ID: 1159974763

View in Genome Browser
Species Human (GRCh38)
Location 18:74697260-74697282
Sequence TCTCCTCATAGGAGCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159974763_1159974769 10 Left 1159974763 18:74697260-74697282 CCTCCTGTGCTCCTATGAGGAGA 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1159974769 18:74697293-74697315 TTTGGCACATATGCTAGTATGGG 0: 1
1: 0
2: 0
3: 8
4: 100
1159974763_1159974768 9 Left 1159974763 18:74697260-74697282 CCTCCTGTGCTCCTATGAGGAGA 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1159974768 18:74697292-74697314 CTTTGGCACATATGCTAGTATGG 0: 1
1: 0
2: 0
3: 4
4: 73
1159974763_1159974766 -8 Left 1159974763 18:74697260-74697282 CCTCCTGTGCTCCTATGAGGAGA 0: 1
1: 0
2: 0
3: 16
4: 154
Right 1159974766 18:74697275-74697297 TGAGGAGAATATATATCCTTTGG 0: 1
1: 0
2: 2
3: 58
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159974763 Original CRISPR TCTCCTCATAGGAGCACAGG AGG (reversed) Intronic
901097895 1:6697255-6697277 TCTTGTCATAGGAGAACGGGGGG + Intronic
904861513 1:33541432-33541454 TCTCCTCACAGGATCCCAGTTGG + Intronic
907613276 1:55894811-55894833 TTACCTCATAGGACCACTGGGGG - Intergenic
907651846 1:56302737-56302759 TCTGCTCATAGAAGCACAAGAGG - Intergenic
907935013 1:59034107-59034129 TGTCCTCATTGGAGCAAAGAAGG - Intergenic
910794132 1:91081018-91081040 CCTCTTCATGGGAGCACCGGTGG - Intergenic
911953965 1:104212524-104212546 TCTCCTTATAGGACAACAGTGGG + Intergenic
911971186 1:104439997-104440019 GTTCCTCATAGGATCTCAGGTGG - Intergenic
915562901 1:156697761-156697783 CCTTCTCAGAGGAGCACATGTGG + Intergenic
915605789 1:156949413-156949435 TCTGCTTCTAGGACCACAGGAGG + Intronic
915692939 1:157708677-157708699 TATCCTCATGGGACCACTGGTGG - Intergenic
915854336 1:159365513-159365535 TTTCCTCATTGGAACCCAGGAGG - Intergenic
916572157 1:166037433-166037455 TCTCCTCAAAGCAGATCAGGAGG - Intergenic
922502812 1:226109756-226109778 TCTCCTCGCAGCAGCTCAGGAGG - Intergenic
1064013342 10:11754026-11754048 CCTCCTCAGAAGAACACAGGTGG - Intronic
1065331938 10:24611354-24611376 TCTCCACATAGTAGAAAAGGTGG - Intronic
1072674033 10:97452288-97452310 GGTCCTCACAGGAGCACTGGGGG + Intronic
1072736287 10:97881782-97881804 TCTGAACAAAGGAGCACAGGTGG - Intronic
1075277693 10:121109533-121109555 TCTGCTGTTGGGAGCACAGGGGG - Intergenic
1076160235 10:128237869-128237891 TCTCCCAGTAGGAGCCCAGGTGG - Intergenic
1079124414 11:17708676-17708698 TCCCCACAAAGGAGCACTGGGGG - Intergenic
1081777216 11:45684022-45684044 TCTCCCCACAGGAGCATATGGGG + Intergenic
1082209588 11:49482449-49482471 TTTTCTCATAGGAGCACTGTTGG + Intergenic
1084225899 11:67714674-67714696 TCTCTTCATAGCAGCACTGTGGG - Intergenic
1084263720 11:67994530-67994552 TCTCTTCATAGCAGCACTGTGGG - Intronic
1084809687 11:71604590-71604612 TCTCTTCATAGCAGCACTGTGGG + Intergenic
1085966281 11:81531509-81531531 TCTCCACACAGTAGCAAAGGAGG - Intergenic
1086640089 11:89143085-89143107 TTTTCTCATAGGAGCACTGTTGG - Intergenic
1086836759 11:91634096-91634118 TCTCCTCATCGGAAAACTGGGGG - Intergenic
1093383409 12:18521792-18521814 TCTCCTCCCAGGAGCTCAGCAGG + Intronic
1097282184 12:57851949-57851971 CCTCCTGACAGGAGCACAGGGGG - Intergenic
1098190142 12:67939178-67939200 CCTCCCCATAGGAGCAGATGTGG - Intergenic
