ID: 1159981973

View in Genome Browser
Species Human (GRCh38)
Location 18:74793286-74793308
Sequence GTTTGGCATAAATCAATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159981973 Original CRISPR GTTTGGCATAAATCAATGTC TGG Intronic
905968538 1:42120725-42120747 GTTTGAAAAAAATCAATGTGAGG - Intergenic
906896880 1:49784066-49784088 GTTTGGGATTGATCAATCTCAGG - Intronic
907596775 1:55727412-55727434 GTTTTGCATAAATGAATGGGAGG + Intergenic
909720915 1:78768027-78768049 TTTTGACATAAATCAATACCAGG - Intergenic
911467628 1:98275096-98275118 GTTAGGCATAAATCTATGTAAGG + Intergenic
913375663 1:118149022-118149044 GACTGGCATTAATGAATGTCTGG + Intronic
913685216 1:121225450-121225472 GATTTGAATATATCAATGTCTGG + Intronic
914037062 1:144013055-144013077 GATTTGAATATATCAATGTCTGG + Intergenic
914152393 1:145054877-145054899 GATTTGAATATATCAATGTCTGG - Intronic
915616049 1:157039198-157039220 GTTTTTCAGAAATCATTGTCTGG - Intronic
917826823 1:178830657-178830679 GTTTGGCATGAATAGATTTCTGG + Intronic
918820370 1:189247024-189247046 ATTTGGGATAATTCAATGTGTGG - Intergenic
920472535 1:206244008-206244030 GATTTGAATATATCAATGTCTGG + Intronic
1066280818 10:33916816-33916838 GTTTTGCATCTATAAATGTCAGG + Intergenic
1066324752 10:34346720-34346742 GCTTGGCGTAAGTGAATGTCAGG - Intronic
1071403413 10:85301860-85301882 GTCAGGAATAAACCAATGTCAGG + Intergenic
1078586259 11:12592242-12592264 GTCCGGAATCAATCAATGTCTGG - Intergenic
1080364115 11:31550755-31550777 ATTTGGCAGAAAAAAATGTCTGG - Intronic
1083314325 11:61804936-61804958 GGTGGGCATAAATCCAAGTCTGG + Intronic
1086593649 11:88545021-88545043 GTTTAGCAAAAAGCAATTTCAGG - Intronic
1089464974 11:118679169-118679191 TTTTGGTAAAAATCAATGACAGG + Intronic
1089482350 11:118816371-118816393 CTTTGTCAAAAATCAATTTCTGG + Intergenic
1089740291 11:120577675-120577697 GATTGGCATAATTTCATGTCTGG - Intronic
1089934358 11:122348303-122348325 ACTTGGCCTAATTCAATGTCTGG + Intergenic
1092076850 12:5681064-5681086 GTGTGGCAGGAACCAATGTCGGG - Intronic
1093553172 12:20439310-20439332 GAATGTCATAAATCAATGTTAGG - Intronic
1095754563 12:45749878-45749900 CTTTGGCTTAAAGGAATGTCTGG + Intronic
1097983517 12:65758553-65758575 GTGTTGCATAAAGCAATGGCAGG + Intergenic
1098386924 12:69929502-69929524 GAATGGCATAAATGAAAGTCTGG + Intronic
1099135916 12:78901387-78901409 GTTTGGCAGACATTCATGTCTGG - Intronic
1102311747 12:111850512-111850534 GTTTGGCTTAAAAAAATGTCAGG + Intronic
1105433762 13:20360160-20360182 GTTTGGCATCACTCCATGGCAGG + Intergenic
1107798800 13:44083756-44083778 GTTTGGCATAAAATAATTACGGG + Intergenic
1109329880 13:60916332-60916354 GGTTGGCATCAATGAATGTTGGG - Intergenic
1114714729 14:24813270-24813292 GAAAGGCATAAATCAAAGTCGGG - Intronic
1114781841 14:25547002-25547024 GATTGGCATAAATTTATGCCAGG - Intergenic
1119316792 14:73703230-73703252 ATATGACATAAATCAATGTGAGG - Exonic
1122337483 14:101003406-101003428 CTTTTGCATAAATGAATGACTGG - Intergenic
1126628021 15:50704420-50704442 GTTTAGCAAAAATAAATGTGAGG - Exonic
