ID: 1159982172

View in Genome Browser
Species Human (GRCh38)
Location 18:74796448-74796470
Sequence CTATATAGAAAAATGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 349}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159982172_1159982173 -3 Left 1159982172 18:74796448-74796470 CCAAGCTGCATTTTTCTATATAG 0: 1
1: 0
2: 1
3: 34
4: 349
Right 1159982173 18:74796468-74796490 TAGCAGAGATGTGTCACACGAGG 0: 1
1: 0
2: 0
3: 4
4: 68
1159982172_1159982174 30 Left 1159982172 18:74796448-74796470 CCAAGCTGCATTTTTCTATATAG 0: 1
1: 0
2: 1
3: 34
4: 349
Right 1159982174 18:74796501-74796523 GTTCAGTATAGTAATGTCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159982172 Original CRISPR CTATATAGAAAAATGCAGCT TGG (reversed) Intronic
901454167 1:9353755-9353777 CTAAATAGAAAAAATTAGCTGGG + Intronic
902402175 1:16164163-16164185 CTATGGAGAAAAATACAGCAAGG - Intergenic
902569843 1:17340350-17340372 CTATGTAGAAGAATGCGGCAGGG + Intronic
902858253 1:19225033-19225055 CTATAGAGAAAAATAAAGCCGGG - Intronic
903029866 1:20456174-20456196 CTATTTAGAAATGTGGAGCTGGG - Intergenic
904067999 1:27770034-27770056 AAGTATAGAAAAATGCTGCTTGG + Intergenic
904759229 1:32789747-32789769 AAATATATAAAAATTCAGCTGGG - Intronic
905090038 1:35423385-35423407 CTATATTGAAAAATGGGGCTGGG + Intergenic
906442879 1:45865324-45865346 TTTGATAGAAAAATGCTGCTTGG + Intronic
906788827 1:48640968-48640990 GGATAGAGAAAAAGGCAGCTTGG + Intronic
907254043 1:53164733-53164755 CAATGTACAAAAATGCAGCAGGG - Intergenic
907490631 1:54806773-54806795 CTGTGGAGAAAAATGAAGCTGGG + Intronic
908950250 1:69552485-69552507 TTATATAGAAAACTGCTGCTTGG + Intergenic
909174255 1:72335606-72335628 CTATGAAGAAAAATACAGCAAGG + Intergenic
910558226 1:88560755-88560777 CTAAAGAAAAAAATGCTGCTGGG - Intergenic
911964188 1:104345094-104345116 CTATAAAGAAAAAATCCGCTAGG - Intergenic
912328028 1:108787263-108787285 GTGTATATAAAAATCCAGCTAGG - Intronic
913492036 1:119390021-119390043 CTATATTTAACAATGCTGCTGGG - Intronic
915691034 1:157690952-157690974 CTATGTAGAAAAATAAAGCAAGG - Intronic
916425988 1:164680644-164680666 TTTTACAAAAAAATGCAGCTAGG + Intronic
916619134 1:166476743-166476765 TTAAAGAGATAAATGCAGCTTGG + Intergenic
916713101 1:167429522-167429544 CTCTACAAAAAAATACAGCTGGG - Intergenic
918296406 1:183161250-183161272 CTATGAAGAAAAATAAAGCTGGG + Intergenic
918974600 1:191466483-191466505 CTATATAGATAAATACAACCTGG - Intergenic
919150679 1:193693856-193693878 TTATATATCAAAATGCAGATTGG - Intergenic
920037251 1:203074492-203074514 ATATATATAAAAATGCTACTAGG + Intronic
920722278 1:208398993-208399015 CTATAGAGATAAATGAAGCACGG + Intergenic
920951129 1:210572734-210572756 ATATAAAAAAAAATGTAGCTGGG + Intronic
922650498 1:227334163-227334185 ATATATTAAAAATTGCAGCTGGG + Intergenic
923120111 1:230981990-230982012 CTATAGAGAAAGATAAAGCTGGG - Intronic
924718221 1:246598587-246598609 CAATATATAAAAATGCAAATAGG - Intronic
1063954019 10:11249284-11249306 CTCTAGAGAGAAAAGCAGCTGGG - Intronic
1064979500 10:21151852-21151874 CTATAGAGAAAAATGGAGCAGGG - Intronic
1065255707 10:23865592-23865614 CTATAAAAAAAAAGGCAGTTTGG - Intronic
1065627938 10:27650381-27650403 CTATAAAAAAAAATAGAGCTGGG + Intergenic
1066077890 10:31898548-31898570 CTGCATATAAAAATGCAGTTGGG - Intronic
1066454522 10:35561327-35561349 GATTATAGAAAAATGCAGCAGGG - Intronic
1070471802 10:76787831-76787853 CTCTGTAGCAAAATCCAGCTAGG - Intergenic
1071534998 10:86421135-86421157 CAATATATAAAAATGTGGCTGGG - Intergenic
