ID: 1159973412

View in Genome Browser
Species Human (GRCh38)
Location 18:74680626-74680648
Sequence AAGCTGGTTTATAGGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159973406_1159973412 16 Left 1159973406 18:74680587-74680609 CCTCTGTTTTTTTGTATGTGTGG 0: 1
1: 0
2: 2
3: 88
4: 894
Right 1159973412 18:74680626-74680648 AAGCTGGTTTATAGGAATGAAGG 0: 1
1: 0
2: 0
3: 20
4: 206
1159973405_1159973412 17 Left 1159973405 18:74680586-74680608 CCCTCTGTTTTTTTGTATGTGTG 0: 1
1: 0
2: 25
3: 239
4: 2194
Right 1159973412 18:74680626-74680648 AAGCTGGTTTATAGGAATGAAGG 0: 1
1: 0
2: 0
3: 20
4: 206
1159973404_1159973412 18 Left 1159973404 18:74680585-74680607 CCCCTCTGTTTTTTTGTATGTGT 0: 1
1: 0
2: 12
3: 160
4: 1667
Right 1159973412 18:74680626-74680648 AAGCTGGTTTATAGGAATGAAGG 0: 1
1: 0
2: 0
3: 20
4: 206
1159973403_1159973412 21 Left 1159973403 18:74680582-74680604 CCGCCCCTCTGTTTTTTTGTATG 0: 1
1: 0
2: 5
3: 59
4: 758
Right 1159973412 18:74680626-74680648 AAGCTGGTTTATAGGAATGAAGG 0: 1
1: 0
2: 0
3: 20
4: 206
1159973402_1159973412 22 Left 1159973402 18:74680581-74680603 CCCGCCCCTCTGTTTTTTTGTAT 0: 1
1: 0
2: 4
3: 108
4: 1275
Right 1159973412 18:74680626-74680648 AAGCTGGTTTATAGGAATGAAGG 0: 1
1: 0
2: 0
3: 20
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159973412 Original CRISPR AAGCTGGTTTATAGGAATGA AGG Intronic
901281290 1:8037226-8037248 AACCTGGATTCTAGGGATGAAGG + Intergenic
903364420 1:22797246-22797268 GAGCTGTTTTAGTGGAATGAAGG - Intronic
905773409 1:40652992-40653014 AAGGTGATTTACAGGAAGGATGG + Intronic
906417888 1:45635961-45635983 AAGGTGGTATATAAGATTGAGGG - Intronic
909157918 1:72104042-72104064 AATGTGGTTTATAGGAAGGAAGG - Intronic
909369125 1:74863288-74863310 TTGTTGGTTTATAGGAATGCTGG + Intergenic
910131529 1:83913302-83913324 AAGCTGGGTGATAGGCATGTGGG - Intronic
910787553 1:91017212-91017234 AAGCTGGGTTAGAGTGATGAAGG - Intronic
911871523 1:103106955-103106977 AAGCTGGGGGATAGGAAGGAGGG - Intronic
913400798 1:118430418-118430440 AAGCCGATTTAGAGGAAGGAAGG - Intergenic
913936384 1:125055241-125055263 AAACTGCTTTATAGAAAGGAAGG - Intergenic
914077384 1:144367552-144367574 TAGCTGGTTTTAAGGAATGAAGG - Intergenic
914101795 1:144598953-144598975 TAGCTGGTTTTAAGGAATGAAGG + Intergenic
914172290 1:145236093-145236115 TAGCTGGTTTTAAGGAATGAAGG - Intergenic
914255542 1:145959304-145959326 AAGTTGGTTTCTTGGAAAGAAGG + Intergenic
914297166 1:146338559-146338581 TAGCTGGTTTTAAGGAATGAAGG - Intergenic
914526939 1:148477096-148477118 TAGCTGGTTTTAAGGAATGAAGG - Intergenic
914639463 1:149590038-149590060 TAGCTGGTTTTAAGGAATGAAGG + Intergenic
915191302 1:154153200-154153222 AGCCTGGTTTCTAGGATTGAAGG - Intronic
919405745 1:197180905-197180927 AATATGATTTATAGGAATTAGGG - Intronic
920073028 1:203316797-203316819 ATTCTTGTTTATAGGAATGAGGG - Intergenic
920328874 1:205190293-205190315 AAGGAGGTTTTTAGGAGTGATGG - Intronic