1100353489 12:93807282-93807304 CCTTTTCATAGGAGCACAGAGGG + Intronic
1104074713 12:125378872-125378894 TCTCCCCATATGAGCAAATGAGG - Intronic
1105927885 13:25024167-25024189 GCTCCTCACAGGGGCACAGACGG + Intergenic
1108599395 13:51978864-51978886 TCTCCACATAGCACCACTGGGGG + Intronic
1109274814 13:60291608-60291630 TTTCCTCCCAGGAGGACAGGCGG + Intergenic
1109472670 13:62830384-62830406 ACTCTTCATAGGTACACAGGAGG + Intergenic
1119178033 14:72583884-72583906 TCTGCTCATGGGGACACAGGTGG + Intergenic
1121092638 14:91193403-91193425 TGTCCTCATGGGAGCTCAGAGGG + Intronic
1121644327 14:95507491-95507513 TCTGCTCAAAGGAGCACATTAGG + Intergenic
1121996730 14:98608528-98608550 TCTCCTCCTCAGAGCACAGTGGG + Intergenic
1122941147 14:104981948-104981970 TGTCCTCAGAGGGGCACATGGGG - Intergenic
1127453317 15:59137153-59137175 CCTCTTCATAGGAACCCAGGAGG - Exonic
1132030965 15:98438283-98438305 TCTCCTCATCAGGCCACAGGAGG + Exonic
1132247286 15:100307365-100307387 TTTCCTGATGGCAGCACAGGGGG - Intronic
1132646500 16:1001639-1001661 TGTCCTCATAGAAGCAGAGGAGG - Intergenic
1138704418 16:58899647-58899669 TATCCTCAAAGAAGCACATGTGG - Intergenic
1140536542 16:75714910-75714932 TCTCCAGATAAGAGCACTGGGGG + Intronic
1141391805 16:83670998-83671020 TCTCCTCATGCGAGCACGGAGGG + Intronic
1141831868 16:86513668-86513690 TCTCCTCCGTGGACCACAGGTGG + Exonic
1142746775 17:1963331-1963353 TCTCCTCCTGGGAGCTCAGCTGG - Intronic
1143048187 17:4099967-4099989 GCTCCTGATAGGAGCAGAAGTGG - Intronic
1144072896 17:11690202-11690224 GGTCCTCATCAGAGCACAGGAGG - Exonic
1145863556 17:28226617-28226639 CCACCTCATAGGAGCTCAGGGGG - Intergenic
1147179829 17:38677292-38677314 CCTCCTCATAGGAGAAAAAGAGG + Intergenic
1147262549 17:39217105-39217127 TCTCCTCAGAGCACCAGAGGTGG + Exonic
1147364759 17:39952686-39952708 TGGCCCCACAGGAGCACAGGGGG + Intergenic
1150600105 17:66643679-66643701 TCTCCAGAAAGGAGCACAGGCGG - Intronic
1153653814 18:7264552-7264574 TCTCCTCAGAGTACCACAGTTGG + Intergenic
1153922417 18:9803647-9803669 TCTCCTTAAAGGAGCTCAGCAGG - Intronic
1154162315 18:11989712-11989734 TCTCCTTAAGGGGGCACAGGTGG - Intronic
1156445968 18:37236973-37236995 TCTCCTCATGGGAACCAAGGAGG - Intergenic
1157105221 18:44768083-44768105 TCTCTGTATAGGAGCACAGTAGG + Intronic
1159974763 18:74697260-74697282 TCTCCTCATAGGAGCACAGGAGG - Intronic
1160586378 18:79915638-79915660 TCTCCCCATCGGGCCACAGGAGG - Intronic
1161678616 19:5667520-5667542 TCTCCTTGGGGGAGCACAGGAGG + Intronic
1161866099 19:6833229-6833251 TCTCCTCAAAGGAGAACATCTGG - Exonic
1163493590 19:17631564-17631586 TCTGCTCCCAGCAGCACAGGAGG - Intronic
1163934740 19:20432627-20432649 TCTCCTCATCTGTGCACAGATGG + Intergenic
1166194783 19:41198532-41198554 TATCCTCATAGGAGAAGCGGAGG - Exonic
927445764 2:23160243-23160265 ATTCCACATAGCAGCACAGGAGG + Intergenic
928863968 2:35895586-35895608 TCTCCCCATAGCACCACAGCTGG + Intergenic
928934285 2:36658610-36658632 TCTCCTGATTGGAGCCCAGGGGG - Intergenic
930683874 2:54287242-54287264 TGTCCTCATAGCAGAAGAGGTGG + Intronic
933723117 2:85410552-85410574 TCTCCTCAGAGGGGCACACAGGG + Exonic
942674883 2:178416345-178416367 TCTCCTTATTGGAGGACAGGAGG + Intergenic
944288417 2:197977294-197977316 TGTCCTAATAGGACAACAGGGGG - Intronic