1071552454 10:86577313-86577335 TTTTATAGAAAAATGCAGGGCGG - Intergenic
1073075277 10:100821482-100821504 CTATTTAGAAAACTGAAGTTGGG - Intronic
1073663088 10:105499144-105499166 GTACATAGAAAATTGCCGCTAGG + Intergenic
1073978119 10:109123357-109123379 ATATATACAAAAATTTAGCTGGG + Intergenic
1074649771 10:115507272-115507294 CTAAAGGGAAAAATGAAGCTGGG - Intronic
1075529533 10:123217473-123217495 GTATATAGAAGGATGCACCTAGG - Intergenic
1077162571 11:1120434-1120456 CTCTATTGAAAAATGCAGCATGG - Intergenic
1077857172 11:6139779-6139801 ATAAAAAGAAAAATGAAGCTGGG + Intergenic
1078663152 11:13303409-13303431 CTATGGAGAAAAATGAAGCAAGG + Intronic
1078954332 11:16173151-16173173 CTACATAGAAAAGTGAAGTTAGG + Intronic
1079665748 11:23103447-23103469 CTTGATGGAAAAATGCAGGTAGG - Intergenic
1080831743 11:35900450-35900472 AAAAATAGAAAAATGGAGCTGGG + Intergenic
1080931112 11:36812172-36812194 ATATATGGGAAAATGCTGCTGGG - Intergenic
1081249253 11:40809515-40809537 CTATAGAAAAAAATGCAGCAGGG - Intronic
1082024418 11:47561724-47561746 CTATTTTGAACAATGCTGCTGGG - Intronic
1083047275 11:59748372-59748394 CTATTTTGAATAATGCTGCTAGG - Intronic
1085089429 11:73697646-73697668 CTATAGAGAAAAATGAAGTAGGG - Intronic
1085797935 11:79560665-79560687 CTATTTACATATATGCAGCTAGG + Intergenic
1086292120 11:85323607-85323629 ATATGTAGAAAAATACAGTTAGG - Intronic
1086547591 11:88016027-88016049 CCATATAGAAAAAAGCAGCAGGG + Intergenic
1088419496 11:109627479-109627501 ATATATAGAAAAATAAAGATAGG + Intergenic
1088695432 11:112362246-112362268 CTATAGAGAAAAATGAAGACAGG + Intergenic
1089905031 11:122029909-122029931 ATATATGGAAAAACGGAGCTGGG - Intergenic
1091156706 11:133381400-133381422 GTAGAAAGAAAAATTCAGCTTGG + Intronic
1092387450 12:8047103-8047125 CTCTATAAACAAATGTAGCTTGG - Intronic
1093759232 12:22888360-22888382 ATATAGAGAAAAATAAAGCTAGG - Intergenic
1093834741 12:23814776-23814798 CTATATATTAAAATGCAGCGTGG - Intronic
1095260464 12:40093548-40093570 CTATAGAGAAAAATAAAGCAGGG + Intronic
1095304072 12:40620384-40620406 GAATAGAGAAAATTGCAGCTAGG - Intergenic
1097808992 12:63998057-63998079 CTATAAAGAAGAATAAAGCTGGG - Intronic
1098965785 12:76786682-76786704 CAAGCTAGAAAAATTCAGCTGGG - Intronic
1099610599 12:84863748-84863770 CTATAAAGTAAAATGAAGCCAGG + Intronic
1100377777 12:94033349-94033371 GTATATGGTAAAAAGCAGCTGGG + Intergenic
1100650269 12:96579712-96579734 CTACAGAGAAAAAGGGAGCTAGG - Intronic
1101049001 12:100841490-100841512 CTACAAAGAAAGATGAAGCTGGG + Intronic
1101535810 12:105615324-105615346 TTTTAAAGAAAAATGCGGCTGGG + Intergenic
1101649014 12:106657820-106657842 CTATAAAGAAAAATAAAGCATGG - Intronic
1102386249 12:112512923-112512945 CTTTAAAGAGAAATGCTGCTGGG - Intergenic
1103497877 12:121376784-121376806 CTATAAAATAAAATACAGCTGGG - Intronic
1103632384 12:122272481-122272503 CTAAATATACAAATGCAGCCTGG + Exonic
1104162773 12:126196229-126196251 ATATATTGAAAAATACTGCTTGG - Intergenic
1104203382 12:126613990-126614012 CTATGAATAAAAATGTAGCTTGG - Intergenic
1104516097 12:129428423-129428445 CAAAATAGAAAAATGCAAATTGG - Intronic
1106390403 13:29329907-29329929 TTATAAAGACACATGCAGCTAGG - Intronic
1106441432 13:29776556-29776578 TAATAAAGAAAAATGCAGCCAGG - Intronic
1108425086 13:50291400-50291422 CTATAAAGAAATATCCATCTGGG + Intronic
1108747015 13:53406112-53406134 TTATATAGAAAAATACAATTTGG - Intergenic
1109597467 13:64575398-64575420 CAATATAGAGTAATGAAGCTAGG - Intergenic
1109777372 13:67059448-67059470 TTATAAAGAAAAATACAGCAAGG + Intronic