923809086 1:237292787-237292809 AAGCTGATGAATAGGAATGTTGG + Intronic
924407468 1:243765394-243765416 AAGCTGGTTTACATGGTTGAGGG - Intronic
1064387442 10:14909345-14909367 AAACAGGTTTATAGGAAACAAGG + Intronic
1069017078 10:63442712-63442734 AAGCTGGATTATATAAAGGATGG - Intronic
1073463805 10:103682083-103682105 AAACTGGGTGATAGGAGTGAGGG + Intronic
1076361674 10:129894056-129894078 GAGCAGGTTAATAGGAAGGAGGG - Intronic
1078669416 11:13351823-13351845 GGGCTGTTTTATGGGAATGATGG + Intronic
1078888219 11:15527215-15527237 AAGCTGTTTTTCAGAAATGAAGG + Intergenic
1080041358 11:27762792-27762814 AAGCTGGTATATAGACATGGTGG + Intergenic
1080195575 11:29604664-29604686 CAGCTGGTTTAAAGGAAATATGG + Intergenic
1082159360 11:48869873-48869895 AAACTGCTTTATAGAAAGGAAGG - Intergenic
1084565501 11:69926250-69926272 AAGCTGGTTTCTAGGAGGGAAGG + Intergenic
1086922922 11:92607501-92607523 AAGCTAGTTTAAAGCAGTGAGGG - Intronic
1087459794 11:98431421-98431443 AAGCTGTTTTTCAGAAATGAAGG - Intergenic
1087540612 11:99513272-99513294 ACGTTGGTTCATAGGATTGAAGG + Intronic
1087849596 11:103012740-103012762 TAGCTGGTTATGAGGAATGAAGG + Intergenic
1088659909 11:112035181-112035203 AAGGTGCCTTAAAGGAATGATGG - Intronic
1089099872 11:115953475-115953497 AAGATGCTTTAGAGTAATGAGGG + Intergenic
1089653136 11:119927942-119927964 AAGCAGGTCTCTAGGAATAATGG - Intergenic
1090018047 11:123103135-123103157 AAGCTGCTTTATAGTAATTCTGG - Intronic
1094419320 12:30254278-30254300 TAGCTGGTTTTTAGGAAAAAAGG - Intergenic
1094770466 12:33652428-33652450 AATCTGGTTCACAGGAAAGAAGG + Intergenic
1096090604 12:48897974-48897996 AAGCTGGTTTGACAGAATGATGG + Intergenic
1097137886 12:56874656-56874678 TAGCTTGATTATAGGAATGGAGG + Intergenic
1100596152 12:96073803-96073825 TCACTGGTTTATAGGATTGAAGG - Intergenic
1103250736 12:119497820-119497842 AATATTGTTTATAGGACTGAAGG + Intronic
1107210329 13:37845648-37845670 AAGAGGGTCTATAGGAATTATGG + Intronic
1109518514 13:63476852-63476874 ATGCTATTTTATAGGAATTATGG - Intergenic
1110410344 13:75197933-75197955 AAGCTGGGGGCTAGGAATGAGGG + Intergenic
1111910627 13:94307709-94307731 CAGCTGTTTTAAAGAAATGATGG + Intronic
1115267389 14:31514818-31514840 AAGCTGGTTTAAAGAAAAAAGGG + Intronic
1116027661 14:39534718-39534740 TTGCTGGTTTAAGGGAATGAGGG - Intergenic
1119434788 14:74591232-74591254 AAAATGGTTTCTAGGAATGTGGG - Intronic
1119629656 14:76216926-76216948 AAGATGGATTATAAAAATGAAGG + Intronic
1120174536 14:81278795-81278817 AAACTGAAGTATAGGAATGAGGG + Intronic
1120396208 14:83970281-83970303 AAGCTGGATCACAAGAATGAGGG + Intergenic
1128884543 15:71274527-71274549 AACCAGGATTATAGGAATCAGGG - Intronic
1130009890 15:80142904-80142926 TTGCTGGTTTACTGGAATGAGGG - Intergenic
1131109450 15:89756016-89756038 GAGCTGGTTTGTAGCGATGATGG + Intergenic
1133424685 16:5677844-5677866 AAGATGGATTATGGGTATGAGGG + Intergenic
