ID: 1159983261

View in Genome Browser
Species Human (GRCh38)
Location 18:74811874-74811896
Sequence TGGGGTAAGGGGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23542
Summary {0: 2, 1: 65, 2: 1066, 3: 11025, 4: 11384}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159983261 Original CRISPR TGGGGTAAGGGGAAGGGGGA GGG Intronic
Too many off-targets to display for this crispr