1110292136 13:73819687-73819709 CCATATAGAAAAATGAAGCAGGG + Intronic
1111525832 13:89467591-89467613 CTAAAGGGAAAAATGAAGCTGGG - Intergenic
1111793195 13:92884804-92884826 CTATAAAGAGAGTTGCAGCTTGG + Intergenic
1113677870 13:112220663-112220685 CCCTATAGAAAACAGCAGCTGGG - Intergenic
1114344834 14:21783530-21783552 CTGTATCCAAACATGCAGCTGGG + Intergenic
1114592779 14:23883105-23883127 CTATCTAGAATAAAGCAGATAGG + Intergenic
1116800490 14:49438698-49438720 CTATTTAGAAAATTTCATCTCGG + Intergenic
1117051246 14:51861550-51861572 CAAAATAAAAAAGTGCAGCTGGG + Intronic
1118373545 14:65157745-65157767 CTATAGAGAAAAATAAAGCAGGG + Intergenic
1118718579 14:68577676-68577698 CTATATAGAAAAATAAAGCAGGG - Intronic
1119023728 14:71136503-71136525 CTATATGCAAATATGCTGCTAGG - Intergenic
1121084868 14:91138194-91138216 CTATAAAGAAATACGCAGCTGGG + Intronic
1121268736 14:92623437-92623459 CTATTAATAAAAATGTAGCTTGG - Intronic
1121695607 14:95909593-95909615 CTTTATAGGGAAATCCAGCTAGG + Intergenic
1122073520 14:99221009-99221031 AAATATAAAAAAATGTAGCTGGG - Intronic
1122146883 14:99695996-99696018 TTAAATATAAAAATGCAGATAGG - Intronic
1125764951 15:42128584-42128606 ATATATATAAAAATTTAGCTGGG + Intergenic
1125811429 15:42544903-42544925 CTATAGAGAAAAAGTCATCTTGG + Intronic
1127135486 15:55918078-55918100 ATATAAAGAAATGTGCAGCTTGG - Intronic
1128101642 15:65005767-65005789 CTAAATACAAAAATTTAGCTGGG - Intronic
1129537887 15:76329298-76329320 ATATATTGAAAAATACATCTGGG - Intergenic
1130275459 15:82473882-82473904 CCATATATAAAAATGAAGCAGGG + Intergenic
1130467819 15:84201277-84201299 CCATATATAAAAATGAAGCAGGG + Intergenic
1130485865 15:84398231-84398253 CCATATACAAAAATGAAGCAGGG - Intergenic
1130496446 15:84472265-84472287 CCATATATAAAAATGAAGCAGGG - Intergenic
1130590111 15:85205875-85205897 CCATATATAAAAATGAAGCAGGG + Intergenic
1131607002 15:93916737-93916759 CTAAATAGAAAAAATTAGCTGGG - Intergenic
1131685527 15:94763495-94763517 CTATATAACAAGGTGCAGCTAGG + Intergenic
1134263045 16:12669035-12669057 CTCTTTTGAAAAATGCTGCTAGG - Intronic
1134854600 16:17507747-17507769 CTAGAAAAATAAATGCAGCTGGG + Intergenic
1135160209 16:20087665-20087687 CAACAGACAAAAATGCAGCTAGG - Intergenic
1135929341 16:26723506-26723528 CAATAGAAAAAAATGTAGCTGGG + Intergenic
1136916591 16:34207854-34207876 CTCTAAAGAAATATTCAGCTCGG + Intergenic
1138762141 16:59557761-59557783 CTATATAGAAGAATGCTACAGGG - Intergenic
1139200662 16:64973508-64973530 ATTTAAAGAAAAATGCAGCCTGG + Intronic
1139772116 16:69286386-69286408 CTACAATGAAAAATGAAGCTGGG + Intronic
1140243170 16:73223012-73223034 CAATATAAAAAAATGAATCTAGG + Intergenic
1140404119 16:74696489-74696511 CCTTTAAGAAAAATGCAGCTGGG + Intronic
1141578143 16:84978436-84978458 TTTTATAGAAAAATATAGCTGGG + Intronic
1142360328 16:89623143-89623165 CTATTTTTAAAAATGCTGCTGGG + Intronic
1143286725 17:5795478-5795500 CAGTAAAGAAAACTGCAGCTTGG - Intronic
1144634383 17:16895521-16895543 CTCTACTGAAAAATACAGCTGGG - Intergenic
1145772970 17:27506696-27506718 CACCACAGAAAAATGCAGCTTGG - Intronic
1145857054 17:28169970-28169992 CCATAAAGAAAAATGTAGCCAGG + Intronic
1146296895 17:31657396-31657418 CTAAACAGAAACATGCAGCTGGG + Intergenic
1146546187 17:33740840-33740862 CTATATAGGAAAATGAATCTAGG + Intronic
1146823023 17:35999854-35999876 CTAAATAGAAAAATGCAGCCAGG + Intronic
1149487468 17:57054126-57054148 TTATATGCAAAAATGCTGCTGGG - Intergenic
1150068940 17:62136351-62136373 AATTATAGAAAAATGAAGCTGGG + Intergenic