1135950030 16:26905601-26905623 AAGCTGGTTAATCAGACTGAAGG + Intergenic
1137247033 16:46714334-46714356 AAGCTGATTTAAAGGAAGCAGGG - Intronic
1138832817 16:60395663-60395685 AAACTGGCATATGGGAATGAGGG + Intergenic
1140914028 16:79478857-79478879 AAGATGGTATATAGGTATGCTGG - Intergenic
1146940645 17:36842250-36842272 AAGCAGGCTTATGTGAATGAGGG - Intergenic
1147254361 17:39173360-39173382 AAGCTGGTTAGCAGGAACGAGGG + Intergenic
1148580669 17:48741315-48741337 AAGCTGAGTGATAGGTATGAGGG - Intergenic
1150141219 17:62730586-62730608 AAACAGGTTTTTAGAAATGAAGG + Intronic
1153398377 18:4651607-4651629 AAGGTGGTTCACAGGAATAATGG + Intergenic
1155229790 18:23761521-23761543 AATCTGGACTATAGGGATGATGG + Intronic
1155685814 18:28548741-28548763 AAGGCAGCTTATAGGAATGAAGG + Intergenic
1156351370 18:36304358-36304380 AAGTTGGATTATAGGTATGTGGG + Intronic
1156724315 18:40109699-40109721 AAGTTGGGGTATTGGAATGATGG - Intergenic
1157088546 18:44607706-44607728 AAGATGGTTGGTAGGAAGGAAGG - Intergenic
1158040098 18:53082877-53082899 AAACTGGAGTCTAGGAATGAGGG - Intronic
1158764886 18:60437844-60437866 AAACAGGTTTATAGATATGATGG - Intergenic
1159973412 18:74680626-74680648 AAGCTGGTTTATAGGAATGAAGG + Intronic
1163766812 19:19167920-19167942 AAGCTGGTTTGCAGGAGGGAAGG - Intronic
1164289261 19:23852648-23852670 ATGTGGGTTTATGGGAATGAGGG - Intergenic
1165125580 19:33594312-33594334 AAGCTGGTCTATCAGAATGCAGG - Intergenic
925652030 2:6101046-6101068 AAGCTGGTTTTTTGAAACGATGG - Intergenic
927436492 2:23070981-23071003 ATGCTGGTTTTGAGGAAGGAGGG + Intergenic
927482411 2:23464686-23464708 AAAATGGGTTATAGGAAAGAAGG - Intronic
929130592 2:38565827-38565849 AAGCTGGGTGATAGGTATGTGGG - Intronic
929320639 2:40539762-40539784 AGGGTGGTTTATAGGAATAAAGG - Intronic
929326384 2:40616419-40616441 AAGGTGGTTTCGATGAATGAAGG + Intergenic
930359075 2:50355982-50356004 AAGCTGGTTATAAAGAATGATGG + Intronic
930365390 2:50433067-50433089 AAGCTTGTTTCTGGCAATGAAGG - Intronic
930524677 2:52512894-52512916 GAGCTGGTTAGCAGGAATGACGG - Intergenic
930685569 2:54303827-54303849 AGGCTGTTTTATACAAATGATGG - Intronic
931410816 2:62029462-62029484 AAGCTGGGTAATAGGAATATAGG - Intronic
931885377 2:66611439-66611461 TTGCTGGTGTATAGGAATGCTGG + Intergenic
934104738 2:88685417-88685439 TAGCTGGTTCACAGGAATAAGGG - Intergenic
935936631 2:108192234-108192256 AAGCTGTGTTATAGTAATTAAGG + Intergenic
936533780 2:113295142-113295164 AGGATGAATTATAGGAATGAAGG + Intergenic
937333517 2:121046537-121046559 AAGCAGGAAAATAGGAATGAGGG - Intergenic
939082257 2:137676298-137676320 AAATTGGTTTAGTGGAATGAAGG - Intronic
941115385 2:161466352-161466374 AATCTGGATTTTAGGAATAAGGG - Intronic
944352725 2:198747876-198747898 AATATGGTATAAAGGAATGAAGG + Intergenic
944951324 2:204752863-204752885 TAGGTGGTTTACAGGATTGACGG - Intronic
947114540 2:226754828-226754850 AAGCTGTTTTCTAGAAGTGAAGG - Intronic
947579760 2:231307710-231307732 AACCTGGTTGACAGCAATGATGG - Intronic