945391864 2:209274453-209274475 AATCCTCACAGGAGCACAGTGGG - Intergenic
945981685 2:216317353-216317375 GCTCCTCATGGGAGGAGAGGGGG - Intronic
946757831 2:222964797-222964819 TCTCCTCATCGCATCACACGTGG + Intergenic
949017757 2:241723029-241723051 TCTCCCCATAGGAGACCTGGTGG - Exonic
1172162633 20:32879176-32879198 TTTCATCATAGGGGCACAGGTGG + Intronic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1180142493 21:45900775-45900797 TCCCCACAGGGGAGCACAGGAGG - Intronic
1181277239 22:21694739-21694761 TCTCCTCCTAGCAGCAAAGGGGG - Exonic
1181597804 22:23928482-23928504 TCTACTCCTAGGAGCACAGTTGG + Intergenic
1182257663 22:29050190-29050212 ACTCCTCCCTGGAGCACAGGGGG + Exonic
1183017344 22:34999950-34999972 TCTCCTCTTGGGAGCTCTGGTGG - Intergenic
1183093818 22:35540717-35540739 TCTCCTCATCTGGGGACAGGAGG + Intergenic
1183591959 22:38784384-38784406 CCTCCTCATGGGCACACAGGAGG + Intronic
1184291094 22:43498558-43498580 GCTCCTCACAACAGCACAGGAGG + Intronic
950220495 3:11191747-11191769 TTTCCTCACAAGAGCACAGTTGG + Intronic
950241121 3:11371014-11371036 TCTCCAAATAGGAACATAGGAGG - Intronic
951427467 3:22564271-22564293 TCTCCTGATAAGAGCACAAGGGG + Intergenic
952924431 3:38310762-38310784 TCTCCTCATCCTAGCACATGGGG + Intronic
953119243 3:40023726-40023748 TCTCCTCTGTGTAGCACAGGGGG - Intronic
956381916 3:68673288-68673310 TATCCTCATAGAAGCACACAAGG - Intergenic
956549498 3:70442077-70442099 TCTCCTCATAGCACCATAGCTGG - Intergenic
957079153 3:75622482-75622504 TCTCTTCATAGCAGCACTGTGGG - Intergenic
959936925 3:112038857-112038879 TCTCCCCATAGGAGAGCAAGAGG + Intronic
960426463 3:117514190-117514212 TCTCATCATAGTAGCTCAGAAGG + Intergenic
963300616 3:143593207-143593229 GCTCCTCCTGGGAGCACAGGTGG + Intronic
967270705 3:187729768-187729790 ACTCCTCATCGGAGAAGAGGAGG + Exonic
969022239 4:4146437-4146459 TCTCTTCATAGCAGCACTGTGGG - Intergenic
969235396 4:5862014-5862036 GCTTCTCACAGGAGCCCAGGAGG - Intronic
969731633 4:8960956-8960978 TCTCTTCATAGCAGCACTGTGGG + Intergenic
969791227 4:9495063-9495085 TCTCTTCATAGCAGCACTGTGGG + Intergenic
974343501 4:60646348-60646370 TCTGCTCTTAGGAGGATAGGAGG - Intergenic
975883534 4:78939119-78939141 TCTGCTCGTAGGTGTACAGGCGG + Exonic
984694983 4:182770351-182770373 TCTCCTCACTGGAGAACATGAGG - Intronic
985631210 5:1015013-1015035 TTTCCTCACAGGACCACAAGGGG - Intronic
985937337 5:3107017-3107039 GTTCCTCATAGGGGCACATGGGG - Intergenic
987262026 5:16213794-16213816 TCTTCTCACAGGTCCACAGGTGG + Intergenic
988145448 5:27300052-27300074 TCTCCTTATACTAGCACATGGGG - Intergenic
992266045 5:75019099-75019121 TCTCCTCTTATGAGCACATTGGG - Intergenic
992348764 5:75907940-75907962 TCTCTTCATAGGAGCACTAATGG + Intergenic
993023745 5:82623216-82623238 TCTCCTGACAGGTACACAGGTGG + Intergenic
995666133 5:114544637-114544659 TCTCCTCTCAGGAGCTCAGGAGG - Intergenic
1000067383 5:157706474-157706496 ACTCCTAATAGCAGCACAAGAGG + Intergenic
1001618019 5:173057453-173057475 TCTCCTCACACGAGCTGAGGAGG + Intronic
1002570159 5:180135659-180135681 TCTCCTCAGAGTAACACAGCTGG + Intronic
1002841520 6:910824-910846 TGTCTTTATAGGAGCACACGGGG - Intergenic
1004424970 6:15501093-15501115 TGTCCCCAGAGGAGCACCGGCGG + Exonic
1007934748 6:45722987-45723009 TCTCCAGAAGGGAGCACAGGTGG + Intergenic
