ID: 1159974347

View in Genome Browser
Species Human (GRCh38)
Location 18:74692195-74692217
Sequence CAGTCAAGGCCATTAGCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159974343_1159974347 -9 Left 1159974343 18:74692181-74692203 CCGTATCTCTTCTTCAGTCAAGG 0: 1
1: 0
2: 1
3: 18
4: 249
Right 1159974347 18:74692195-74692217 CAGTCAAGGCCATTAGCATGGGG 0: 1
1: 0
2: 0
3: 16
4: 148
1159974342_1159974347 2 Left 1159974342 18:74692170-74692192 CCTGATGATGGCCGTATCTCTTC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1159974347 18:74692195-74692217 CAGTCAAGGCCATTAGCATGGGG 0: 1
1: 0
2: 0
3: 16
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159974347 Original CRISPR CAGTCAAGGCCATTAGCATG GGG Intronic
901450980 1:9336992-9337014 CATTCAAGGCCCTTGGCATCTGG + Intronic
901866091 1:12107817-12107839 CAGTGAAGGCTCTTAGCGTGGGG - Intronic
903644028 1:24880238-24880260 CAGTAAAGGCCATTCTAATGAGG - Intergenic
903792093 1:25900593-25900615 CATTCAAGTCCAGTAGCATCTGG + Intronic
906505099 1:46373088-46373110 CAGTAAAGGCCATTCTAATGAGG - Intergenic
907890482 1:58632015-58632037 CAGTAAAGGCCATTCTGATGAGG + Intergenic
908485593 1:64589348-64589370 CAGACAAAGCAATTAGCATTAGG + Intronic
910041150 1:82852762-82852784 CAGTAAAGGCCATTCTGATGAGG - Intergenic
912549938 1:110479051-110479073 GAGGCAGGGCCATCAGCATGGGG + Intergenic
914247730 1:145898187-145898209 CAGTCAAGGCCACTGGCCGGAGG + Exonic
914376112 1:147075355-147075377 CAGACAAGGCCGTGTGCATGCGG - Intergenic
914453954 1:147817996-147818018 CAGTAAAGGCCATTTTGATGAGG - Intergenic
915488678 1:156239630-156239652 CAGTCAAGGTCAAGAGCCTGTGG + Exonic
916950577 1:169776226-169776248 CTTTTAAGGCCATTAACATGAGG + Intronic
920831673 1:209471233-209471255 CAGTAAAGGCCATTTGGATGAGG - Intergenic
921619072 1:217306714-217306736 CAGTAAAGGCCATTCTGATGAGG + Intergenic
921619948 1:217314359-217314381 CAGTGAATGCCATGAGCATGAGG - Intergenic
921957637 1:221000660-221000682 CATTCAAGGCCATAAATATGTGG - Intergenic
1064224011 10:13466739-13466761 CAGTCAAGCCCAGTAACATGTGG - Intronic
1066260154 10:33721735-33721757 CAGTCAATGCCAGCTGCATGTGG + Intergenic
1067162526 10:43839375-43839397 CAGTCAAGGCAATTCTGATGAGG - Intergenic
1067561570 10:47308251-47308273 CAGTCAAGGCCACATGCTTGGGG + Intronic
1071337834 10:84615952-84615974 CAGTAAAGGCCATTCTAATGAGG + Intergenic
1072866678 10:99069293-99069315 TATTTAAGGCCATTATCATGGGG + Intronic
1074276345 10:112006033-112006055 CAGGCCAAGCCATCAGCATGGGG + Intergenic
1076785386 10:132747178-132747200 CACTTAAGCCCATTAGCATCTGG + Intronic
1077396805 11:2328113-2328135 CAGTCAAAGCCATTCTCGTGAGG - Intergenic
1078357260 11:10641748-10641770 AAGTGAAGGCCATGAGCATGGGG + Intronic
1085022339 11:73217668-73217690 CAGGGAAGGCCATTAGAGTGGGG + Intergenic
1090197512 11:124829383-124829405 CAGGAAAGGCCATCAGTATGAGG - Intergenic
1092123232 12:6058755-6058777 AACTCCAGGCCATGAGCATGTGG + Intronic
1094578906 12:31714933-31714955 CATTCAAGTCCAGTAGCATCTGG + Intronic
1100932929 12:99631535-99631557 CAGTAAAGGCCATTTCGATGAGG + Intronic