947885424 2:233566041-233566063 AATCTGGTATATAGTACTGAAGG - Intronic
948126076 2:235565378-235565400 TATCTGTTTTATAGGAATGAAGG + Intronic
1174259218 20:49281398-49281420 GAGCTGGTTGCTAGGAGTGAGGG + Intergenic
1174851912 20:54003921-54003943 AAGCTGGTTGATTAGAAGGATGG + Intronic
1175059034 20:56224902-56224924 TTGCTGGTTTACCGGAATGAGGG + Intergenic
1178565917 21:33684649-33684671 AACCTGATTTAAAAGAATGACGG - Intronic
1182179546 22:28332006-28332028 AAGCTGTTTGAAAGGAATGTTGG + Intronic
1183784748 22:40022873-40022895 AAGCTGGTGTGCAGGAATGCAGG - Intronic
1184016537 22:41790036-41790058 AAACTGGTTGAAGGGAATGAAGG - Intronic
950157559 3:10734642-10734664 AAGCTGGTTTTTTAAAATGAAGG + Intergenic
950915760 3:16643766-16643788 AATCTGCTTTATAGGAATATAGG - Intronic
951130847 3:19042579-19042601 AAGGTAGTTTATAAGACTGAAGG + Intergenic
951563271 3:23988842-23988864 ATCCTGGTTGATAGGAATGCAGG + Intergenic
952639640 3:35578238-35578260 AAGCTGTGTTTTAGAAATGAGGG - Intergenic
952930761 3:38359331-38359353 TTGCTGGTTTACCGGAATGAGGG - Intronic
954202284 3:49030855-49030877 CAGCTGGTTTGTGGGAAGGAGGG - Intronic
955501845 3:59592974-59592996 AACCTGGTTTAAAGGAAAGGTGG + Intergenic
956420989 3:69085957-69085979 AAGGTGGTTTCTAGGAAAGCAGG - Intronic
957204911 3:77184095-77184117 AAGATGGTTTTAATGAATGAAGG + Intronic
957834138 3:85563855-85563877 AAGCTTGTTTATACCAATCAGGG - Intronic
958844920 3:99254363-99254385 AAGACAGTTTAAAGGAATGAGGG + Intergenic
959296743 3:104545031-104545053 AAGTTTCTTTATAGGAATGAAGG + Intergenic
959537403 3:107501750-107501772 AAACTGGTTTACAGGACAGAAGG + Intergenic
962672081 3:137718628-137718650 TTGTTGGTGTATAGGAATGATGG + Intergenic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964843043 3:161015208-161015230 CAGCTGGTTTAGGGGAAGGAAGG - Intronic
965114917 3:164477181-164477203 ATTCTTGTTTATAGCAATGATGG + Intergenic
966207256 3:177417721-177417743 AAGCTGGATTAAAGGAATATGGG - Intergenic
966259596 3:177960049-177960071 AAGCTGTTTTGTAGCAATGCTGG - Intergenic
970443519 4:16105587-16105609 AAGCTGGGTAATAGGTATCAGGG + Intergenic
970633741 4:17983571-17983593 TTGTTGGTGTATAGGAATGAGGG + Intronic
970737065 4:19184447-19184469 ATGTTTGTTTATAGGAAAGATGG - Intergenic
973640964 4:52902185-52902207 AAGCTGTTTCACAGGAATGGAGG - Intronic
978417682 4:108494226-108494248 AAGCTGTCTTTTAGGAATGAAGG + Intergenic
979422635 4:120524775-120524797 AAACTTGTTTGGAGGAATGATGG - Intergenic
979801225 4:124911991-124912013 AAGCTGTTCTTTAGAAATGAAGG - Intergenic
979803004 4:124935258-124935280 AAGCAGGTCTACAGGAATGTGGG + Intergenic
980002205 4:127502998-127503020 AAGCTGGTTTTCAGTAGTGAAGG + Intergenic
980377372 4:131967403-131967425 AAGCTGGGGTAAAGGAATGCTGG + Intergenic
980614364 4:135199440-135199462 TATCTGTTTTATAGGAATGTGGG + Intergenic
981961782 4:150549800-150549822 AAGCTTTTTTAGAGGAAAGATGG + Intronic