1151471495 17:74321061-74321083 GTATATAGAAAAAAGGACCTGGG + Intergenic
1152387304 17:79982437-79982459 CTTTACAGAAAAATGAAGCTGGG - Intronic
1153748748 18:8208438-8208460 CTATGGAGAAAAATAAAGCTGGG + Intronic
1153764634 18:8363851-8363873 CTGTAAAGAAACATGCAGCCTGG - Intronic
1155706587 18:28823555-28823577 CTTTACAAAAAACTGCAGCTAGG - Intergenic
1156134030 18:34014423-34014445 ATATAAAGTAAAATGCAGCTGGG + Intronic
1156696979 18:39779223-39779245 CTAAATAGAAAAAATTAGCTGGG - Intergenic
1158045920 18:53155205-53155227 CTAGCTAGAAAAATTCATCTGGG - Intronic
1158575404 18:58633129-58633151 CTAAATACAAAAAAGTAGCTGGG - Intergenic
1158585744 18:58732754-58732776 ATATAAAAAAGAATGCAGCTAGG - Intronic
1158955050 18:62529657-62529679 CTGCATAGAAAAATGTAACTGGG - Intronic
1159982172 18:74796448-74796470 CTATATAGAAAAATGCAGCTTGG - Intronic
1160270471 18:77378947-77378969 CTATTTAAAAAAATGCTGTTGGG + Intergenic
1161656204 19:5516810-5516832 GTATATAGAAAAAATTAGCTGGG - Intergenic
1162288495 19:9759948-9759970 ATAAAGTGAAAAATGCAGCTTGG + Intronic
1163286885 19:16354241-16354263 CTAAAAAAAAAAATGCAGGTAGG - Intergenic
1163905302 19:20147206-20147228 TTACATAGTAAAATGCAGCTGGG - Intergenic
1164033321 19:21431328-21431350 CTATAGAGACAATTGTAGCTAGG - Intronic
1164111420 19:22163044-22163066 CTGTGTAGAAAACAGCAGCTAGG - Intergenic
1164195881 19:22958454-22958476 CTGTGTAGAAAACAGCAGCTAGG - Intergenic
1166591170 19:44000808-44000830 CCTTATACAAAAATGAAGCTGGG - Intergenic
1167421506 19:49406673-49406695 CCATCTATAAAAATGGAGCTAGG - Intronic
1168111289 19:54192557-54192579 CAAAAAAGAAAAATGCAGCTGGG - Intronic
1168513180 19:56989706-56989728 CTATGAAGAAAAATACAGCAGGG + Intergenic
926229936 2:10994667-10994689 CTATGGAGAAATATGAAGCTGGG - Intergenic
927375267 2:22405888-22405910 ATATATAGATAATTGCAGGTTGG + Intergenic
928233707 2:29522026-29522048 CACCATAGAAAAATGCAGCTGGG + Intronic
928367430 2:30713612-30713634 CTCTAAAGAACAATGCAGATGGG - Intergenic
928567980 2:32573034-32573056 CTATATAGAAAACTAAAGCAGGG - Intronic
928970016 2:37018192-37018214 TTATAAAAAAAAATGCAACTAGG + Intronic
929487436 2:42367478-42367500 CTATAAAGAAAAAAAAAGCTAGG + Intronic
930060603 2:47285308-47285330 CTAAATATAAAAATTTAGCTGGG + Intergenic
930187801 2:48427673-48427695 CTATATAAATAAATGCACTTTGG + Intergenic
930228977 2:48824622-48824644 CTATACTGAAGGATGCAGCTTGG + Intergenic
930384064 2:50670087-50670109 CTAGATAAATATATGCAGCTAGG - Intronic
931060303 2:58521416-58521438 CTTTATAGAACAATTCAGATTGG + Intergenic
933116714 2:78482566-78482588 CTATAAAGAAAAATTAAACTAGG + Intergenic
933461239 2:82588577-82588599 CTTTATAGAATATAGCAGCTAGG + Intergenic
933507239 2:83192876-83192898 GTATAAAGAAAATTTCAGCTGGG - Intergenic
935053709 2:99546441-99546463 CTAGAGAGAAAAATGCAGAAAGG - Intronic
936009292 2:108915088-108915110 TTATAGAGAAAAATGCACGTTGG + Intronic
936880520 2:117244807-117244829 ATATTTAACAAAATGCAGCTGGG + Intergenic
937013050 2:118578635-118578657 CTATGAAGAAAAATAAAGCTTGG - Intergenic
937081156 2:119140942-119140964 CTGTAAAGAAAACTGAAGCTAGG + Intergenic
938122769 2:128645318-128645340 CTAAAGAGAAAAATCAAGCTGGG + Intergenic
939172893 2:138716160-138716182 CTATTTAAAAAAATGGAGTTCGG - Intronic
939803227 2:146738954-146738976 CAAAAAAGAAAAATTCAGCTGGG - Intergenic
939937311 2:148308813-148308835 CTTTATAGAAAAATGAACTTAGG - Intronic
941004884 2:160237777-160237799 CTATAAAGCAAAATACAGCAGGG - Intronic
941095277 2:161233233-161233255 TTATATAGATATATGTAGCTGGG + Intronic