1101990375 12:109479041-109479063 CAGTCTAGACCATTAGTATGTGG - Intronic
1102538937 12:113604220-113604242 CACTCAAGGCCTTTAGCAAAGGG - Intergenic
1102957681 12:117070038-117070060 CAATCAACGCCATTTTCATGTGG + Intronic
1104074298 12:125376109-125376131 CAGACAAGGAGATTAGCAAGAGG - Intronic
1105624591 13:22100698-22100720 CAGTAAAGGCCATTCTGATGAGG + Intergenic
1105639497 13:22247779-22247801 CAGTCTTGGACATTAGCGTGGGG - Intergenic
1106328530 13:28717665-28717687 CAGTAAAGGCCATTAGGTTTGGG + Intronic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108527659 13:51299657-51299679 GAGTCATGACCATGAGCATGGGG + Intergenic
1111513492 13:89297171-89297193 CAGTAAAGGCCATTCTCATGAGG + Intergenic
1113131075 13:107037395-107037417 CAGCAAGGGCCATTAGCATGAGG - Intergenic
1116531295 14:45977006-45977028 CAGTGAATTCCATGAGCATGAGG + Intergenic
1118067517 14:62207894-62207916 CAGTAAAGGCCATTCTGATGAGG - Intergenic
1118700297 14:68426375-68426397 CAGTAAAGGCCATTCTGATGAGG + Intronic
1124237810 15:28004924-28004946 CAGACAAGGCCATCAGACTGTGG + Intronic
1129025093 15:72564356-72564378 CAGTAAAGGCCATTATGATGAGG - Intronic
1131565915 15:93485447-93485469 CAGTGAATGCCATTGGCTTGGGG - Intergenic
1138215187 16:55198583-55198605 CAGTAAAGGCCATTCTGATGAGG + Intergenic
1139000515 16:62504977-62504999 CAGTGAAGGCCATTCTGATGAGG + Intergenic
1140768043 16:78178164-78178186 CAGGCCAGGCCACTTGCATGTGG - Intronic
1143006615 17:3840013-3840035 AAGGCAAGGCCAGAAGCATGAGG + Intronic
1143179119 17:4973368-4973390 CAGTCAAGGACACTAGCTTAAGG + Intronic
1144027420 17:11290894-11290916 CATTCAAGGCGAAGAGCATGGGG - Intronic
1150622420 17:66818173-66818195 CAGTAAAGGCCATGATAATGAGG + Intergenic
1151214121 17:72565954-72565976 GAGGCCAGGCCATCAGCATGGGG + Intergenic
1153929031 18:9862124-9862146 CAGTCAAGGACTTTGGCATGTGG + Exonic
1156304024 18:35859927-35859949 CAGTGAATTCCATGAGCATGAGG - Intergenic
1157785945 18:50482805-50482827 CTGTCAAGGGCTTTAGCATGTGG - Intergenic
1158559047 18:58498538-58498560 TAGTCAATGCCAATAGCAAGAGG + Intronic
1159974347 18:74692195-74692217 CAGTCAAGGCCATTAGCATGGGG + Intronic
1162244755 19:9390556-9390578 CAGTAAAGGCCATTCTGATGTGG - Intergenic
1168554005 19:57322967-57322989 CATGTAAAGCCATTAGCATGAGG + Intronic
925330342 2:3053634-3053656 ATATCAATGCCATTAGCATGTGG - Intergenic
925693640 2:6551185-6551207 CAGTGAAGGCCATTCTGATGAGG + Intergenic
928836237 2:35549572-35549594 TATTCAATGCCAATAGCATGAGG - Intergenic
931679462 2:64732433-64732455 CAGTCAAGGCAATCAGTAAGAGG + Intronic
931824993 2:65991231-65991253 CAGTCATGGCCATCAGTCTGTGG + Intergenic
932307262 2:70712971-70712993 CAGACAAGGCCCTTTGCATGAGG - Intronic
935741178 2:106149947-106149969 CAGTAAAGGCCATTCTGATGAGG + Intronic
941736229 2:168979828-168979850 AAGTAAAGGCCATTAACAGGTGG - Intronic
943288956 2:186043426-186043448 CAGTAAAGGCCATTCTGATGAGG - Intergenic
943691149 2:190870966-190870988 CAGTAAAGGCCATTCTAATGAGG - Intergenic
946624653 2:221597975-221597997 CAGACAAGGCCACTTGGATGAGG + Intergenic
948683808 2:239658292-239658314 AAGTCAAGGCCATGAGAGTGGGG - Intergenic