983616268 4:169708767-169708789 ATGTTGGTTTAAGGGAATGAGGG + Intronic
983777473 4:171626191-171626213 AAACTAGTTTAAAGGAATGGTGG - Intergenic
986247720 5:6025856-6025878 AAGATCATTTATAGGAATGCAGG + Intergenic
989247392 5:39269355-39269377 AAGCTGTTTTCTAGGAATCCCGG + Intronic
989413606 5:41148573-41148595 AAGCTGTTTTCTGAGAATGAGGG + Intronic
989443204 5:41496293-41496315 AAGCTTATTTAAAGGAATAATGG + Intronic
990293315 5:54377167-54377189 AAGATTGGTTATGGGAATGAGGG + Intergenic
990364688 5:55058347-55058369 ATGTTGGTTTATAGGATTGTTGG + Intergenic
992356419 5:75989113-75989135 AAGGTGGTTTATTGGAAAGTGGG - Intergenic
992677804 5:79123243-79123265 AAGCTGTTTCAGAGGAATGAAGG + Intronic
993135865 5:83963251-83963273 AAACTGGCTTACAGCAATGATGG - Exonic
997073429 5:130643546-130643568 TTGCTGGTTTACTGGAATGAGGG - Intergenic
998719324 5:144926689-144926711 AAGCTGTTTTATAGAAAAAAAGG - Intergenic
999474675 5:151887686-151887708 AAACAGGTTTAGAGGAAGGAAGG + Intronic
999750230 5:154622935-154622957 CAGTTGGCTTATAGTAATGAAGG - Intergenic
999911956 5:156211204-156211226 AAGCTGTTTTTTAGAAATGAAGG + Intronic
1007157136 6:39756378-39756400 AAGGTGGTATATATGCATGATGG - Intergenic
1007512460 6:42384305-42384327 AAAATGTTTTATAAGAATGAGGG + Intronic
1008093206 6:47313057-47313079 TTGCAGGTTTACAGGAATGAGGG - Intergenic
1009714868 6:67378296-67378318 GATCTGGTTTATAGGAGTAAAGG + Intergenic
1011093767 6:83635752-83635774 AAGTTGCTTTGTAGGAATTATGG + Intronic
1011556304 6:88574089-88574111 TGGCTGGTTAATAGGAATAAGGG - Intergenic
1012131786 6:95503373-95503395 AAGCAGGCATATAGGAATCATGG + Intergenic
1012249327 6:96962268-96962290 AATCTGGTACATAGGATTGATGG - Intronic
1013375882 6:109513754-109513776 AATCCTATTTATAGGAATGATGG - Intronic
1013862783 6:114656587-114656609 AAACTGTTTTCTAGGAATGATGG + Intergenic
1018752634 6:166821030-166821052 AAGCAGGTGTCTTGGAATGATGG + Intronic
1018831980 6:167450205-167450227 AATCGGGTGTAAAGGAATGAAGG + Intergenic
1020979293 7:15047432-15047454 TAGTTGCTTTATAGGGATGAAGG - Intergenic
1021121052 7:16796223-16796245 GAGCTGGTTCTTAGGACTGAAGG + Intronic
1022405463 7:30085845-30085867 AAGCTGGTGGAGAGGAAGGATGG + Intronic
1025245675 7:57315063-57315085 AGCCAGGTTTATAAGAATGAGGG - Intergenic
1026470720 7:70692855-70692877 AGACTGGTTTAAAGTAATGATGG - Intronic
1026666440 7:72343859-72343881 AATCTGGTTTCTGGGAAAGATGG + Intronic
1027848260 7:83413744-83413766 AAGGTGGTTTTGAGGCATGAAGG + Intronic
1028487891 7:91379860-91379882 GAGGTGGTTTCTAGGGATGAAGG + Intergenic
1029455078 7:100665793-100665815 GAGCTGGTTGTTAGGAATGGTGG - Intergenic
1030419834 7:109294674-109294696 GTCCTGGTTTATAGAAATGAGGG + Intergenic
1031537468 7:122953120-122953142 AAGGTGGTTTATAAAAATGAAGG + Intergenic
1032938909 7:136766155-136766177 AAGCAAGTCTATAGGACTGAAGG + Intergenic
1033166789 7:139046114-139046136 AACCTGGTTCATAAGAAGGAAGG + Exonic