941284609 2:163593951-163593973 CTAGAATGAAAAATGCAGTTGGG - Intronic
941530583 2:166665536-166665558 CTAAGTAGAAAAATGGAGCAAGG - Intergenic
943355947 2:186856124-186856146 ATAAAAAGAAAAATGCAACTAGG - Intergenic
946470417 2:219955330-219955352 ATAAATAGAAAAATACAGCTAGG - Intergenic
1170892004 20:20383895-20383917 TTATATTTAAAAATGAAGCTAGG - Intergenic
1171471608 20:25376607-25376629 CTATAAAGAAAAATAAAGCAAGG - Intronic
1172169722 20:32921988-32922010 CTAGAAATAAAAAAGCAGCTGGG - Intronic
1172669633 20:36626096-36626118 CTTTAAAAAAAAATACAGCTGGG + Intronic
1173067257 20:39725100-39725122 ACATAGAGAAAAATGTAGCTAGG - Intergenic
1173206209 20:40996094-40996116 CTAAATATAAAAATTTAGCTGGG - Intergenic
1174608597 20:51780228-51780250 CCTAATATAAAAATGCAGCTGGG - Intergenic
1175010858 20:55734229-55734251 CTATATAGAAAAATGCCAGAAGG + Intergenic
1175347523 20:58291658-58291680 ATACATAGAAAATTGCATCTAGG + Intergenic
1178181326 21:30165111-30165133 CCAAATAGAAAATTGCAGTTTGG - Intergenic
1178448977 21:32674384-32674406 CTATAGAGAAAAATAAAGCAGGG - Intronic
1180644340 22:17326171-17326193 CAAAATACAAAAATGTAGCTGGG + Intergenic
1181541722 22:23576725-23576747 CTATGTATAAAAATGGAGCGGGG - Intronic
1182031953 22:27166154-27166176 CTATATAATAAAATGAAGATGGG + Intergenic
1183386296 22:37517340-37517362 TTATATAAAAAAATTCAGCTAGG + Intronic
952468332 3:33616170-33616192 CTAAAAAGAAAAAGTCAGCTGGG + Intronic
954090147 3:48277714-48277736 CTATTAATAAAAATGTAGCTTGG + Intronic
954526682 3:51278023-51278045 CTATATTGTAGAATGAAGCTGGG + Intronic
955174527 3:56600440-56600462 CTATAAAGATACATGCAGCCGGG - Intronic
958953529 3:100441964-100441986 CTATATAAAAATATAAAGCTAGG - Intronic
959186450 3:103052936-103052958 GTATGTAAAAAAATGGAGCTTGG - Intergenic
959189459 3:103091818-103091840 CTCTATAGAAAAATAAAACTAGG - Intergenic
959691110 3:109199301-109199323 CTAAATAGATAAATGCCTCTAGG + Intergenic
960614463 3:119584265-119584287 TTTTAAAGAAAAATGCGGCTAGG + Intronic
960891181 3:122450284-122450306 ACATATTAAAAAATGCAGCTGGG + Intronic
961523752 3:127483637-127483659 CTAAGGAGAAAAATGGAGCTGGG - Intergenic
962662217 3:137614333-137614355 CTACAAAGCAAAATGCACCTGGG + Intergenic
963585372 3:147180226-147180248 TTATATTTAAAAATGCATCTTGG - Intergenic
963990486 3:151647781-151647803 ATATATTTTAAAATGCAGCTGGG + Intergenic
964285601 3:155114431-155114453 CTATATAAACAAATGCAAATTGG + Intronic
964434242 3:156635290-156635312 CTATGAAGAAAAATGAAGCAGGG - Intergenic
964603064 3:158524696-158524718 TTATATAGAACAATGGAGCAGGG + Intronic
964628061 3:158777976-158777998 TCATTTAGAAAAATGCAGATGGG + Intronic
965443260 3:168743055-168743077 CTTGCTAGAAAAATGCATCTTGG + Intergenic
967703836 3:192626449-192626471 CTATAAGGAAAATTTCAGCTGGG + Intronic
970438254 4:16056552-16056574 CTATAAAGAAAAATGAAGCAAGG + Intronic
970881245 4:20934745-20934767 CTATGTAGAAAAATAAAGCAAGG + Intronic
971318170 4:25584507-25584529 CGGGATAGACAAATGCAGCTCGG + Intergenic
971649471 4:29254229-29254251 CTAAAAAGAAAAATGGAGCCTGG + Intergenic
971853803 4:32018015-32018037 CTCTTCAGAAAAATGGAGCTGGG - Intergenic
971931930 4:33096043-33096065 CAATTTCTAAAAATGCAGCTAGG + Intergenic
973607189 4:52599609-52599631 CTATATGGAAAAAAGCAGAAAGG + Intronic
973671263 4:53220175-53220197 CTATGAAGAAAAATGAAGCTGGG - Intronic
973730418 4:53817173-53817195 AGAAATAGCAAAATGCAGCTGGG - Intronic
974744897 4:66059318-66059340 CCATATGGAAAAATGAAGCCTGG - Intergenic