1009920701 6:70056384-70056406 TCTCTTCTTGGGAGCACAAGAGG - Intronic
1014883321 6:126748751-126748773 TCTCCCAAGAGGTGCACAGGTGG - Intergenic
1018422855 6:163654395-163654417 TCTGCTCACAGGATCTCAGGTGG - Intergenic
1018483398 6:164214690-164214712 TTTCCCAAGAGGAGCACAGGTGG - Intergenic
1018565414 6:165146338-165146360 TTTCCTTATAGGAACACAAGTGG + Intergenic
1019593373 7:1846759-1846781 CCCCCTCATAGGAGCCAAGGAGG + Intronic
1020309663 7:6858479-6858501 TCTCTTCATAGCAGCACTGTGGG - Intergenic
1023422529 7:39997576-39997598 TCTCCTCCTGGTAGCTCAGGGGG - Exonic
1023825926 7:44008817-44008839 TGTCCTCCTAGGAGCAGGGGTGG + Exonic
1027119091 7:75502983-75503005 TGTCCTCCTAGGAGCAGGGGTGG + Intergenic
1027328730 7:77068826-77068848 TTTCCTCTTAGGAGGAAAGGTGG + Intergenic
1027883824 7:83876758-83876780 TCTCCTAATATGGGCACATGAGG + Intergenic
1028125724 7:87110691-87110713 TTTCCTCATAAGAGCACGGTGGG - Intergenic
1029718407 7:102347049-102347071 TGTCCTCCTAGGAGCAGGGGTGG - Intergenic
1029754209 7:102562206-102562228 TGTCCTCCTAGGAGCAGGGGTGG + Intronic
1029772159 7:102661296-102661318 TGTCCTCCTAGGAGCAGGGGTGG + Intronic
1030995512 7:116354433-116354455 GCTCTTCATAGGAGCACAAATGG + Intronic
1032544108 7:132727657-132727679 TCTTCTCCAAGGAGCACAGTGGG - Exonic
1032568509 7:132973904-132973926 AGTCCTCATTGGAGCACAGTTGG - Intronic
1033127271 7:138717152-138717174 TCTGCACATGGGAGCTCAGGTGG + Intronic
1036122977 8:6038023-6038045 ACTCCTCATAGCAGCTCAGCAGG + Intergenic
1036915872 8:12803213-12803235 TCTCCTTATAGGATTTCAGGGGG - Intergenic
1038434566 8:27526184-27526206 CCTCCTAAGAGGAGCAGAGGTGG - Intronic
1041370502 8:57154717-57154739 TCTCTTCCTAGGATCACAGGTGG - Intergenic
1041634118 8:60123426-60123448 TCTCTTCATTTGAGGACAGGAGG - Intergenic
1046822851 8:118653123-118653145 TCTCCTCATAGGAGATCATAAGG + Intergenic
1046999758 8:120562270-120562292 TCTCCTCATCTGAACAAAGGGGG - Intronic
1047993930 8:130315605-130315627 ACACCTCATGGGAGCACAGCTGG - Intronic
1049305694 8:141902685-141902707 CCTCCTCCTCGGACCACAGGTGG - Intergenic
1052284312 9:26767733-26767755 CCTCCTAATAAGAGCAGAGGAGG + Intergenic
1052995685 9:34550665-34550687 TCTCCTCAGAGGAGGACACTTGG - Intergenic
1053041553 9:34877911-34877933 TCCCCTCCCTGGAGCACAGGGGG + Intergenic
1055226272 9:74001017-74001039 TCTCCTTATAGGAGTAGAGGGGG + Intergenic
1057559358 9:96115202-96115224 TGTCCTCGTAGGAGAACAGAAGG - Intronic
1058098219 9:100887744-100887766 TCTTCTCAGAGGAGCAAAGCAGG + Intergenic
1059958715 9:119544642-119544664 TCTCCTCCAAGGAGCAGAGCTGG + Intergenic
1060979155 9:127782853-127782875 TCTGCTCAGAGGAAAACAGGGGG + Intergenic
1062711260 9:137976351-137976373 TCTCCCCAGTGGAGCTCAGGGGG + Intronic
1189534887 X:41925302-41925324 TCTGCTCATAGGATCACAGTTGG + Intergenic
1190478064 X:50847780-50847802 TTTCCTCACAGAAGCCCAGGAGG - Intergenic
1193359929 X:80569983-80570005 GCTCCTCCTGGGAGCACAGAGGG - Intergenic
1195383387 X:104291497-104291519 CCACCTCAAAGGAGCACACGGGG - Intergenic
1197093433 X:122566198-122566220 TCTCCACATGGCAGCACAGCTGG - Intergenic
1198017820 X:132629837-132629859 TATTATCATAGGAGCAAAGGTGG - Intronic
1198449708 X:136754807-136754829 TCTGGTGACAGGAGCACAGGAGG - Intronic
1198873971 X:141203506-141203528 TCATCTCATAGGCTCACAGGTGG - Intergenic