948873717 2:240816849-240816871 CAGTCAAGGTCAGCAGCAGGTGG - Intronic
1171067753 20:22035383-22035405 CAGTCAATTCAATTATCATGAGG + Intergenic
1172957281 20:38769885-38769907 CAGTAAGGGGCATGAGCATGGGG + Intronic
1177618292 21:23554753-23554775 CAGTCAAGGCAATTCTGATGAGG + Intergenic
1182538107 22:31021198-31021220 CAGTAAAGGCCATTCTGATGAGG - Intergenic
1182724914 22:32437020-32437042 CTGTCAGGGCCATAAGCACGTGG - Intronic
949650716 3:6155812-6155834 AAGTGGAGGACATTAGCATGGGG + Intergenic
950884944 3:16355007-16355029 CAGTAAAGGCCATTCTGATGAGG - Intronic
952585355 3:34886174-34886196 CAGTAAAGGCCATTTGAATGAGG + Intergenic
952660647 3:35842493-35842515 CATTCAAGGCCATTAGCAATCGG - Intergenic
953148247 3:40299636-40299658 CAGTAAAGGCCATTCTGATGAGG - Intergenic
953424191 3:42779720-42779742 CAGTAAAGACCATTTGTATGTGG + Intronic
953533651 3:43760033-43760055 CTGTCATGGGCATGAGCATGGGG - Intergenic
959311407 3:104741911-104741933 CAGTAAAGGCCATTCTGATGAGG - Intergenic
960886894 3:122405110-122405132 CAGTCAGGGTCTTTAACATGAGG - Intronic
961762870 3:129184221-129184243 CAGTGACTGCCATTAGCTTGGGG + Intergenic
962674862 3:137748221-137748243 CATCCAATGCCATTAGCATCTGG + Intergenic
962785654 3:138765906-138765928 CATTCAAGTCTATTTGCATGTGG + Intronic
963974790 3:151468518-151468540 CCGTCAATGCCATTATCAGGAGG - Intergenic
965291581 3:166888359-166888381 CAGTGAATTCCATGAGCATGAGG + Intergenic
967215658 3:187207903-187207925 CAGTAAAGGCCATTCTGATGAGG - Intergenic
969722085 4:8897730-8897752 CAGCCAGGGCCATTCCCATGTGG + Intergenic
969921736 4:10546493-10546515 CAGTAAAGGCCATTCTGATGAGG - Intronic
970786605 4:19804796-19804818 CAGTCAAAACAATTAGAATGAGG + Intergenic
971098324 4:23434126-23434148 CAGTAAAGGCCATTCTGATGAGG + Intergenic
971443390 4:26715301-26715323 CAGTCAAGGAGAGTAACATGTGG - Intronic
971486187 4:27162979-27163001 CAGTAAAGGCCATTCTGATGAGG - Intergenic
973580343 4:52338428-52338450 CAGTAAAGGCCATTCTGATGAGG + Intergenic
974223101 4:59002373-59002395 TATTCAAGGCCATTATAATGAGG - Intergenic
983163677 4:164448579-164448601 CAGTAAAGGCCATTCTAATGAGG - Intergenic
986544784 5:8883692-8883714 CTGTCAACACCACTAGCATGTGG - Intergenic
987101709 5:14596891-14596913 TAGATAAGGCCATCAGCATGGGG - Intronic
989340522 5:40369020-40369042 CAGTAAAGGCCATTTCAATGAGG - Intergenic
992041412 5:72836934-72836956 CAGTAAAGGCCATTCTGATGAGG - Intronic
996504154 5:124250579-124250601 CAGTAAAGGCCATTCTGATGAGG - Intergenic
996835657 5:127789370-127789392 CAGTAAAGGCCATTTTGATGAGG + Intergenic
996877391 5:128254333-128254355 CAGGCAACGCCATTAGCATAGGG - Intergenic
1000918834 5:167114983-167115005 AAGTAAAGGGCATTAGCATCAGG + Intergenic
1002860692 6:1076916-1076938 CAGCCAAGCCCATTTGCTTGTGG + Intergenic
1003177639 6:3764718-3764740 CATTCAAGGCAAGTAACATGAGG + Intergenic
1006767813 6:36524193-36524215 CAGACAAAGCAATTAGGATGTGG + Intronic
1007076347 6:39069264-39069286 CAGTAAAGGCCATTCTGATGAGG - Intronic
1007220304 6:40273669-40273691 CAGTAAAGGCCATTCTGATGAGG - Intergenic
1007508572 6:42357587-42357609 CAGTCAAGGTGATGAGCATTAGG + Intronic
1008506139 6:52231839-52231861 CTGTCAAAGCCATGAGAATGTGG + Intergenic