1138864690 16:60802440-60802462 TTTTGGGATACATCCATGTCTGG - Intergenic
1139133066 16:64169404-64169426 GGTTGGCATGATTGAATGTCTGG - Intergenic
1142579111 17:929980-930002 CTTTGGAATCAATCAATGACGGG + Intronic
1144454119 17:15405004-15405026 GTTTCTCAGAAATCAATTTCGGG - Intergenic
1152379944 17:79937206-79937228 GTTTGGCAGAAATAGATGTGGGG - Exonic
1154476395 18:14763804-14763826 GTCTGCCAAAATTCAATGTCTGG + Exonic
1155677916 18:28452084-28452106 GTTAGGACTAAATCTATGTCTGG - Intergenic
1156824592 18:41415224-41415246 GTTTGATTTAAATCAATGGCTGG + Intergenic
1157000259 18:43514496-43514518 GGTTAGCATAAATCACTGACAGG + Intergenic
1159981973 18:74793286-74793308 GTTTGGCATAAATCAATGTCTGG + Intronic
1160207227 18:76844750-76844772 ATTTTGTATAAATCAATGTAGGG + Intronic
1160478306 18:79214749-79214771 GTGAGGCATAAATCCATGTGAGG - Intronic
1164938784 19:32235117-32235139 GATAGGCATAATTTAATGTCTGG + Intergenic
926342771 2:11918108-11918130 ATTTACCATAAATCAGTGTCTGG + Intergenic
931122863 2:59239871-59239893 GTTTGCCACAAATCAATGGGAGG + Intergenic
933871190 2:86567109-86567131 GTTAGATATAAATCAATGTTTGG + Intronic
935606464 2:104976369-104976391 CTTTTGCATAAAACAATGTTTGG + Intergenic
936134912 2:109882769-109882791 TTTTTGCCTAGATCAATGTCCGG + Intergenic
936209785 2:110488716-110488738 TTTTTGCCTAGATCAATGTCCGG - Intergenic
936720431 2:115245870-115245892 GTTTGGCATTAATTAAATTCTGG + Intronic
941664731 2:168233091-168233113 TTTTGGCATAAGTCAAGATCGGG - Intronic
942622852 2:177866365-177866387 GTTTGGAAAAAATCACTGCCTGG - Intronic
943955220 2:194180186-194180208 GTTTTACATATATCAATGTGTGG + Intergenic
944638029 2:201693630-201693652 GTTTTACATAAAACATTGTCAGG + Intronic
945570687 2:211463779-211463801 GTTTTGAATGAAGCAATGTCTGG - Intronic
946654504 2:221931511-221931533 GCTTAGCATGAAGCAATGTCAGG - Intergenic
946733674 2:222733199-222733221 GTTTGGGATATATCGATGCCAGG - Intergenic
946994816 2:225379343-225379365 GTTGGGCATAAAGCAAAGCCAGG - Intergenic
1172878856 20:38184375-38184397 GACTGTAATAAATCAATGTCAGG - Intergenic
1178615241 21:34127276-34127298 TTCTGGGATAAATCAGTGTCTGG + Intronic
1180256169 21:46629174-46629196 GTTTGTCATAAAGCAAAGTTTGG - Intergenic
1182416771 22:30226356-30226378 GTTCGGCACAGAACAATGTCTGG - Intergenic
951638124 3:24802999-24803021 GTTTGGCATACAAAAATGTCAGG + Intergenic
952777008 3:37056287-37056309 GTTTAGCAAAAATCAGTCTCTGG + Intronic
955497717 3:59552807-59552829 GTTTGGAATAAGACAATGTTGGG - Intergenic
956224959 3:66947217-66947239 GTTTGGCATAAATAAATAGAAGG - Intergenic
957651149 3:83006287-83006309 GTCAGGAATAAATAAATGTCAGG + Intergenic
958690959 3:97465654-97465676 TTTTGGCATAAAGCAATAGCAGG + Intronic
962033245 3:131623573-131623595 TTAAGGCATAAATCAATTTCAGG - Intronic
963981698 3:151545307-151545329 GTTTGGCAGAATTCACTGTAGGG + Intergenic
964026144 3:152077416-152077438 GTTTAGCATAAAACAATCTTTGG - Intergenic
964048757 3:152365043-152365065 GTTTGGCATTATACAGTGTCTGG - Intronic
