACAAGCACAGAAACACTGG - Intergenic
1047275867 8:123404519-123404541 GAGTACAAGCACAAAAAGACAGG - Intronic
1050578208 9:7021693-7021715 GAGTAATACCCCATAAACACAGG - Intronic
1051468429 9:17407012-17407034 GAGGAATAGAACATAAAAAGAGG + Intronic
1051894340 9:21972252-21972274 GAGGATTAGGACATAGACATTGG - Intronic
1058775118 9:108275610-108275632 GAGCACTAGCCCATTAACAGTGG + Intergenic
1191924073 X:66289979-66290001 GAGCAATACCCCATAAACACAGG - Intergenic
1193279961 X:79635828-79635850 GAGTAGTACCCCATAAACACAGG - Intergenic
1193979799 X:88168478-88168500 TAGAACTAGCACAAAAACTCTGG - Intergenic
1196033246 X:111114320-111114342 GATGCCTAGCACATAGGCACTGG + Intronic
1196061331 X:111411071-111411093 GATGAATAGCACAAAGACACTGG - Exonic
1196583816 X:117406574-117406596 TATGACTAGCAGATAAATACTGG + Intergenic
1196598854 X:117577718-117577740 GAGGAATATCCCACAAACACAGG - Intergenic
1197953393 X:131921609-131921631 GAGTAATACCCCATAAACACAGG + Intergenic
1200910941 Y:8530892-8530914 GAGTACTCCCACCTAAACACTGG - Intergenic
1200929058 Y:8680643-8680665 GAGTACTCCCACACAAACACTGG + Intergenic
1200964950 Y:9027328-9027350 GAGTACTCTCACATGAACACTGG + Intergenic
1202148158 Y:21821458-21821480 GAGTACTCTCACATGAACACTGG - Intergenic