ID: 1159969322

View in Genome Browser
Species Human (GRCh38)
Location 18:74629779-74629801
Sequence TTGGCTGAACATTCCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159969319_1159969322 7 Left 1159969319 18:74629749-74629771 CCTTTTTATTAACGTGGAATCAA 0: 1
1: 0
2: 0
3: 13
4: 220
Right 1159969322 18:74629779-74629801 TTGGCTGAACATTCCCATCATGG 0: 1
1: 0
2: 2
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159969322 Original CRISPR TTGGCTGAACATTCCCATCA TGG Intronic
903352017 1:22723074-22723096 TGGGGTCAACATTCCCATTATGG + Intronic
905752474 1:40477626-40477648 TCTGCTCCACATTCCCATCAAGG - Exonic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
916454091 1:164952905-164952927 CTTGCTGAACAATCCCATAAAGG + Intergenic
917629772 1:176880141-176880163 TGGGCTGAACAATCCCAGCCAGG - Intronic
923306348 1:232692379-232692401 TTGGTTGACAATGCCCATCATGG - Intergenic
1064804786 10:19118690-19118712 CTGGCTTCACTTTCCCATCATGG + Intronic
1067988053 10:51174570-51174592 TGGTGTGAATATTCCCATCATGG + Intronic
1069705476 10:70456671-70456693 TTGGCTGCACTTTCCCATCAAGG - Intergenic
1078483679 11:11702700-11702722 TTGGCTGGTCACTACCATCATGG - Intergenic
1080852950 11:36086953-36086975 TTGGCAGAACAATCTCATAATGG - Intronic
1085504929 11:77053036-77053058 TTGGCATAACATCACCATCATGG - Intergenic
1086058053 11:82671510-82671532 TTGTTTAAGCATTCCCATCATGG - Intergenic
1099928512 12:89046851-89046873 TTAGCTGCCCATTCCCATTATGG - Intergenic
1104754171 12:131258513-131258535 TTGGAATAAAATTCCCATCAAGG - Intergenic
1106067269 13:26367002-26367024 CTGGTCGAACATTTCCATCATGG + Intronic
1109779598 13:67091558-67091580 TTGGCTCAGCATTTCCTTCAAGG + Intronic
1115377823 14:32697834-32697856 TTGCCTGAAAATTCCCATTCTGG + Intronic
1117177886 14:53164042-53164064 AAGCCTGAACAGTCCCATCACGG + Intergenic
1117391425 14:55266399-55266421 TTGGCTTAACAGTCTCCTCAGGG - Intergenic
1119806858 14:77487826-77487848 TTGGCTGCAGGTGCCCATCATGG - Intronic
1120453062 14:84695621-84695643 TCTGCTGCACATACCCATCAGGG - Intergenic
1122124455 14:99571529-99571551 GTGGCTGAACCTCCCCGTCAGGG - Intronic
1125242807 15:37595861-37595883 TTTGGGGGACATTCCCATCAGGG + Intergenic
1127671398 15:61198415-61198437 TTTGCTAAACATTCTCATCATGG + Intronic
1127883267 15:63176538-63176560 TTGGGTGAACCATCCCAGCAAGG - Intergenic
1128477243 15:68007752-68007774 TTGGGTAAACATTCCTATCGGGG - Intergenic
1130142880 15:81245667-81245689 CTCGCTGAACAGTCCCTTCATGG + Intronic
1130353523 15:83110685-83110707 TGGGCTGAAGAATCCCATGAGGG - Intronic
1140348985 16:74243537-74243559 TTGCCTGAACATTTCCCTCTAGG - Intergenic
1140485147 16:75287802-75287824 TGGGCTGGAGATTCCCATCTTGG - Intergenic
1149465743 17:56877654-56877676 TTGTCTCAACATTGTCATCAAGG - Intergenic
1155797959 18:30064420-30064442 TAGAATAAACATTCCCATCATGG + Intergenic
1156774869 18:40775140-40775162 TTGGATCAACATTCCAATCATGG + Intergenic
1158283295 18:55851107-55851129 ACAGCTGAACATTCCCATCATGG + Intergenic
1159969322 18:74629779-74629801 TTGGCTGAACATTCCCATCATGG + Intronic
1164402639 19:27912167-27912189 TTGGCTTAACAGTCCCTTCAGGG + Intergenic
1168512497 19:56984193-56984215 TTGGCTCAGCAATCCCATTATGG - Intergenic
934790175 2:97052845-97052867 TTGGCAGAACAATCAGATCACGG - Intergenic
934816295 2:97329692-97329714 TTGGCAGAACAATCAGATCACGG + Intergenic
934821401 2:97378792-97378814 TTGGCAGAACAATCAGATCACGG - Intergenic
935161190 2:100530864-100530886 TTGGCTAGACATTCACACCATGG + Intergenic
935782679 2:106521759-106521781 ATTTCTGATCATTCCCATCATGG - Intergenic
939020305 2:136950453-136950475 TTGGCAGAATATTACCATCTTGG - Intronic
1172260719 20:33562430-33562452 TTGGCAGGACCTTCCCATCTGGG + Exonic
1175527089 20:59642493-59642515 TAGGCTGAACAATCCCGACACGG - Intronic
1180589100 22:16921101-16921123 TTGGCAGAACAATCAGATCATGG - Intergenic
1184748489 22:46470708-46470730 TTGGCTCAGCATTCCCATACTGG - Intronic
949637052 3:5994620-5994642 TTGGATGTTCATTCCCTTCAAGG - Intergenic
952414727 3:33080563-33080585 TTGGCTGAAGGTTGCCCTCAGGG - Intronic