974999033 4:69197275-69197297 CTGTATAGAAAAATACAACTTGG - Intronic
975730575 4:77333766-77333788 CTATAAACAAAAATGTAGATTGG - Intronic
976152719 4:82108181-82108203 CAAGATATAAAAATGCAGGTTGG - Intergenic
977077051 4:92467814-92467836 GGATATAGAAAATTGAAGCTAGG + Intronic
977095641 4:92740310-92740332 CCATAAAGAAAAATGCAGAAAGG - Intronic
977296400 4:95214309-95214331 CTGTTTATAAAAATGAAGCTAGG - Intronic
977590888 4:98825472-98825494 CTATGTTGAAAAATAAAGCTAGG + Intergenic
978407325 4:108394404-108394426 CTCTAGATAAAAATGCAGCTTGG + Intergenic
978927461 4:114265561-114265583 GATTATAGAATAATGCAGCTAGG - Intergenic
979411853 4:120389007-120389029 ATATATGGAAACATGCAGTTAGG - Intergenic
980505633 4:133716622-133716644 CTAAATAGAAAAGTCAAGCTGGG - Intergenic
980567172 4:134558825-134558847 TTATAAAGAAAATTACAGCTGGG + Intergenic
980963178 4:139496625-139496647 AGATTTAGAAAAATGCAGCTGGG - Intronic
981053120 4:140331361-140331383 CTATAAAGAAAAAGGCCACTTGG - Intronic
982418786 4:155168956-155168978 CTATATAAGAAAATGTAGGTAGG - Intergenic
982539362 4:156648668-156648690 CTATATACAACAAAGCAGATTGG + Intergenic
982644415 4:158005312-158005334 CTATAGAGTAAAATACAACTAGG + Intergenic
983107383 4:163705183-163705205 CTTTAAAGTAAAATACAGCTCGG - Intronic
984269573 4:177534937-177534959 CTGTTTATAAAGATGCAGCTAGG - Intergenic
984930006 4:184838719-184838741 CTATAAAGAACAAAGCAGGTTGG + Intergenic
984943964 4:184956795-184956817 CTAAATACAAAAAACCAGCTGGG + Intergenic
986083516 5:4418935-4418957 CTCTATAAAAAAATATAGCTGGG + Intergenic
986523830 5:8650729-8650751 CAATATAAAAAAATACATCTAGG - Intergenic
987425623 5:17769441-17769463 TGTTATGGAAAAATGCAGCTGGG - Intergenic
987805816 5:22766421-22766443 CCTTATTGATAAATGCAGCTTGG - Intronic
987927223 5:24358174-24358196 CTATATAAAAAAATGCCATTGGG + Intergenic
988583266 5:32486893-32486915 GTATATTGAAAACTACAGCTGGG - Intergenic
990321907 5:54638202-54638224 CTATATCTAAAAATGCACCGTGG - Intergenic
992555903 5:77903440-77903462 CCATATAGAAAAATGTGTCTTGG + Intergenic
992875431 5:81049877-81049899 CAATATAGAAAAATACATGTTGG - Intronic
993432354 5:87847425-87847447 CTTTAAAAAAAAATGTAGCTTGG - Intergenic
993957918 5:94259539-94259561 CTATAGAGGAAAATACTGCTAGG - Intronic
994275719 5:97834629-97834651 GTAAATAGAAAAATGCAGAAAGG + Intergenic
994337746 5:98588692-98588714 TTATAGATAAAATTGCAGCTGGG + Intergenic
995581176 5:113604644-113604666 CAATATACAGAAATACAGCTGGG - Intergenic
995614934 5:113951264-113951286 CTATATACCAAACTGCAACTCGG - Intergenic
995732476 5:115260869-115260891 CCATATAGAATAATGCACATTGG - Intronic
996450974 5:123624542-123624564 CTATTTAGAAAGGTGCAGCAGGG - Intergenic
998181615 5:139949965-139949987 CTAAATAGCAAAAGGCTGCTGGG + Intronic
998193489 5:140046188-140046210 GTATATTAAAAAATGCGGCTGGG + Intergenic
999412303 5:151362291-151362313 CTATATAGAAACAGTGAGCTTGG - Intergenic
1000747237 5:165048561-165048583 CTACATAGAAAATTTCAGCCAGG - Intergenic
1000856101 5:166400290-166400312 TAATATAGAAAAATGGGGCTGGG + Intergenic
1002012277 5:176292883-176292905 CTATGTATAAAAAGGCAACTGGG - Intronic
1002806783 6:584334-584356 CTATTTTAAAAAATACAGCTAGG - Intronic
1004391728 6:15215673-15215695 CTATAAAGAAAAATACAGGCTGG + Intergenic
1008209061 6:48699096-48699118 ATATGTAGAAGAATGAAGCTGGG + Intergenic
1008752173 6:54748487-54748509 CTATCAAGAATAATGCTGCTAGG + Intergenic
1008765040 6:54902116-54902138 CTATCTTTAAAAATACAGCTTGG - Intronic
1009274941 6:61663513-61663535 ATATATATATATATGCAGCTGGG + Intergenic