1035180769 7:157087936-157087958 AAGTCGGTTGATAGAAATGAAGG - Intergenic
1037004634 8:13761770-13761792 AAGCTGTCTTTTAGAAATGAAGG + Intergenic
1037011477 8:13848642-13848664 AAGCATGTTTATGGAAATGAGGG - Intergenic
1038641945 8:29335929-29335951 AAGCTGGTTCATGGGCATGTAGG - Exonic
1039223388 8:35360391-35360413 AAGCTGCTTTAAAGGAAGGAAGG - Intronic
1039744873 8:40415675-40415697 GAGCTGGTAGAGAGGAATGAGGG - Intergenic
1040836155 8:51733283-51733305 AAACTGCTTCATAGAAATGAGGG - Intronic
1040988801 8:53326828-53326850 TTGTTGGTTTATCGGAATGAGGG + Intergenic
1043933077 8:86112842-86112864 ATGCTGGGTTATAAGAATAAGGG + Intronic
1044167567 8:89005917-89005939 AAGGTGGTTTAGAGCTATGATGG + Intergenic
1045338675 8:101232510-101232532 AAGCTGGGTGATGGGTATGATGG - Intergenic
1046696519 8:117345780-117345802 AAGCTTGTTTAAAGAAATAAAGG + Intergenic
1047680071 8:127245625-127245647 AAGCAGGTAAAAAGGAATGAAGG + Intergenic
1049857373 8:144871167-144871189 TTGCAGGTTTACAGGAATGAGGG + Intergenic
1050861412 9:10437123-10437145 AAGCAAGTATATAGGGATGATGG - Intronic
1051361299 9:16283887-16283909 AAGCAGGTTCATAGGGATGCAGG - Intergenic
1051384048 9:16487731-16487753 AAGCCGATTTCTTGGAATGAAGG + Intronic
1052292848 9:26864098-26864120 AAGCTGCTTTAAAGGAGTGTTGG - Intronic
1053191797 9:36077527-36077549 ATGCTGGTATACTGGAATGAAGG + Intronic
1054323244 9:63695066-63695088 AAGCTGGGGTAAAGGAATGCTGG + Intergenic
1056008415 9:82299556-82299578 AAGCTGTTTTATAGGGAAGCAGG + Intergenic
1057627831 9:96693418-96693440 TTGTGGGTTTATAGGAATGAGGG - Intergenic
1058048263 9:100380461-100380483 AAGCTGGAGGATAGGAATGTGGG + Intergenic
1059904353 9:118965369-118965391 AAGCTGGTTAAGAAGAATAATGG - Intergenic
1185482408 X:457149-457171 TAGCTGATTGATAGGTATGATGG - Intergenic
1185482429 X:457683-457705 TAGCTGATTGATAGGTATGATGG - Intergenic
1189894529 X:45640495-45640517 TCGGTGGTTTATAGGAATTAGGG - Intergenic
1191631443 X:63326143-63326165 AAGCTGGTTTAATTGAATGGTGG + Intergenic
1193633482 X:83919283-83919305 AAGCTGTTTTACAGAAATGAGGG + Intergenic
1194853892 X:98904401-98904423 AAGCTGTTTTATCTGAATGATGG - Intergenic
1194919548 X:99748624-99748646 CAGCTGCTCTATAGCAATGATGG - Intergenic
1194951295 X:100129735-100129757 GAGCTTGTTTATAGGAAAAAGGG + Intergenic
1196539681 X:116892835-116892857 AAGCTTATTTAAAGAAATGATGG - Intergenic
1196555279 X:117078158-117078180 AAGCTGATTTATAGGAGTCTGGG + Intergenic
1197136623 X:123068066-123068088 TTGTTGGTTTATAGGAATGTCGG - Intergenic
1197456872 X:126687750-126687772 TAGCTGTTTTATAGGAGTTATGG - Intergenic
1197682006 X:129395100-129395122 AAGCATGTTTAAAGGAATAATGG + Intergenic
1202169786 Y:22031255-22031277 AAGGTTGTTTATCAGAATGAAGG + Intergenic
1202221580 Y:22555118-22555140 AAGGTTGTTTATCAGAATGAAGG - Intergenic
1202321538 Y:23640554-23640576 AAGGTTGTTTATCAGAATGAAGG + Intergenic
1202549229 Y:26029502-26029524 AAGGTTGTTTATCAGAATGAAGG - Intergenic