956254518 3:67269872-67269894 GTGGCATAACATTCGCATCAGGG - Intergenic
958188371 3:90152640-90152662 TTGGCTTAATATCCTCATCAGGG + Intergenic
958410895 3:93814474-93814496 TTGGCTTAATATCCTCATCAGGG + Intergenic
961124584 3:124405268-124405290 TGATCTGAACATTTCCATCAGGG - Intronic
962412353 3:135152400-135152422 TTGGCAGCAAATTCCCAACAGGG + Intronic
966674265 3:182568350-182568372 TTGGCTGGAAAGTCCCATCCAGG - Intergenic
971492928 4:27233283-27233305 TTTGCAGAACATTACCAGCATGG - Intergenic
971998080 4:33993321-33993343 CTGGCTTCCCATTCCCATCATGG + Intergenic
973250139 4:48051549-48051571 TTGGCTGGATATGCACATCAGGG + Intergenic
974036799 4:56824565-56824587 TTTGCTGAAGATTCTTATCAAGG + Intergenic
978764850 4:112393485-112393507 TTGGGTGAACATTTTCATCAAGG + Intronic
983513889 4:168636900-168636922 AGGGCTGAACATTCACATCCAGG - Intronic
985008734 4:185560619-185560641 TTGGCTGAACATGAGCATGAGGG - Intergenic
985925273 5:3011241-3011263 CTGGCTGAACATCGGCATCATGG - Intergenic
986989294 5:13532884-13532906 GAAGCTGAACATTTCCATCATGG - Intergenic
987974578 5:24996747-24996769 TTGACTCAACAATCCCATTAGGG + Intergenic
991727833 5:69553850-69553872 TGGGCTGAACACTCCAATTAAGG + Exonic
991867124 5:71074026-71074048 TGGGCTGAACACTCCAATTAAGG - Intergenic
993830570 5:92752733-92752755 CTCACTGAACATTCCCATCTGGG - Intergenic
996083260 5:119278197-119278219 TTGGCTAAACAGTGTCATCAGGG + Intronic
996381590 5:122867452-122867474 CTGGCTGATCATTCCCAATATGG + Intronic
997262143 5:132473639-132473661 TTGGCTTAAGATTCCCAGGAAGG - Intronic
997878725 5:137571300-137571322 CTTTCTGAACATCCCCATCAGGG + Intronic
1007723263 6:43898742-43898764 TTGACTCTACATACCCATCACGG + Intergenic
1011278239 6:85650731-85650753 TTCACTGAACATGTCCATCATGG + Intergenic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1013558252 6:111279102-111279124 TTGGCTGCACATTACAATTACGG - Intergenic
1016244332 6:141964952-141964974 TTCCCTGAACATCTCCATCAAGG + Intergenic
1016828677 6:148411918-148411940 TTGGGTGAATATTCCCATTATGG - Intronic
1016850073 6:148609954-148609976 AAGGCTGAACATTCCCAGGAAGG - Intergenic
1020856977 7:13439938-13439960 TTGGCTGCACTTTCACATCATGG - Intergenic
1024526359 7:50353325-50353347 TTGGCTGAAACTGCTCATCATGG - Intronic
1025082079 7:55992586-55992608 TTGGCTGAGCATTCTCTTCCTGG - Intronic
1029042878 7:97596485-97596507 TTGGGTGAAAACTCCCATCATGG - Intergenic
1029354521 7:100041943-100041965 TTGGCTCCCCCTTCCCATCATGG - Intergenic
1029640887 7:101817863-101817885 TTGGCTGAACTTTCCTAACCTGG + Intronic
1029869409 7:103674530-103674552 TTGGGTGAGGATTCCCATGAGGG + Intronic
1031195835 7:118611894-118611916 TTTGGTGACCATTCTCATCAGGG - Intergenic
1031950839 7:127890458-127890480 TGGGCTGAATATGCCCAGCATGG - Intronic
1033639351 7:143246278-143246300 TTGACTGAACATTGGCATGAGGG - Intronic
1035181358 7:157091769-157091791 TAGGCAGAAAATTCCCACCAAGG + Intergenic
1035193208 7:157190593-157190615 TTGGCTCAGTATTCCCACCATGG + Intronic
1037306554 8:17510727-17510749 TTGGCCCAGCAGTCCCATCATGG + Intronic
1038915131 8:32013010-32013032 TTCACTGAAAATTCCCATTAGGG - Intronic
1039786974 8:40842367-40842389 TTGGCTTAGCATTTCCTTCAAGG + Intronic
1044020850 8:87104036-87104058 ATGGCTGACCATGACCATCATGG - Intronic
1046009765 8:108532164-108532186 TAGGTTGAAGATTCTCATCATGG + Intergenic
1048805390 8:138236496-138236518 TTGGTTAAACATTCACATCATGG + Intronic
1051197018 9:14573194-14573216 TTGGCTGTACATTCCCAGCAGGG - Intergenic
1061560891 9:131402246-131402268 GTGGCTCAACATTGCCACCATGG - Intronic
1061757444 9:132824897-132824919 TTGGCCCAACAATCCCATGAGGG + Intronic
1062000422 9:134213148-134213170 ATGCCTCAATATTCCCATCATGG + Intergenic
1203759605 EBV:5269-5291 CTGGCTGAACATTAGCATCCCGG + Intergenic
1192916827 X:75660687-75660709 TTTGTTGAACATTCCCTCCAGGG + Intergenic
1193557125 X:82968654-82968676 GAGCCTGAACATCCCCATCAGGG + Intergenic
1196986883 X:121282944-121282966 AGGGCTCCACATTCCCATCACGG - Intergenic
1197344248 X:125313141-125313163 TTCCCTGTACATTTCCATCATGG - Intergenic