1010706138 6:79113078-79113100 CTATTAAGAAAAATAAAGCTAGG - Intergenic
1011231115 6:85163522-85163544 CTAGAGACAAAAAAGCAGCTGGG - Intergenic
1011598803 6:89041132-89041154 CTATAGAGAAAAATAAAGCAGGG - Intergenic
1011928025 6:92672647-92672669 CTAGAAAGAAAAAGGCAGCCTGG + Intergenic
1011970459 6:93216092-93216114 ATATGCAGAAAAATGAAGCTGGG - Intergenic
1012278321 6:97299675-97299697 CTAGATAGAGATATGCAGTTGGG + Intergenic
1012546023 6:100420421-100420443 CGATGTAGAAAAATGCATCTTGG - Intronic
1013634393 6:112015577-112015599 CTATAAAGAGAAATGAAGCTGGG + Intergenic
1013758644 6:113490093-113490115 CTACATAGAAAAATTCCACTTGG - Intergenic
1013822718 6:114174696-114174718 CTATAAAGCAAAATGCAGGCCGG + Intronic
1015074279 6:129135750-129135772 CTATATAGGAATACACAGCTAGG - Intronic
1015980983 6:138838416-138838438 ATATATAGAGAAATGAAGCGTGG - Exonic
1016130196 6:140458515-140458537 CTATATAGAACATTGTAGATAGG - Intergenic
1016410494 6:143778118-143778140 CAATATATAAAACTACAGCTAGG - Intronic
1017186199 6:151603094-151603116 CTATAAAGAAATACCCAGCTGGG - Intronic
1017533492 6:155321587-155321609 CTATATTGCAAAATGCAACATGG - Intergenic
1020225976 7:6280281-6280303 CTACACAGAAAATTCCAGCTGGG + Intergenic
1020563813 7:9770912-9770934 ATATATAGAATAAGGGAGCTTGG + Intergenic
1020975857 7:15005705-15005727 CATCATAGAAAAATGTAGCTTGG - Intergenic
1021710273 7:23409372-23409394 CTATACACAAAAATTCTGCTGGG - Intronic
1022930063 7:35101955-35101977 CTATGTGGAAAAAGTCAGCTGGG + Intergenic
1024559195 7:50629274-50629296 GTTTAAAGAAAAATGCAGCAGGG - Intronic
1027113365 7:75458366-75458388 CTAAATATAAAAAATCAGCTGGG + Intronic
1027781397 7:82524883-82524905 CTATAGAGAAAATTGGAGATTGG + Intergenic
1027810888 7:82895913-82895935 CTCTATAGAAAAATACAGCCAGG + Intronic
1028577141 7:92364582-92364604 ATATATAAAGAAATGCAGGTAGG - Intronic
1029676546 7:102073471-102073493 TTATTTAGAAAACAGCAGCTAGG - Intronic
1030266344 7:107625970-107625992 TAAAAAAGAAAAATGCAGCTAGG + Intronic
1030382953 7:108834171-108834193 ATATTTAGAAGAATGAAGCTAGG - Intergenic
1030963932 7:115965073-115965095 CTATACAGAAAACTCCAGTTAGG - Intronic
1032354392 7:131196290-131196312 CAATATAAGAAAATGCAGCTAGG + Intronic
1033449090 7:141447206-141447228 CTATGGAGAAAAATAAAGCTGGG + Intronic
1034170499 7:149059305-149059327 CTAAAAAAAAAAATACAGCTGGG + Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034704880 7:153132314-153132336 CTATAAAAAAAAAGGCAGCTAGG + Intergenic
1036996011 8:13657339-13657361 CTGGCTAGAAGAATGCAGCTGGG - Intergenic
1037503567 8:19507929-19507951 TGATATAGAAAGATGCATCTAGG - Intronic
1037984277 8:23277365-23277387 CCATATAGAAAAATATAACTGGG - Intronic
1038042844 8:23740565-23740587 CTTTAAAAAGAAATGCAGCTGGG + Intergenic
1038683285 8:29690729-29690751 CTATAGAGAAAAATTATGCTTGG + Intergenic
1038923021 8:32106671-32106693 ATATATAGAAGAAAGCAGCAAGG + Intronic
1038978784 8:32732966-32732988 CTAAATACAAAAAATCAGCTGGG - Intronic
1039576499 8:38628089-38628111 ATATGTAGAAAAATAAAGCTGGG + Intergenic
1041077579 8:54183266-54183288 CTATAAATAAAAAAGCAGCTGGG - Intergenic
1041954649 8:63543999-63544021 CTATTTAGTAAAATACAGTTGGG - Intergenic
1043083086 8:75791385-75791407 TTACATAGAAAACTGAAGCTTGG - Intergenic
1044159616 8:88896812-88896834 CTTTCTAGAAAAAAGCAGGTAGG - Intergenic
1044334246 8:90959810-90959832 TTATATAGGTAAAGGCAGCTAGG - Intronic
1044412812 8:91903014-91903036 TTATAAAGAAACTTGCAGCTAGG + Intergenic
1045999508 8:108402338-108402360 CTAGATTGCAAAATGCAACTGGG - Intronic