966375132 3:179288912-179288934 GTAAGACATAAATCAATTTCAGG - Intergenic
966970953 3:185044972-185044994 GTTTTGCCTAAATCAAAGTTTGG - Intronic
972586501 4:40442227-40442249 ATATTGCATTAATCAATGTCTGG - Intronic
975162680 4:71141851-71141873 GCTTGGCTTGAATCAATGTTTGG + Intergenic
980535563 4:134116638-134116660 GTTTGGTGTGAATCAATGTTAGG + Intergenic
983305663 4:165982546-165982568 TTTTGGCACAAATCAAAGTCCGG - Intronic
983898397 4:173105800-173105822 ATTGGGCATAAAACAATGTGAGG - Intergenic
984445922 4:179835378-179835400 ATTTGGTATAAATGAATGTGAGG + Intergenic
986497751 5:8363456-8363478 TGTTGGCATAACTAAATGTCAGG + Intergenic
988134227 5:27148432-27148454 ATTTGGCAGAAAACAATGTTAGG - Intergenic
996222610 5:120952000-120952022 TTTTTGCAAAAAACAATGTCTGG + Intergenic
996492143 5:124110520-124110542 GTTGGGCACAAATAAATGTTGGG + Intergenic
1002995216 6:2276703-2276725 GCTTGGCATAACTGAATGTAGGG + Intergenic
1004768061 6:18753925-18753947 GTTTGGCATATCTCAGTGTGTGG - Intergenic
1005643297 6:27817109-27817131 CTTTGCCACAAATCATTGTCTGG - Intergenic
1008231901 6:48993188-48993210 TTTTCGCCTAAGTCAATGTCTGG - Intergenic
1011012962 6:82722634-82722656 GTCATGCATAAATCAATGTGAGG - Intergenic
1011465833 6:87655988-87656010 GTTTGGCCTAAAACTATGACAGG - Intronic
1011624281 6:89270752-89270774 GTGTGGAATAAATAAAAGTCGGG - Intronic
1015149777 6:130023960-130023982 GTTTGGGATAAATAAATTTCCGG - Intronic
1029069423 7:97883051-97883073 GTTTGGCCTAAACCCATTTCTGG - Intergenic
1031292647 7:119957021-119957043 GTTTGGCTTAAATATATATCAGG + Intergenic
1031615206 7:123871513-123871535 GTTTGGTACAAATGAATATCAGG - Intronic
1034765451 7:153716753-153716775 GCTTTGCATAAAACAATATCTGG - Intergenic
1036810330 8:11863751-11863773 GATTGGCAAAAATCAAAGTCTGG + Intronic
1037356048 8:18020562-18020584 GTTTTCCATAAGTCAATGTGAGG - Intronic
1040470726 8:47734027-47734049 GTTTTGTAAAAATAAATGTCAGG - Intronic
1042493896 8:69434660-69434682 GTATGGCATAACACAATGGCCGG - Intergenic
1043973130 8:86555061-86555083 GTTTGTCATAATACAAAGTCAGG + Intronic
1044345187 8:91096736-91096758 TTTTGGCATCATTCACTGTCTGG - Intergenic
1049046870 8:140159314-140159336 GTGTGGGATAAATCCATGACTGG - Intronic
1049304737 8:141895120-141895142 CTTGGTGATAAATCAATGTCGGG - Intergenic
1050153878 9:2644953-2644975 TTTTGGCATTCATCAATATCTGG - Exonic
1052521315 9:29551156-29551178 GTTTGGTCTAAATTAAGGTCAGG + Intergenic
1055767698 9:79682558-79682580 GTTTGTCATAAATCAGTGAAGGG + Intronic
1055800414 9:80029849-80029871 GTTTTGGAGAACTCAATGTCTGG + Intergenic
1059886840 9:118754445-118754467 CATTTGCATAAATCAATTTCTGG + Intergenic
1191089673 X:56606954-56606976 TCTTTGCCTAAATCAATGTCTGG - Intergenic
1193673238 X:84415821-84415843 GTTTAGCATAACTTAATGTGCGG + Intronic
1195061499 X:101199372-101199394 GTATGGCATAAACTAATATCTGG + Intergenic
1196636121 X:118004799-118004821 GTATGGGACAAATCAATATCAGG + Intronic
1197292150 X:124671851-124671873 GTCTGGAATAAATTAATGTATGG - Intronic