ID: 1159974385

View in Genome Browser
Species Human (GRCh38)
Location 18:74692480-74692502
Sequence GATTCGTAGTTGAAGTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159974379_1159974385 29 Left 1159974379 18:74692428-74692450 CCATGCTCGTGATCTTGCTTTTG 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1159974385 18:74692480-74692502 GATTCGTAGTTGAAGTAGGTAGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159974385 Original CRISPR GATTCGTAGTTGAAGTAGGT AGG Intronic
907036194 1:51218483-51218505 GAAGACTAGTTGAAGTAGGTTGG - Intergenic
908961635 1:69704887-69704909 GATTTGTAGTTGAAATATGTAGG - Intronic
1074064519 10:110001872-110001894 GATTCGTAGCTGAAGTGTGAAGG + Intronic
1077310030 11:1884195-1884217 GATTAGTGGTTGGAGTAGCTGGG + Intronic
1081197102 11:40174936-40174958 GATTTGTAGTTGAAATTTGTGGG - Intronic
1086021563 11:82237143-82237165 GATATGTAGTTGAAGTATGGTGG - Intergenic
1092842121 12:12552540-12552562 GATACATAGTTGAAGAAGGGTGG - Intronic
1093675491 12:21934752-21934774 CATTTGTTCTTGAAGTAGGTGGG - Intronic
1095687451 12:45051372-45051394 GACTCGTAGTGGGAGGAGGTGGG + Intergenic
1100071893 12:90731046-90731068 GATTTCTATTTGAAGTAGGTTGG + Intergenic
1110794409 13:79620169-79620191 GATTTGTAGTTCATGTTGGTAGG - Intergenic
1111284861 13:86075966-86075988 AAATAGTAGTTGAAGTAGATAGG + Intergenic
1114198107 14:20496882-20496904 AATTCTTAGTTGGAGTATGTGGG + Intergenic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1134905408 16:17975760-17975782 GATTTGAAGTTGGAGGAGGTGGG - Intergenic
1139835142 16:69832351-69832373 TATTTATAGTTGAAGTATGTCGG - Intronic
1141839545 16:86566005-86566027 GTTTCGAAGCTGAAGTTGGTAGG + Intergenic
1156214749 18:34986068-34986090 TATCGGTATTTGAAGTAGGTAGG + Intronic
1156686878 18:39660773-39660795 GATTTGTAGTTGAATTCTGTGGG + Intergenic
1159163910 18:64678590-64678612 AATACGTACTTGAAGTAGATTGG + Intergenic
1159974385 18:74692480-74692502 GATTCGTAGTTGAAGTAGGTAGG + Intronic
927264641 2:21131524-21131546 GATACGTAGTTGGAGAAGGAAGG - Intronic
929245535 2:39698028-39698050 GATTCTTAATTGAAGGAGATTGG - Intronic
931868525 2:66435819-66435841 TATTAGAAGTTGAAGTAGGAAGG + Exonic
935446681 2:103164731-103164753 GATTGGTAGATGGAGTAGGGAGG + Intergenic
940062810 2:149591347-149591369 GATTCCTAGTTAAAGTCTGTGGG + Intergenic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
1169532241 20:6498056-6498078 CATTCGCAGTGGAAGTAAGTAGG + Intergenic
1174675154 20:52346675-52346697 GATTTGTAGTTGTATTAGGGTGG + Intergenic
971989638 4:33875535-33875557 GATTCATAGGTCTAGTAGGTAGG + Intergenic
976033084 4:80781700-80781722 GTTTCCTAGTTTAAGTAGATTGG + Intronic
987781772 5:22446292-22446314 GGTTTGAAGTTGAAGTAGTTAGG - Intronic
987958079 5:24765867-24765889 TACTGGTATTTGAAGTAGGTTGG + Intergenic
1003264164 6:4551028-4551050 GATTTGTAGTTCAAAGAGGTAGG - Intergenic
1011050596 6:83144429-83144451 GATTTACAGTTGAAGTATGTAGG + Intronic
1011722719 6:90175940-90175962 AATTGCTAGTTGAAGTAGTTTGG - Intronic
1026490500 7:70859122-70859144 CATTGGTAGTTGAAGTGGGGAGG + Intergenic
1032297208 7:130650336-130650358 GATTAGTAGTTGTGGTAGGCAGG - Intronic
1034592422 7:152152904-152152926 GATTCGGACGTGAAGAAGGTCGG + Exonic
1038122313 8:24631262-24631284 AATTAGTAGTTTAAGTTGGTGGG + Intergenic
1042002752 8:64144810-64144832 GAAGGGTAGTTGAAGGAGGTAGG - Intergenic
1045452120 8:102337784-102337806 GATTCTTGTTGGAAGTAGGTTGG + Intronic
1050188353 9:2998657-2998679 GATTCTTAATTTAACTAGGTTGG - Intergenic
1055103376 9:72487684-72487706 GATGGGTAGTAGAAGAAGGTAGG + Intergenic
1188282111 X:28282903-28282925 GATTATTACTAGAAGTAGGTGGG - Intergenic
1194887854 X:99340008-99340030 GATGGGTAGTGGAAGTATGTTGG - Intergenic
1199272503 X:145900407-145900429 GATTCCTAGTTGAAATAACTAGG - Intergenic