1046116927 8:109795944-109795966 CTATAAAGAAAAAGGCAAGTTGG - Intergenic
1046280381 8:112021473-112021495 CTATATAAAAAAAGTCTGCTAGG - Intergenic
1046807022 8:118490029-118490051 GTCTATAGAAAAAGGCAGATAGG + Intronic
1047146932 8:122212328-122212350 CTATAGAGAAACATGAAACTTGG + Intergenic
1047312244 8:123701960-123701982 ATATATAGAAAGATGAAGATGGG - Intronic
1050921617 9:11209730-11209752 CTAAACAGAAAAATAGAGCTGGG - Intergenic
1051567261 9:18514623-18514645 CAATATAGAAAAATCAGGCTGGG - Intronic
1052604825 9:30686407-30686429 CTATAAAGACACATGCAGCTGGG + Intergenic
1053010768 9:34631629-34631651 CCATGGAGAAAAATGTAGCTGGG + Intergenic
1055206000 9:73731257-73731279 CTATATTGAAACATGAAGCTGGG + Intergenic
1055442151 9:76347183-76347205 CTACACAGAAAGATGCAGCTTGG - Intronic
1055717677 9:79136018-79136040 CAATATACAAAAAAGCTGCTTGG + Intergenic
1056540827 9:87569442-87569464 CCATATAGAAATACGCAGATAGG + Intronic
1056808983 9:89749877-89749899 CTTTAGAGGAAAATGAAGCTCGG + Intergenic
1057949794 9:99360563-99360585 CAAAACAGAAAAATGAAGCTGGG - Intergenic
1058260670 9:102826552-102826574 CTATTTAGTAATATTCAGCTAGG - Intergenic
1058634019 9:107019102-107019124 CTAAGTAAAAATATGCAGCTTGG + Intergenic
1059783888 9:117559432-117559454 AAATTAAGAAAAATGCAGCTGGG + Intergenic
1061259727 9:129473248-129473270 CTAAATACAAAAAAGTAGCTGGG + Intergenic
1061279202 9:129587363-129587385 CTAAATAGAAAAAATTAGCTGGG + Intergenic
1061400725 9:130366907-130366929 CTATGGAGAAAAATAAAGCTAGG + Intronic
1061786673 9:133033111-133033133 CTATAAATAAAAATGTAGATTGG - Intronic
1185665961 X:1765873-1765895 TTAAAAAAAAAAATGCAGCTGGG + Intergenic
1185745470 X:2569274-2569296 ATAAATGGAAAAATGCAGCCAGG - Intergenic
1186132679 X:6485485-6485507 CTACATGGAAAAATACAACTTGG - Intergenic
1186400435 X:9253712-9253734 CTACATAAAAAAATTTAGCTGGG + Intergenic
1187360259 X:18619479-18619501 GTAAATAGAAAAATGAAGGTAGG + Intronic
1187517305 X:19983909-19983931 AAATATAAAAAAATGTAGCTGGG + Intergenic
1188134485 X:26478031-26478053 TTATATAGAGAAATGCTTCTGGG + Intergenic
1188661902 X:32770838-32770860 CTATAAAGAAAAATAGAGCAAGG + Intronic
1188856619 X:35204306-35204328 CTCTATAGAAATATGCTGCCTGG + Intergenic
1189926158 X:45957814-45957836 CTATAGAGATAAATTCAGCAGGG + Intergenic
1192353528 X:70378195-70378217 CTATATTAAAAAATGCAGAAAGG + Intronic
1192708514 X:73554888-73554910 GTATAAAGAAAAATGCAACATGG + Intergenic
1193109695 X:77715682-77715704 ATATAAAGAAAACTACAGCTAGG - Intronic
1193474525 X:81946771-81946793 AAATATAGAAAAAAGTAGCTGGG - Intergenic
1194937785 X:99971518-99971540 CTATAGAGAAAAATAAAGCTTGG - Intergenic
1195416460 X:104625362-104625384 GTACATAAAAAAATACAGCTTGG + Intronic
1196335369 X:114525828-114525850 ATATATAGAAAAAATTAGCTGGG + Intergenic
1198046360 X:132907164-132907186 CTATAAAGGAAACTGAAGCTGGG - Intronic
1198108130 X:133480192-133480214 CTATGGAGAAAAATGAAGCAGGG + Intergenic
1198269726 X:135044828-135044850 CTATATTGAAAAATGAACATTGG - Intergenic
1198587153 X:138135008-138135030 CTATATGGATAAATGCAGGAAGG - Intergenic
1199022870 X:142902908-142902930 TTATATACAAAAATTAAGCTAGG - Intergenic
1201269085 Y:12237016-12237038 CTAAAGAGAAAAGTCCAGCTGGG + Intergenic
1201411935 Y:13707247-13707269 CTTTATAAAAACATTCAGCTGGG - Intergenic
1202132493 Y:21626110-21626132 ACATAGAGAAAAATGTAGCTAGG + Intergenic
1202368365 Y:24181851-24181873 CCATATACAAAAATGAAGCAGGG - Intergenic
1202502420 Y:25488266-25488288 CCATATACAAAAATGAAGCAGGG + Intergenic