1009967442 6:70592428-70592450 CAGTAAAGGCCATTCTGATGAGG + Intergenic
1010813821 6:80331162-80331184 CAGTCATGGCCTTAAGCATCCGG + Intronic
1012859347 6:104540921-104540943 CAGTAAAGGCCATTCTGATGAGG - Intergenic
1015633928 6:135257313-135257335 CAGGCAAGGCCATGGGCTTGAGG + Intergenic
1017025348 6:150176403-150176425 CAGTCAATGCCTTTAGGATTAGG + Intronic
1018247566 6:161837260-161837282 CAACCCAGGCCATTAGCAGGAGG - Intronic
1018415766 6:163600983-163601005 CAGTCAGGGCCATCTACATGTGG + Intergenic
1021820606 7:24494312-24494334 CAGCCAAGGGAATTAGCCTGGGG - Intergenic
1023792163 7:43761590-43761612 CCTTCAAGGCCATTAACATTTGG - Intronic
1023847259 7:44129404-44129426 CACCAAAGGCCATTGGCATGGGG - Intergenic
1024939097 7:54743652-54743674 CAGTCTAGTCCATTGGCATAAGG + Intergenic
1027566471 7:79800944-79800966 AAGTAAAGGCCATTCTCATGAGG - Intergenic
1028777029 7:94688913-94688935 CAGTAAAGGCCATTCTAATGAGG - Intergenic
1032489610 7:132314446-132314468 CGGTCATGGGCATTGGCATGAGG - Intronic
1038426117 8:27465016-27465038 CAGTCAAGGCCTTTTGCAAACGG - Intronic
1038710946 8:29944968-29944990 CAGTCAGAGCCATTAGCAACTGG + Intergenic
1039155618 8:34553436-34553458 CAGTAAAGGCCATTCTGATGGGG + Intergenic
1040823295 8:51589515-51589537 CAGTAAAAGCCATTCTCATGAGG + Intronic
1041527740 8:58826482-58826504 CAGTAAAGGCCAATGGCATGGGG + Intronic
1042413195 8:68488250-68488272 GAGTCAAGGCCTTTAGAATTTGG + Intronic
1043495749 8:80798230-80798252 CACTAAAGGCCATTACAATGAGG - Intronic
1044803277 8:95978814-95978836 CAGTCAAGACCACTTGAATGTGG - Intergenic
1044839289 8:96324147-96324169 CAGTCAAGGCCACTCTGATGAGG - Intronic
1056335368 9:85563421-85563443 CAGTAAAGGCCATTCTGATGAGG + Intronic
1056693122 9:88824716-88824738 CAGTAAAGGCCATTCTGATGAGG + Intergenic
1058250824 9:102694001-102694023 CAGTAAAGGCCATTTTGATGAGG + Intergenic
1058564897 9:106272512-106272534 GTGTCAAGGCCCTTAGAATGAGG + Intergenic
1059568446 9:115407913-115407935 AAGGCAAGGCCAGTAGCAAGGGG + Intergenic
1062093681 9:134691752-134691774 TAGTCCAGGCCATGAGCAAGTGG - Intronic
1189215373 X:39318621-39318643 CTGTCTAGCCCACTAGCATGTGG + Intergenic
1190002709 X:46705084-46705106 CAGAGAAAGCCCTTAGCATGAGG + Intronic
1192810916 X:74546690-74546712 CAGTCAAAGCCAGTCACATGTGG - Intergenic
1193196876 X:78643152-78643174 CAGACAAATCCAGTAGCATGTGG + Intergenic
1194539536 X:95153965-95153987 CAGTAAAGGCAATTCTCATGAGG - Intergenic
1195292287 X:103440959-103440981 CAGTAAAGGCCATTCTGATGAGG + Intergenic
1195511705 X:105723296-105723318 CAGTAAAGGCCATTTTTATGTGG - Intronic
1195746989 X:108128666-108128688 CAGTCAATTCCATTATTATGGGG - Intronic
1195872712 X:109502604-109502626 CAGTAAAGGCCATTCTGATGAGG - Intergenic
1195879085 X:109574066-109574088 CAGTCAAGGCCAGTAAGATGAGG + Intergenic
1197887269 X:131231511-131231533 CAGTCAAGGGCAAAAGCTTGGGG + Intergenic
1198576637 X:138017226-138017248 AAGTCAAGGATATTAGCATTTGG + Intergenic
1199776177 X:151013660-151013682 CTGTCTTGGCGATTAGCATGTGG + Intergenic
1200062709 X:153490673-153490695 CACTCAAGGCCATAAACTTGGGG + Intronic